ID: 1130246709

View in Genome Browser
Species Human (GRCh38)
Location 15:82258012-82258034
Sequence GTGTGGGTTGGGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1000
Summary {0: 2, 1: 1, 2: 6, 3: 93, 4: 898}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130246709_1130246719 11 Left 1130246709 15:82258012-82258034 CCAGCTTCCCTCCCAACCCACAC 0: 2
1: 1
2: 6
3: 93
4: 898
Right 1130246719 15:82258046-82258068 AATCGATCTTCAAGTCTATTGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1130246709_1130246718 10 Left 1130246709 15:82258012-82258034 CCAGCTTCCCTCCCAACCCACAC 0: 2
1: 1
2: 6
3: 93
4: 898
Right 1130246718 15:82258045-82258067 AAATCGATCTTCAAGTCTATTGG 0: 1
1: 0
2: 1
3: 9
4: 101
1130246709_1130246720 23 Left 1130246709 15:82258012-82258034 CCAGCTTCCCTCCCAACCCACAC 0: 2
1: 1
2: 6
3: 93
4: 898
Right 1130246720 15:82258058-82258080 AGTCTATTGGGTCTACCCTGTGG 0: 1
1: 0
2: 0
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130246709 Original CRISPR GTGTGGGTTGGGAGGGAAGC TGG (reversed) Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900736109 1:4300400-4300422 GGGTGGGTTGGTAGGAAAGGTGG + Intergenic
901396642 1:8986795-8986817 GTCAGGGTTGGGCGGGAGGCAGG + Intergenic
901877385 1:12174721-12174743 GAGGGGGTAGGGAGGGCAGCTGG - Intronic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
902291799 1:15440318-15440340 GGATAGGTTGGGCGGGAAGCTGG - Exonic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902360829 1:15941830-15941852 CTGTGGGGTGGGTGGGGAGCTGG - Intergenic
902555662 1:17245167-17245189 GTGTGTGTTGGGAGGAAATTAGG + Exonic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902630384 1:17701244-17701266 GTGAGGGTTGGAAGGGGAGGGGG + Intergenic
903226630 1:21897445-21897467 GTAGGGGTGGGGAGGGAAGGGGG - Intronic
903253256 1:22072475-22072497 TTGTGGGTGGGGAGGGATTCAGG + Intronic
903379407 1:22886340-22886362 GAGGAGGTTGGGAGGGAGGCTGG + Intronic
903740706 1:25556895-25556917 GTGTGGGATGGGAGGGAGAGGGG + Intronic
903827856 1:26158352-26158374 GTGTGGGCAGAGAAGGAAGCGGG + Intergenic
903892414 1:26578511-26578533 ATCTGGGGTGGAAGGGAAGCTGG + Intergenic
903995942 1:27305634-27305656 GGGTGGGTAGCCAGGGAAGCTGG + Intronic
904173847 1:28611261-28611283 GGGAGGGTTGGGAGGGACGGAGG + Intronic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
904605650 1:31696317-31696339 GGGTGGGTGGGGGGGGAAGGAGG - Intronic
904699258 1:32348606-32348628 GGCTGGGCTGGGAGGGAAGATGG - Intergenic
904876847 1:33661928-33661950 GTGTGTGGTGGGAGGGAGGGGGG - Intronic
904881482 1:33700733-33700755 GTGTGGGTTGTGGGGTAAGGAGG - Intronic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
905587552 1:39132757-39132779 GTGGGGGGTGGGAAGGAAGGAGG + Intronic
905737171 1:40337561-40337583 GTGGGGTTGGGGAGGGAAACCGG - Intergenic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906407844 1:45556241-45556263 GTGTGGGTTGAGTGGGGAGGAGG - Intronic
906409839 1:45569595-45569617 ATTGGGGTTGGGAGGGAAGTCGG + Intronic
906521938 1:46472368-46472390 GTGTGTGTTGGCAGGGGGGCAGG - Intergenic
906534231 1:46543003-46543025 GTGGGGGTGGGGAGGGGGGCAGG - Intergenic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907506538 1:54923163-54923185 GGGTGGGGAGGGAGGGAGGCAGG - Intergenic
907768695 1:57438024-57438046 GTAAGGGCTGGGATGGAAGCTGG - Intronic
908210104 1:61891468-61891490 GTGTGAGTTGGGAGAGAAAAGGG + Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909618025 1:77634660-77634682 GTGTGGTTTGGGAGATGAGCAGG + Intronic
910158102 1:84243261-84243283 GTGGGGGTGGGGAGGGAACCAGG + Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
911137692 1:94458954-94458976 GTGGAGGAGGGGAGGGAAGCGGG - Intronic
911705566 1:101008381-101008403 GTGAGGATTGGGAGGGAGACTGG - Intronic
912432963 1:109639193-109639215 AAGTTGGTTGGGAGAGAAGCAGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913389647 1:118296202-118296224 GTGTGTTGTGGGAGGGAAGGTGG - Intergenic
913486563 1:119337092-119337114 GCTTGGGTGGGGAGGGAAGCTGG - Intergenic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914320583 1:146555566-146555588 GTGGGGGTTGGGTGGGGAGTTGG + Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
914676182 1:149909124-149909146 GTGTGGGCTGGGAGAGAGGTGGG - Intronic
914827293 1:151145475-151145497 TTGGGGGTTGGGTGGGAAGGAGG - Intronic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915069678 1:153255803-153255825 GTGAGGGTGGTCAGGGAAGCAGG + Intergenic
915164301 1:153940126-153940148 GCCTGGGTGGGGAGGGAGGCTGG - Intronic
915327612 1:155088772-155088794 GTGTGGGGTGGGAGAGCAGGTGG + Intergenic
915454544 1:156030875-156030897 CTGAGGGGTGGGAGGGATGCAGG - Intergenic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
915512373 1:156393155-156393177 GTGGGGGTTGAGAGGGAGGCTGG - Intergenic
915586006 1:156844364-156844386 GTGAGGATGGGGAGGGATGCGGG + Intronic
915946437 1:160155750-160155772 GGGTGGATTGTGAGGGAGGCTGG - Intronic
916177442 1:162054342-162054364 GTGTGGGGTGGGAGAGGAGGAGG + Intergenic
916437569 1:164791081-164791103 GTGTGGGTAGGGTGGGAAAGAGG - Intronic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
916641943 1:166739196-166739218 GTGTGGGGTGGGAGGGCAAGAGG - Intergenic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
917808432 1:178635057-178635079 GGGTGGCTTGGGAGAGAAGACGG - Intergenic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918064639 1:181090868-181090890 GCCTGGGTTGGGAGGGAAGTGGG + Intergenic
918403675 1:184190989-184191011 GTGGTGGTTGGGAGGGGGGCAGG - Intergenic
918673931 1:187258099-187258121 GTGGGGGTTTGGAGGGGAGGTGG - Intergenic
919496968 1:198285039-198285061 GGGTGGAGTGGGAGTGAAGCGGG - Intronic
919567717 1:199209589-199209611 GTGTGGGTGGGAGGGGGAGCAGG + Intergenic
919770256 1:201154105-201154127 GAGTTGGGCGGGAGGGAAGCAGG - Exonic
920087042 1:203425029-203425051 GTGTGGGATGGGAGGGTGCCAGG + Intergenic
920284835 1:204871925-204871947 TTGTTGGTTGGGAGGGAAAAAGG + Intronic
920370781 1:205477948-205477970 GGGAGGGGTGTGAGGGAAGCGGG - Intergenic
920570906 1:207016559-207016581 GTGTGGATTGGGAAGGAGGCAGG + Intronic
920626842 1:207611065-207611087 GTGAGGGTAGGGAGGGGAGGTGG - Intronic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
920870179 1:209787610-209787632 GTGTGTGTTGGGGGGGCGGCAGG - Exonic
921131567 1:212224320-212224342 GTGTGGCTGGGGAGGTGAGCAGG + Intergenic
921337021 1:214098393-214098415 GTGAAGGGTGGGAGGGAAGAGGG + Intergenic
921352150 1:214246880-214246902 GTGTAGGCTGGGATGGAATCCGG + Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
922478207 1:225921458-225921480 GTGGGAGTTGGTTGGGAAGCTGG - Intronic
922818890 1:228470588-228470610 GGATGGGTGGGGAGGGGAGCTGG + Intergenic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923660125 1:235950529-235950551 GCTGGGGTTGGGAGGGAAGCAGG - Intergenic
923725648 1:236503148-236503170 GTGTGGGATGGGCAGAAAGCTGG + Intergenic
923779765 1:237011835-237011857 GTGTGGGTTAAGTGGGAAACAGG - Intergenic
923978966 1:239298432-239298454 GTGTGTGTTGGCGGGGCAGCAGG - Intergenic
924741209 1:246795123-246795145 GAGTGGGGTGGGGTGGAAGCCGG + Intergenic
1063083400 10:2790110-2790132 GTGTGGTTTTGGAGGGATGGTGG - Intergenic
1063119457 10:3094540-3094562 GTGTTGGTGGGGAGGTGAGCAGG + Intronic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1064156211 10:12905442-12905464 GGATGGGTTTGGAGGGCAGCTGG + Intronic
1064599062 10:16974776-16974798 GAGTGGGTTGGGGAGGAAGAGGG - Intronic
1064906920 10:20357085-20357107 GTGTGGGGAGGTAGGGAGGCAGG - Intergenic
1065347891 10:24766124-24766146 GTGTGTTTTGGGAGGGACCCAGG - Intergenic
1065382391 10:25103158-25103180 GGGGGGGTTGGGAGAGAAGAGGG - Intergenic
1065748152 10:28860674-28860696 GGATGGGTTGGGAGGGAACGGGG + Intronic
1065920396 10:30387731-30387753 GTCTGGGTTGGCCGGGTAGCTGG + Intergenic
1066598692 10:37080137-37080159 GTGTGTGTTGGGTGGGAAGGTGG + Intergenic
1067043384 10:42970311-42970333 GTGGGGGTTGGGTGGGAAGGAGG + Intergenic
1067226886 10:44382441-44382463 GGGTGGGTTGGGGGTGGAGCAGG + Intronic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067684371 10:48457950-48457972 GTTGGGGTTGGGTGGGAAGGGGG + Intronic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1068358437 10:55942828-55942850 GTGTGGGTAGGGAGTGGGGCAGG + Intergenic
1068777357 10:60882615-60882637 GTGGGGGGTGGGAGGGTGGCTGG + Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1070513886 10:77185788-77185810 GTTTGGGCTGGGTGGGAAGTAGG + Intronic
1070692648 10:78539101-78539123 GGGTGGGTTGAAAGGGGAGCTGG - Intergenic
1070957160 10:80471747-80471769 GTGGGGGTGGGGTGGGTAGCAGG + Intronic
1071058002 10:81533093-81533115 GTGTGGATTGGGGTGGGAGCTGG + Intergenic
1071374662 10:84990447-84990469 GTGTGTGTTGGGGGGGAGGAGGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1072451574 10:95543183-95543205 ATGTGGGTTGGGGGGTGAGCTGG - Intronic
1072723499 10:97796299-97796321 GTGCATGTTGGGAGGGCAGCGGG - Intergenic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072831663 10:98664349-98664371 TTGTGGGCTGGCAGGGAAGCAGG + Intronic
1073114886 10:101086282-101086304 GTTTGGGTTGGGAGGGCCTCAGG + Intergenic
1074111279 10:110424219-110424241 GTGGGGGTAGTTAGGGAAGCTGG + Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074299990 10:112225201-112225223 GTGTGTGTGGTGAGGGAATCTGG - Intergenic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075618060 10:123905780-123905802 GTGAGGGTGGGGTGGGAGGCAGG - Intronic
1075794398 10:125108711-125108733 GGGTGGGCTGGGCGGGGAGCAGG + Intronic
1076291305 10:129348068-129348090 TTGTGGGGTGGGGGAGAAGCAGG + Intergenic
1076637535 10:131892041-131892063 GGCTGGGCTTGGAGGGAAGCTGG + Intergenic
1076705106 10:132297203-132297225 GTGTGGGGTGGGAGCCAAGCAGG - Intronic
1076812711 10:132897634-132897656 GTGTGGGTTGGCAGGTTGGCAGG + Intronic
1076835957 10:133021017-133021039 GTGTGTGTTTGGGGAGAAGCTGG + Intergenic
1076888254 10:133272318-133272340 GGCTGGGGTGGGAGGGAAGTGGG - Intronic
1076971675 11:137877-137899 ATGAGAGTTGGGAGGGAAGGGGG - Intergenic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077393970 11:2312216-2312238 ATTGGAGTTGGGAGGGAAGCAGG + Intronic
1077587064 11:3461989-3462011 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1078429745 11:11280007-11280029 GTGTGTGTTGGGAGGGGACATGG + Intronic
1078488911 11:11751248-11751270 GTGTGGGGTGGGTGGGGAGGGGG - Intergenic
1078744244 11:14096196-14096218 GTATGGGTTGGGAGTGGAGAAGG + Intronic
1079336874 11:19577718-19577740 GTGTGGGTTGGGTGGGCATCTGG + Intronic
1079536599 11:21522565-21522587 GTGCGGGGTGGGAGGGGAGGTGG + Intronic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1079662919 11:23064227-23064249 GAGTAGAGTGGGAGGGAAGCAGG - Intergenic
1079702286 11:23563708-23563730 GTGTGGTTTGGGAGGGAAATTGG - Intergenic
1079886261 11:25993195-25993217 ATACGGGTTGGGAGGGGAGCTGG - Intergenic
1080701450 11:34647791-34647813 ATGTGAGGTGGGTGGGAAGCAGG - Intronic
1080944619 11:36957620-36957642 AAGTGTGTTGGGAGGGAAGTGGG + Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081911495 11:46702807-46702829 TTGTGGTTTGGGATGGAACCCGG + Intronic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083857728 11:65401369-65401391 GGGAGGCTGGGGAGGGAAGCAGG - Intronic
1083883373 11:65558943-65558965 GAGGGGGCTGGCAGGGAAGCTGG - Intergenic
1083893399 11:65608098-65608120 GTGGGGGTTGGGAGAGAAAAGGG - Intronic
1083994099 11:66263752-66263774 GTGAGGGTTGGGTGGGAGGTGGG + Intronic
1084161781 11:67354008-67354030 GTGGGGGTTGGGTGGGAGCCGGG - Intronic
1084187756 11:67483846-67483868 TTGTAGGTTGGGGGAGAAGCGGG - Intronic
1084359819 11:68661923-68661945 CTGTTGGCTGGGAGGGGAGCTGG + Intergenic
1084829930 11:71760941-71760963 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1085026951 11:73241980-73242002 GTGTGGGGTGGGAGGGGGACAGG - Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1085670720 11:78462187-78462209 GTGTGTGTTGGAGGGGGAGCTGG + Intronic
1086095990 11:83050333-83050355 GTGTGGGTAGTAAGGGGAGCGGG - Intronic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087242643 11:95797157-95797179 GTGTGTGTTGGGAGGGGGGTGGG - Intronic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1089132194 11:116221529-116221551 GAGTGGGTGGGGGGGGAACCAGG - Intergenic
1089683417 11:120132217-120132239 GAGGGTGCTGGGAGGGAAGCGGG - Intronic
1090458261 11:126868062-126868084 GTGGGGGGTGGGTGTGAAGCGGG + Intronic
1090663234 11:128896428-128896450 GGGTGGGGTGGGATGGAAGTGGG - Intronic
1090682564 11:129077284-129077306 GGTTGGGTTGGGAGGTAAACAGG + Intronic
1090793363 11:130111976-130111998 GTCTGGGTGGGGAGTGAAGCTGG - Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1090931547 11:131302011-131302033 TTGTGGGTTGGGTGGGAAAGGGG + Intergenic
1091025538 11:132137766-132137788 GTCGGGGTTGGGGAGGAAGCAGG - Intronic
1091230201 11:133983382-133983404 GTGAGGGTTGGAGGGTAAGCAGG - Intergenic
1091300480 11:134504065-134504087 GAGTGGGCTTGGAGGGATGCTGG + Intergenic
1091440756 12:510482-510504 GGCTGGGCTGGGAGGGAAACGGG + Intronic
1091755087 12:3046175-3046197 GGGGGGGTTGGGTGGGAGGCTGG - Intergenic
1092280664 12:7095631-7095653 GTGGGGGCTGGGAGGGAAAGCGG + Exonic
1092413305 12:8270736-8270758 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1095572320 12:43697412-43697434 GTTGGGGTTGAGAGGGAAGCCGG - Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095943711 12:47741629-47741651 GTGGGGGAAGGGAGGGAGGCCGG + Intronic
1095959556 12:47825618-47825640 CTCAGGGTTGGGAGTGAAGCTGG - Intronic
1096626887 12:52901364-52901386 GTGAGGGTGGAGAGGGCAGCTGG - Intronic
1096817803 12:54212683-54212705 GTGTGGGCTGGGAAGGATGGGGG + Intergenic
1096848623 12:54421231-54421253 GTGGGGGTGGGGAGGGGTGCAGG + Intergenic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097338832 12:58414748-58414770 GGGGGGGTGGGGAGGGAAGGAGG + Intergenic
1098240153 12:68458682-68458704 TTGGGGGGTGGGAGGGAAGGTGG + Intergenic
1099596708 12:84675655-84675677 GTGGGGGTTGGGAGAGCATCAGG - Intergenic
1100407563 12:94284755-94284777 GTAGGGGTAGGGAGGCAAGCAGG + Intronic
1100738294 12:97562456-97562478 GTGGGGGTTGGGAGGGTAGCTGG + Intergenic
1101018247 12:100524823-100524845 ATGTTTGTTGGGAGGGAAGATGG - Intronic
1101252667 12:102951051-102951073 TTGTGCGTGGGGGGGGAAGCAGG + Intronic
1101488712 12:105192453-105192475 GGGCGGGTGGGGAGGGAGGCAGG - Intronic
1101718920 12:107334394-107334416 GTGTGGGGTGTGAGGGAATGAGG + Intronic
1102027405 12:109721354-109721376 GTCTGGGTTGGGAGGGGTGGGGG - Intronic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102563423 12:113778972-113778994 GTAGGGGGTGGGATGGAAGCCGG - Intergenic
1103742260 12:123098802-123098824 GATTGGGCTGGGAAGGAAGCCGG - Intronic
1104386102 12:128352952-128352974 GTCCGAGGTGGGAGGGAAGCAGG + Intronic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104907687 12:132222968-132222990 GTGTGGGTTGTGTGGGGTGCGGG - Intronic
1105656874 13:22451356-22451378 GACTGGGTTGGGAGAGAGGCCGG + Intergenic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1106191773 13:27459724-27459746 TGGTGGGTTGGGGGGGAAGCCGG + Intergenic
1106693565 13:32146011-32146033 GTGAGGCTTGAGAGGAAAGCAGG - Intronic
1106762437 13:32880489-32880511 GTGTGGAGTGGAGGGGAAGCTGG - Intergenic
1108162675 13:47658378-47658400 GTGTGGGTTGGGCAGGAACAGGG - Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109272703 13:60272238-60272260 GTGTGGATTTTGAGGGAAGCTGG - Intergenic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1110408625 13:75179125-75179147 GTGTGGGTGGGGGGGGCGGCGGG + Intergenic
1110457231 13:75703146-75703168 GTGTGTGTTGGGGGGGATGAGGG - Intronic
1111981949 13:95025499-95025521 GTGTGTGGTGGGGGGGATGCAGG - Intronic
1112323477 13:98428048-98428070 GTCGGGGGTGGGAGCGAAGCGGG - Intronic
1113460395 13:110478490-110478512 GTGTGGGTTGGAAAGGCAGGTGG + Intronic
1113465282 13:110508237-110508259 GTGTGGTTGGGGAGGGGAACTGG - Intronic
1113600276 13:111563450-111563472 GTGAGGGGAGGGAGGGAAACAGG - Intergenic
1113913271 13:113854783-113854805 CTGTTGGATGGGAGGGATGCTGG + Intronic
1113932270 13:113974680-113974702 GTGTGGGTGGGGAGAGGCGCTGG - Intergenic
1113959548 13:114119055-114119077 GGGTGGGTCAGGAGGAAAGCGGG - Intronic
1114655567 14:24313519-24313541 GTGAGAGTTGAAAGGGAAGCAGG + Exonic
1115079143 14:29429451-29429473 TTGTTGGCTGGGAGGGAGGCAGG - Intergenic
1115096703 14:29646244-29646266 GTGTGGGATGGGGAGGAAGGAGG + Intronic
1115730538 14:36264404-36264426 GTGGGAGTGGGGATGGAAGCAGG + Intergenic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1117607163 14:57441428-57441450 CTGTGGGTGGGGAGGTAATCAGG + Intergenic
1117742528 14:58833671-58833693 GACAGGGTGGGGAGGGAAGCAGG + Intergenic
1118147633 14:63157516-63157538 GGGTGGGGTGAGAAGGAAGCAGG + Intergenic
1118339018 14:64879617-64879639 GCGTGGGGTGGGAGGGGTGCGGG - Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118387895 14:65271894-65271916 GTGAGGGGTGGGAGGGAACAGGG - Intergenic
1118910346 14:70057036-70057058 GTGTGTGTTGTGGGGGAACCAGG + Intronic
1119646809 14:76354221-76354243 GTGTGGGTGGGGGGGGGGGCGGG - Intronic
1119680807 14:76591045-76591067 GAGGGGGTTGGGAGGGAGACAGG + Intergenic
1119682401 14:76602711-76602733 GTGTGTGTTGGTCTGGAAGCTGG + Intergenic
1121047072 14:90796110-90796132 CAGCTGGTTGGGAGGGAAGCTGG - Intronic
1121209066 14:92193003-92193025 ATGTGGGATGGGAGGGGAGGCGG + Intergenic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121485699 14:94312781-94312803 GTGCGGGATGGGAGGGGAGGTGG + Intronic
1121830766 14:97050209-97050231 GTGTAGGCTGGGTGGGAAGGGGG - Intergenic
1122309176 14:100783733-100783755 GTGTGGTTGAGGAGGGGAGCTGG + Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1123197445 14:106629991-106630013 GTGAGATTTGGGAGGGAACCTGG + Intergenic
1202895094 14_GL000194v1_random:2204-2226 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1123627908 15:22239914-22239936 GGGAGGGTGGGGAGGGAGGCTGG + Intergenic
1124018005 15:25894449-25894471 GGGTTGGTGGGGAGGGCAGCAGG - Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124723945 15:32138430-32138452 GTGGGGGTTGGGAGGGGACATGG - Intronic
1124965357 15:34429269-34429291 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1124981975 15:34575471-34575493 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1125060104 15:35409186-35409208 GCTGGGGTTGGGAGGGAGGCAGG + Intronic
1125079712 15:35657986-35658008 GGGTGGGTGGAGAGGGATGCAGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125611891 15:40976984-40977006 GTGGGGGTTGGGGGAGAAACTGG + Intergenic
1125686353 15:41565787-41565809 GTGGGGGTTGGGGGGTAAGGTGG - Intronic
1126069626 15:44854555-44854577 GAGTGGGCTGGTAGGGCAGCGGG - Intergenic
1126088905 15:45034608-45034630 GAGTGGGCTGGTAGGGCAGCGGG + Intronic
1126230037 15:46313556-46313578 GTGTTGCTTGGGAGGGCAGTGGG + Intergenic
1127559085 15:60118100-60118122 GTGTGGGTGGGGAGGTAGGTGGG + Intergenic
1127651337 15:61011117-61011139 GAGGGGGGTGGGAGGAAAGCTGG - Intronic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1127873331 15:63091144-63091166 GGGTGGGGTGAGAGGGAAGCCGG - Intergenic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128667069 15:69546334-69546356 TGGTGGGTTGGGAGGGAATGGGG + Intergenic
1129060476 15:72856848-72856870 GAGTGGGGTGGGAAGGGAGCTGG - Intergenic
1129161860 15:73752075-73752097 GTGGGGGTTCTGAGGGAAGGCGG - Intronic
1129164607 15:73769310-73769332 GGGTGGGGTGGGAGGGTAGACGG + Intergenic
1129187853 15:73921395-73921417 GTGGGGGTTGGTAGTGGAGCTGG - Intergenic
1129210559 15:74065631-74065653 GTGGGGGGTGGGAGGGATGGCGG - Intergenic
1129238031 15:74235343-74235365 GTGGGGGTAGAGAGGGAGGCTGG + Intergenic
1129403452 15:75299698-75299720 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1129539065 15:76336601-76336623 GGGTGGGTTGGGTTGGAGGCTGG - Intergenic
1129727759 15:77910268-77910290 GTGGGGGGTGGGAGGGATGGCGG - Intergenic
1129747832 15:78037391-78037413 GTGTGGGTTGTGGGAGAGGCCGG - Intronic
1129837039 15:78715262-78715284 GTCTGGGTTGGCTGGGTAGCTGG - Intronic
1129840118 15:78738592-78738614 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1129933520 15:79431511-79431533 GTGTGGGGGGGGAGAGAAACAGG + Intergenic
1130006854 15:80107860-80107882 GATGGGGTTGGGAGGGCAGCGGG + Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1131155618 15:90073407-90073429 TTGGGGGTTGGGAGGGCAGGCGG + Intronic
1131424092 15:92331133-92331155 GTGGGGGTTGTGGGGGAAGAAGG + Intergenic
1131700338 15:94928619-94928641 ATGTGTGTTGGGAGGGGAGTTGG + Intergenic
1131708814 15:95029637-95029659 GTGTGGTTTAGGAGGTAAGGTGG - Intergenic
1131768686 15:95710629-95710651 GTGTGGGCTGGGTGTGAAGGAGG - Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132185218 15:99797656-99797678 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1132431770 15:101766899-101766921 GTGGGGGGTGGGAGGGATGGAGG - Intergenic
1132589471 16:720439-720461 GAGTGTGGTGGGAGGAAAGCCGG - Intronic
1132700104 16:1218672-1218694 ATATGGGCTGGGTGGGAAGCAGG + Intronic
1133354516 16:5126241-5126263 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1133868500 16:9666249-9666271 GTGTGGGCTGGGAGATCAGCTGG + Intergenic
1134025482 16:10949777-10949799 GTGTTGGTGGGGCGGGGAGCAGG + Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134861888 16:17567609-17567631 GGGGGGGATGGGAGGGATGCAGG + Intergenic
1135269462 16:21056437-21056459 GTATGGGAAGGGAGGGAGGCAGG - Intronic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1135621807 16:23962332-23962354 GTGGGGGTTGGGACGGATGAGGG - Intronic
1135839200 16:25859023-25859045 GTGTGGGGTGGGAGGGATGTTGG - Intronic
1135860510 16:26051752-26051774 GTGTGGGGTGGGGAGGAAGGAGG - Intronic
1135973019 16:27086020-27086042 GTGGAGGGTGGGAGGGGAGCAGG + Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1137017984 16:35394872-35394894 GGGCTAGTTGGGAGGGAAGCAGG + Intergenic
1137539283 16:49350783-49350805 GTGTGCGTTGGGAGGGGGGTGGG - Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138410225 16:56833569-56833591 CTGGGGGGTGGGGGGGAAGCAGG - Intronic
1138433152 16:56982242-56982264 GTGTGGGCTGGAGGGGAAACTGG + Intronic
1138587072 16:57977589-57977611 GTGTGTGTTGGAAGGGGAGTGGG + Intronic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1138728389 16:59166157-59166179 GTGAGGTTTGGGAGGTAGGCAGG + Intergenic
1139382736 16:66543862-66543884 GAGTGGGCTGGGAGGGACCCAGG - Intronic
1139495839 16:67316827-67316849 GTGGGGGTTGGGTGGGCAGGTGG + Intronic
1139591367 16:67935107-67935129 GTTTGGGGTGGGATGGAAGCAGG - Intronic
1139654084 16:68376954-68376976 GAGCGGGTAGGGAAGGAAGCAGG - Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140012950 16:71154540-71154562 GTGGGGGTTGGGTGGGGAGTTGG - Intronic
1140191871 16:72824540-72824562 ATGCGGGTTGGAGGGGAAGCAGG - Intronic
1140704086 16:77609913-77609935 GTGAGGGTTGGAAGAGATGCAGG - Intergenic
1140815543 16:78617574-78617596 GTGTGTGTTCTGAGGAAAGCAGG + Intronic
1140866597 16:79067618-79067640 GTGTGGGTGGGGTGGGGGGCGGG + Intronic
1141518982 16:84564974-84564996 CTGTGGCTTGTGAGGGGAGCGGG - Intergenic
1141591610 16:85073051-85073073 GGCTGGGTGGGGAGGGAGGCAGG - Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141667622 16:85474109-85474131 GTGAGGGTTGAGGCGGAAGCAGG + Intergenic
1141845711 16:86607529-86607551 CTGTGTGTTGGGAGAGAAGGGGG - Intergenic
1141887831 16:86904919-86904941 GTGTGGGTTGTGGGGAGAGCTGG - Intergenic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142183999 16:88685928-88685950 GTGGTGGGTGGGAGGGAAGGAGG - Intronic
1142271397 16:89091463-89091485 ATGTGGTGTGGGAGGGAAGCAGG + Intronic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143406984 17:6684205-6684227 GTTTGGTTGGGGAGGGAAGTAGG - Intergenic
1143542378 17:7577274-7577296 GTGTGGCTAGGGAAGGGAGCAGG + Intronic
1143610421 17:8014783-8014805 GGGTGGGCTGGGAGGGCAGCTGG + Intronic
1143718859 17:8796454-8796476 ATGTGTGTTGGGGGGGAAGTGGG - Intergenic
1143857897 17:9866011-9866033 GTGCAGATTGGGAGGGCAGCAGG - Intronic
1144585467 17:16485028-16485050 GTGGGGGTAGGGAGGAGAGCAGG + Intronic
1144764759 17:17726281-17726303 GTGTGGGAAGGGTGGGGAGCAGG - Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145251923 17:21301463-21301485 GTGTGGGTGAGCAGGGAGGCCGG + Intronic
1145733276 17:27209912-27209934 GGGAGGGGAGGGAGGGAAGCAGG - Intergenic
1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG + Intergenic
1146126063 17:30232584-30232606 TTCAGGGTTGGGATGGAAGCTGG + Intronic
1147237913 17:39071372-39071394 GGGTGGGTTGGGAGGGAACTAGG + Intronic
1147261526 17:39212048-39212070 GGGTGGGGTGGGAGGGAATGAGG - Exonic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147588271 17:41665465-41665487 GTGTGTGTTGGGGGGGGCGCTGG - Intergenic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1147927280 17:43953684-43953706 GTGGGGGTGGGGAGGCAGGCAGG - Intronic
1148113461 17:45161130-45161152 ATGGGGGTGGGGAGGGAAGCTGG + Intronic
1148217377 17:45840413-45840435 GTGGGGGTGGGGAGGGTGGCGGG + Intergenic
1148328902 17:46801218-46801240 GTTGGGGTTGGGAGAGGAGCGGG + Intronic
1148768168 17:50051481-50051503 GTGTGGGGCGAGAGGGATGCTGG - Intergenic
1149272406 17:54994658-54994680 ATGTAGGTTGGGAGGGAAATAGG - Intronic
1149431959 17:56601333-56601355 GTGTGGGTTGGGGGTAAAGGAGG - Intergenic
1149461622 17:56834014-56834036 GTGTGAGGTGGGAGGGGAGACGG - Intronic
1149850837 17:60032774-60032796 GTGGGGGTTGGGGAGGGAGCAGG - Intergenic
1149859329 17:60113750-60113772 GTGGGGGTTGGGGAGGGAGCAGG + Intergenic
1150709208 17:67515607-67515629 GTGTGGGCTGGGCGTGGAGCCGG + Intronic
1151247252 17:72804394-72804416 GTGGGGAGTGGGAGGGAAGAGGG - Intronic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151790434 17:76302289-76302311 GGGTGGGGTGGGGGGGAAACGGG - Intronic
1151806033 17:76406000-76406022 GAGTGGGCTGGGGGAGAAGCAGG + Intronic
1151999923 17:77638784-77638806 GGGTGGGGTGGGGGGGAAGCGGG + Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152284609 17:79404800-79404822 GTGTGGGGTAGGAAGGCAGCTGG - Intronic
1152502357 17:80720903-80720925 GTGTGGTGTGAGAGGCAAGCAGG + Intronic
1152763439 17:82121933-82121955 GGGTGGCCTGGGAGGGAAGGCGG - Intronic
1152851624 17:82639874-82639896 GTGTGGGTCGGGAGGGCTGCTGG + Intronic
1152851647 17:82639968-82639990 GTGTGGGTCGGGAGGGTGGCTGG + Intronic
1152897217 17:82919395-82919417 GTGTAGGTTGGTAGGGAAAACGG + Intronic
1152909991 17:82997882-82997904 GTGGGTGGTGGGAGGGAAGTAGG + Intronic
1153320515 18:3769700-3769722 GGTGGGGTTGGGAGGGAAGTGGG + Intronic
1153706645 18:7752109-7752131 GTGTGAGTTGGAGGGGAAACAGG - Intronic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154057875 18:11029175-11029197 GTTTGCGTTGGCAGGGAACCTGG - Intronic
1154466518 18:14647962-14647984 GTGTGTGTTGGGGGGGATACAGG - Intergenic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1155063903 18:22252764-22252786 GTGTGGGTTTGATAGGAAGCAGG - Intergenic
1155581548 18:27313862-27313884 ATGTGGGTTGGAAGAGAAGTGGG + Intergenic
1156178894 18:34580465-34580487 GTGTGGGGTCGGGGGGATGCAGG + Intronic
1156226889 18:35118303-35118325 CAGTGGATTGGGAGGGAAACCGG + Intronic
1156455418 18:37290628-37290650 GATTGTGGTGGGAGGGAAGCAGG + Intronic
1156605723 18:38664827-38664849 GTGTGACTTGTGAGGGCAGCTGG + Intergenic
1156637481 18:39048911-39048933 GTGGGGGTTGGGGGAGAAGGAGG + Intergenic
1157304366 18:46506380-46506402 GTGTGGGTTCAGAAGGAAGCAGG + Intronic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1157673410 18:49549754-49549776 GTTGGGGTTGGGGGAGAAGCTGG + Intergenic
1157721831 18:49931352-49931374 GTGGGGCTTGGGAGGGCAGAGGG - Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158573307 18:58614904-58614926 GTGTGTGTTGGGGGGGAGGGTGG - Intronic
1159039000 18:63305464-63305486 GTGTGTGTGGGGAGGAAAGTAGG + Intronic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160411969 18:78681188-78681210 GTGTGTGTTGGGGGGGGGGCGGG + Intergenic
1160668418 19:344480-344502 GTGGGGGAGGGGAGGGACGCGGG - Intronic
1160714650 19:570705-570727 GGGTGGGTTGGGAGGGGCGGAGG + Intergenic
1160714662 19:570728-570750 GGGTGGGTTGGGAGGGGCGGAGG + Intergenic
1160714674 19:570751-570773 GGGTGGGTTGGGAGGGGCGGAGG + Intergenic
1160714686 19:570774-570796 GGGTGGGTTGGGAGGGGCGGAGG + Intergenic
1160714698 19:570797-570819 GGGTGGGTTGGGAGGGGCGGAGG + Intergenic
1160747498 19:718989-719011 GTGTGGGGTGCGGGGGCAGCAGG - Intronic
1160859887 19:1233316-1233338 TTGTGGGCTGGGTGGGGAGCCGG - Intronic
1161186431 19:2924449-2924471 TTGTATGATGGGAGGGAAGCTGG - Intergenic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161286009 19:3468572-3468594 GTGGGGGGTGGGGGGGCAGCTGG + Intronic
1161325784 19:3663365-3663387 GTGTGGCTTAGGAGGGAGACAGG - Intronic
1161760525 19:6167950-6167972 GTGGGAGTTGGGTGGGAGGCGGG - Intronic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1161766283 19:6210783-6210805 GGGTGGGGTGGGAGAGCAGCTGG + Intergenic
1162444204 19:10712482-10712504 GTGAGGGTTGGGAGGGGCCCTGG + Intronic
1163107296 19:15132346-15132368 GTGGGGGGTGGGACGGAAGTGGG - Intergenic
1163185031 19:15631881-15631903 GTGTGGGCTGGGCGGGGGGCGGG + Intronic
1163186329 19:15641707-15641729 GTCTGGGGTGGCAGAGAAGCAGG + Intronic
1163578276 19:18123246-18123268 GCGTCGGCTGGAAGGGAAGCTGG - Exonic
1163634712 19:18432634-18432656 GGGTGGGGTGGGAGGGACACTGG + Intronic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164597506 19:29539872-29539894 GTCTGTGCTGGGAGGGAGGCAGG - Intronic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1164898200 19:31896017-31896039 CTGTGGGTTGGGCAGGAAACGGG - Intergenic
1164995929 19:32720363-32720385 GTGTGGGTTGGGGGAGGAGTGGG - Intronic
1165455458 19:35908056-35908078 GTGGGTGTTGGGATGGGAGCAGG - Intronic
1165561987 19:36687798-36687820 GAGAAGGCTGGGAGGGAAGCAGG + Intronic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1165777180 19:38411429-38411451 CTGTGGATTGGCAGGGCAGCTGG + Intronic
1165959826 19:39524671-39524693 GTCTGGGAGGGGAAGGAAGCTGG + Intergenic
1166343986 19:42154062-42154084 GGGGGGGTTGGGAGGGACGGAGG - Intronic
1166633049 19:44424856-44424878 GAGTGGGTTGGTAGGGGAGATGG - Intronic
1166646118 19:44533038-44533060 GAGGTGGTGGGGAGGGAAGCTGG - Intergenic
1166870550 19:45867836-45867858 GTTGGGGTTGGGAGGGGAGTGGG + Intronic
1166885187 19:45956226-45956248 GTGTGGGTTGGGGTGGGAACTGG + Intronic
1166885856 19:45960689-45960711 GCGAGGGTGGGGAGGGAGGCAGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167250266 19:48395499-48395521 GTGTGTGTTGGGAGGTGAGGGGG + Intronic
1167415082 19:49365720-49365742 GTATCTGTTGGGAGGGAAGGAGG + Intronic
1167429459 19:49446253-49446275 GTGGGTGTTGGGAGGGAAGAGGG - Intergenic
1167529557 19:50006880-50006902 GTGTGGGATGGAAGGGGAGGAGG - Intronic
1168316506 19:55486854-55486876 CTGGGGGGTGGGAGGGATGCTGG + Exonic
1168328773 19:55553894-55553916 GGGAGGGGTGGGAGGGAAGGAGG - Intergenic
925005691 2:441463-441485 GTCAGGGTGGTGAGGGAAGCAGG - Intergenic
925366851 2:3316554-3316576 CTGTGAGTTGGGAGAGAGGCAGG - Intronic
925388609 2:3480859-3480881 GTGGGGCTTGGGAGGGAGGGTGG - Intronic
925422601 2:3724977-3724999 GTCTGGGTTGGGAAGGGAGAGGG + Intronic
925997786 2:9306302-9306324 GTGGGGGTTGTGAGTGAAGGAGG + Intronic
926098058 2:10095413-10095435 GTGCGGGATGGGAGGGGAGGTGG + Intergenic
927095094 2:19742385-19742407 GTGTGTGTTGGGGGGGGGGCGGG - Intergenic
927144314 2:20151645-20151667 GTGTGTGTTGGGTGGGGAGTTGG + Intergenic
928103326 2:28452212-28452234 GTGTGGGGCGGGCCGGAAGCAGG - Intergenic
928140489 2:28724190-28724212 GTGGGGGCTGGGAGGGCAGGGGG + Intergenic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928787351 2:34904878-34904900 GTGTGTGTTGGGCGGGAGGGTGG + Intergenic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
930393458 2:50790120-50790142 GTGTGTGGTGGGAGGGAATAAGG - Intronic
930576086 2:53150517-53150539 GTGTGGGTGGGGAGAGAGGGAGG + Intergenic
930607160 2:53504612-53504634 GTGAGGAATGGGAGGGAGGCAGG + Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931190296 2:59993851-59993873 GTTTGGGTTGGGAGTGGAGGTGG + Intergenic
931248788 2:60512504-60512526 TTCTGGGTTGGGAGGGGAGCCGG - Intronic
931277612 2:60756998-60757020 TTGTGGGTAGGTGGGGAAGCAGG - Intronic
931842921 2:66173438-66173460 GGGTGAGGTGGGAGGGAAGGGGG + Intergenic
931877268 2:66527634-66527656 GTGTGTGTTGGGGGGGAGACAGG + Intronic
931925346 2:67066301-67066323 GTGTGGCATGGGAGGGAAAGTGG - Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
933758876 2:85661194-85661216 CGGGGGGTTGGGGGGGAAGCTGG + Intronic
933759715 2:85665204-85665226 GTGTGAGTTGGGAGAGAGGTGGG + Intronic
934543388 2:95194743-95194765 GTGGGGGGTGGGAGGGAAGTGGG + Intergenic
935626249 2:105174492-105174514 ATGGGGGCTGGGAGGGAAGGAGG + Intergenic
936519440 2:113202362-113202384 GTGAGGGATGGGACGGAGGCTGG + Exonic
936561611 2:113543418-113543440 GAGAGGGTTGGGAAGGAAGGAGG - Intergenic
936624437 2:114133215-114133237 GTTTGTGTTAGGAGAGAAGCTGG + Intergenic
937818232 2:126276683-126276705 GTGTGTGTTGGGATGGGAGCAGG + Intergenic
937860374 2:126703464-126703486 GTGTGTGGTGGGAGGGACACAGG + Intergenic
937907700 2:127060434-127060456 GTGCGTGTTGGGTGGGAAGGCGG - Intronic
938143274 2:128813227-128813249 GAGGAAGTTGGGAGGGAAGCAGG - Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938493096 2:131776197-131776219 CTGTGGGCTGGGACGGCAGCTGG - Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
938574881 2:132594584-132594606 GTTTGGTTTGGGTGGGAGGCAGG - Intronic
938691083 2:133790040-133790062 GTTAGGGCTGAGAGGGAAGCAGG - Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
940400809 2:153245605-153245627 GTGTGTGTTGGGAGGGGGGGAGG - Intergenic
940502204 2:154506762-154506784 GTGTGGATTGGCAAGGAAGTAGG + Intergenic
940502885 2:154516511-154516533 AAGTTGGTTGGGAAGGAAGCAGG - Intergenic
941225146 2:162838829-162838851 GTGGGGGTGGGGTGGGAAGGGGG + Intergenic
941654452 2:168127999-168128021 GTTAGGCTTGGGAGGGAAGGTGG + Intronic
942241073 2:173964575-173964597 GTGGGGGTGGGGAGGAAGGCGGG + Intronic
943198751 2:184791606-184791628 GTGTGTGTTGGGAGTGAGGTTGG - Intronic
943230203 2:185241340-185241362 GTGTAGGTTAGGAGGTAAGTGGG + Intergenic
943649474 2:190441482-190441504 GCGGGGGTTGGGGGGAAAGCAGG + Intronic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
944662522 2:201933109-201933131 GTGTGTGTAGGGAGGCATGCGGG + Intergenic
945004986 2:205395481-205395503 GTGGGGGTTGGGGGAGAGGCAGG - Intronic
945441456 2:209884905-209884927 GTGGGGGTTGGGAGAGCATCGGG + Intronic
945736533 2:213608107-213608129 GTGCGTGTTAGGAGGGGAGCAGG + Intronic
945977520 2:216282421-216282443 ATGGGGGTTGGGAGGGATGGTGG - Intronic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
947384316 2:229576074-229576096 GTGGGGGTAGGGAGTGTAGCGGG - Intronic
947489682 2:230582846-230582868 GTGTTTTTTGGGAGGGAAGGAGG - Intergenic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
947805772 2:232966849-232966871 GTGAGGGTGGGGGGGGAGGCGGG + Intronic
948145233 2:235703571-235703593 GCGGGGGAGGGGAGGGAAGCGGG - Intronic
948201941 2:236135905-236135927 GAGGGGGCTGGGAGGGCAGCAGG - Intergenic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
949033731 2:241807368-241807390 GCGTGAGGGGGGAGGGAAGCTGG - Intergenic
949043652 2:241860516-241860538 GTGTGGGCTGGAGGGGAGGCTGG + Intergenic
1168827160 20:821740-821762 GGCTGGGGTAGGAGGGAAGCTGG - Intergenic
1169430211 20:5529778-5529800 GTGTGGGCCGTCAGGGAAGCAGG - Intergenic
1169569716 20:6892521-6892543 GTGTGTGTTGGAAGGGATGGCGG + Intergenic
1170025979 20:11890677-11890699 GTGAGGGGTGGGCGGGAACCCGG - Intergenic
1170255201 20:14334657-14334679 GTGGGGGGTGGGAGGGAAGGGGG + Intronic
1170604227 20:17863793-17863815 GAGTGGGGTGGGTGGGGAGCTGG - Intergenic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1171278648 20:23879023-23879045 GCGTGACTTGGGAGGGAAGCGGG + Intronic
1171953483 20:31441489-31441511 GGGTGGGTTAGGAGAGAGGCGGG + Intronic
1172149533 20:32780276-32780298 GGGTGGGGTGAAAGGGAAGCAGG - Intronic
1172179009 20:32989402-32989424 GGGTGGGGTGGGAGGGAACACGG - Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1172807688 20:37624376-37624398 TTGGGGGTGGGGAGGGAGGCTGG - Intergenic
1173375337 20:42477763-42477785 GTGTGGCTTGTCTGGGAAGCTGG + Intronic
1173524385 20:43720874-43720896 GTGAGTGCTGGGAGGGAAGATGG + Intergenic
1174753439 20:53135280-53135302 GTGTGACTGGAGAGGGAAGCAGG - Intronic
1175372250 20:58499795-58499817 ATGGGGCTAGGGAGGGAAGCTGG - Intronic
1175506810 20:59491962-59491984 GTGTAGTTGGGGAGGGAAACAGG - Intergenic
1175961032 20:62636438-62636460 GTGCGGGTAGGGAGGGGAGGTGG + Intergenic
1176614796 21:9018191-9018213 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1176710409 21:10145680-10145702 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1177715946 21:24840224-24840246 TTCTGGGTTGGGTGGGAACCTGG - Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180177544 21:46097976-46097998 GAGGGGGATGGGAGGGAAGCGGG - Intergenic
1180735025 22:18010028-18010050 GGGAGGGGAGGGAGGGAAGCAGG + Intronic
1180839764 22:18953870-18953892 GTGTGGGGTGGGGGTGCAGCTGG - Intergenic
1181069467 22:20323537-20323559 GTGTGGGATGGGAGGAGGGCGGG + Intergenic
1181441462 22:22938040-22938062 ATGTGGGTTGGGAGGCAGGCAGG - Intergenic
1181492302 22:23268229-23268251 GGGTGCGTGGGGAGGGGAGCAGG + Intronic
1181662447 22:24362244-24362266 GTGGGGGCTGGCAGGGAAGCAGG + Intronic
1181731432 22:24849753-24849775 GAATGGGTGGGGAGGGAACCCGG + Intronic
1182378654 22:29868376-29868398 GTGGGGGTGGGGAGGTGAGCAGG + Intergenic
1182586607 22:31347111-31347133 CTGTGGTTTGGGGGAGAAGCTGG - Intergenic
1183055535 22:35303117-35303139 GTGTGTGTTGGGAGGGGAGGTGG - Intronic
1183338789 22:37266760-37266782 GTGTGGCTTTAGCGGGAAGCAGG - Intergenic
1183353517 22:37346393-37346415 GCCTGGGTTGGGAGGGAAGGAGG - Intergenic
1183481323 22:38067096-38067118 GTTTGCGTGGGGAGGGAAGAAGG + Intronic
1183548001 22:38465626-38465648 GTGTGTGTTGGGGGGGACGTGGG - Intergenic
1183726498 22:39592859-39592881 GTGTGGGGTAGGAGGGTGGCGGG - Intronic
1183824278 22:40372453-40372475 GTGTGGTCTGGGAGGGGAGAGGG + Intronic
1184117944 22:42432828-42432850 GTGAGGGGTGGTAGGGAGGCTGG + Intergenic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184270784 22:43381710-43381732 GTGTGAGTTGGTAAGGAACCAGG + Intergenic
1184442065 22:44523052-44523074 GTGTGGGCCGCCAGGGAAGCAGG - Intergenic
1184460681 22:44636242-44636264 GTGGGGGTTGCAGGGGAAGCAGG - Intergenic
1184516155 22:44964029-44964051 CTGTGTGTTGGGAGGGTTGCTGG + Intronic
1184843394 22:47065853-47065875 GCGTGGGGTGGGAAGGAAGGAGG + Intronic
1185254411 22:49824572-49824594 GTGTGTGGTGGTAGGGACGCAGG - Exonic
949607672 3:5672233-5672255 GTGAAGGGTGTGAGGGAAGCGGG - Intergenic
949958027 3:9286312-9286334 GTGTGTGTTGGGGGGCATGCTGG - Intronic
950016340 3:9757412-9757434 GTGAGGAGTGGTAGGGAAGCAGG + Exonic
950173618 3:10856290-10856312 CTGCGGGTTGAGAGGGAAGCAGG + Intronic
950500736 3:13361979-13362001 GGCTGGGTTGGGGAGGAAGCAGG - Intronic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951720544 3:25693205-25693227 GTGGGAGGAGGGAGGGAAGCAGG - Intergenic
951889610 3:27556129-27556151 GTGGGGGGTGGGAGGGAGGGAGG - Intergenic
951919153 3:27834552-27834574 GTGTGGGGAGGGAGAGAATCAGG - Intergenic
951932695 3:27986370-27986392 GCTTGGGCTGGGAGGGAAGCAGG + Intergenic
952211252 3:31231280-31231302 GTGGGGGGTGGGGGGGAGGCGGG + Intergenic
952767907 3:36970899-36970921 GTGAGGGTTGGGAGTGGAGATGG - Intergenic
953351433 3:42219259-42219281 GTCTGGATTGGGTCGGAAGCTGG + Intronic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
953872684 3:46641184-46641206 GTGGGGGTTGGGGGGAAGGCAGG - Intergenic
954075606 3:48177152-48177174 GTGTGGGTTAGGAGGGACCATGG - Intronic
954460826 3:50625921-50625943 GTGGGGGTGGGGAAGGAAGGAGG + Intronic
954683797 3:52359776-52359798 GTCTGAGTTGGGAGGGGAGCAGG - Intronic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954782194 3:53070076-53070098 GTTTGGGTTGGGATGGGGGCAGG - Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
955618381 3:60833784-60833806 GGGTGGAGTGGGAGGGAAGTGGG - Intronic
956057843 3:65319318-65319340 TTGGGGGGTGGGAGGGAAGTAGG + Intergenic
956159669 3:66335891-66335913 GTGGTGGTGGGGAGGGAAGGAGG + Intronic
956305420 3:67819125-67819147 GTGTGGGGTGGGCGGGAAGCAGG + Intergenic
956770665 3:72523230-72523252 TTGGGGGCTGGGTGGGAAGCAGG - Intergenic
957058405 3:75461926-75461948 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
957980246 3:87500180-87500202 GTGTGGGTGGAGGTGGAAGCTGG - Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
959656200 3:108807871-108807893 GTGAAGGATGGGAGGGCAGCGGG + Intergenic
960586567 3:119325650-119325672 GCGGGGGTTGGGGGGGAAGGGGG + Intronic
961295041 3:125877776-125877798 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
961315398 3:126032140-126032162 GTGGGGGCTGGGCAGGAAGCTGG + Intronic
961416927 3:126765957-126765979 GCGTGGTTTTGGATGGAAGCAGG + Intronic
961512163 3:127409681-127409703 CTGTGGGCTGGGAGGCCAGCAGG - Intergenic
961909623 3:130301264-130301286 GTGGGGGCTGGGAGGGCAGAGGG + Intergenic
962155549 3:132945258-132945280 GTGTGTGTTGGGGGGGTGGCGGG + Intergenic
962352932 3:134668872-134668894 GTTGGGGTTGGGAGTGAAGGTGG - Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962755088 3:138460478-138460500 GTGGGGGTTCGGAGGAAAGCAGG - Intronic
962813733 3:138980151-138980173 GTGGGGGCTGGGAGTGAAGGAGG + Intergenic
964474626 3:157087563-157087585 GTGTGGGGTGGGCAAGAAGCAGG - Intergenic
964525935 3:157615366-157615388 ATGTGGCTTGGCAGGAAAGCAGG - Intronic
964824257 3:160808329-160808351 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
964824267 3:160808419-160808441 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
965220519 3:165921092-165921114 CTGAGTGTTGGGAGAGAAGCTGG + Intergenic
965903688 3:173675684-173675706 GTGTGGGTTGGGAAGAAAGGAGG + Intronic
966037159 3:175433118-175433140 TTGTGGCTTGGGATGGAAACAGG - Intronic
966578074 3:181525924-181525946 AAGTGGGTTGGGGTGGAAGCAGG - Intergenic
966604589 3:181809694-181809716 TTGGGGGTTGAGGGGGAAGCAGG - Intergenic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
967194677 3:187016201-187016223 GTGTGTGTTGGGGTGGAAGATGG - Intronic
967757987 3:193191785-193191807 GTGTATGTTGGGAGGGGAGGAGG + Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968697732 4:2041142-2041164 GGGTGGGGTGGGGGGGGAGCGGG + Intronic
968919561 4:3515520-3515542 GTGTCTGTTGGGAGGGAGGTGGG - Intronic
968937125 4:3617298-3617320 GTGAGAGATGGGAGGGAAGAAGG - Intergenic
968937188 4:3617477-3617499 GGGAGGGATGGGAGGGAAGAAGG - Intergenic
969278048 4:6150278-6150300 AGGTTGGGTGGGAGGGAAGCTGG - Intronic
969533586 4:7742252-7742274 GTGTGGGTGGGGTGGCCAGCAGG - Exonic
969658022 4:8509217-8509239 GAGTGGGGTGGGAGGGAGGGAGG + Intergenic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
970347803 4:15170405-15170427 GTGAGGTTTGGGAGGCAGGCAGG - Intergenic
971014115 4:22469786-22469808 GTTTGGGATGGGGTGGAAGCAGG - Intronic
972312217 4:37891603-37891625 GCGGGGGTTGGGGGAGAAGCCGG - Intronic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
972720018 4:41687036-41687058 GGGAGGTTTGGGTGGGAAGCGGG + Intronic
972843513 4:42959424-42959446 GTGGGGGATGGAAGGGAAGAAGG + Intronic
973856818 4:55019740-55019762 GTGTGGGCTGGGAGGTGAGAAGG - Intergenic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
974920687 4:68235475-68235497 GTGGTGGTAGGGAGGGATGCAGG - Intronic
975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG + Intronic
975302718 4:72809622-72809644 GAGTGAGGTGGGAGGGAAGTGGG + Intergenic
975814285 4:78201829-78201851 GTGTGAGTTGGGAGAAAAGGGGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976806068 4:89048457-89048479 GTGGGGGTGGGGAGGGATGGTGG + Intronic
977176784 4:93828675-93828697 GAGGGGGTTGGGAGAGGAGCGGG + Intergenic
977581448 4:98729397-98729419 TTATGCATTGGGAGGGAAGCTGG + Intergenic
977607392 4:98996104-98996126 ATGTGGGCTGGGGCGGAAGCGGG + Intronic
977910291 4:102526341-102526363 GTGAGGGATGGGAGGGCAGTGGG + Intronic
978459139 4:108930626-108930648 GTGTGGGAGAGAAGGGAAGCAGG + Intronic
979298021 4:119054671-119054693 GTGTGGGTGGGGTGGGCCGCAGG + Intronic
979952498 4:126910804-126910826 GACTTGGATGGGAGGGAAGCTGG + Intergenic
980129293 4:128803530-128803552 GGATGGGTTGGGAGGGCGGCGGG - Intergenic
980649092 4:135686878-135686900 GTGGGGGTTGGGAGAGCATCAGG + Intergenic
981713934 4:147733985-147734007 ATGTGTGTTGGGTGGGAAGTAGG + Intronic
981929873 4:150177889-150177911 GGGTTGGTGGGGAAGGAAGCAGG + Intronic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
984533885 4:180948427-180948449 GTGGGGGATTGGAAGGAAGCAGG - Intergenic
985159631 4:187031132-187031154 TTGTGGGATGGGAGGGAGGGGGG - Intergenic
985438843 4:189963743-189963765 TTGTGGGCTGGAATGGAAGCTGG + Intergenic
985484482 5:140796-140818 GTGGGGGTTTGTAGGGAAGGGGG - Intronic
985672417 5:1213424-1213446 ATGTGGGATGGGCGGGAAGTTGG - Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985913100 5:2898039-2898061 CTGTGGATTGGCAGGGATGCAGG - Intergenic
986212821 5:5690188-5690210 GTGAGGGAAGTGAGGGAAGCAGG - Intergenic
986723967 5:10580703-10580725 GTGAGGCTTGGGAGGGACTCGGG + Intronic
986778893 5:11046038-11046060 GTGTGGGATGGGGTGGAAACGGG + Intronic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
988499427 5:31772018-31772040 GTGGGGGTGGGGAGAGGAGCAGG + Intronic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
988910653 5:35838281-35838303 GTGTGGCTTGGGTGGTCAGCAGG + Intergenic
989563498 5:42877348-42877370 GTGTAGGTTGGGGAGGAAGGAGG - Intronic
989997210 5:50849962-50849984 GAGAGGGATGAGAGGGAAGCAGG - Intergenic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990386578 5:55269835-55269857 GTTTGGGTGGGGAGGGAATAAGG + Intronic
990771819 5:59255399-59255421 CTGTGGGGTGGAAGGGAGGCAGG + Intronic
991029157 5:62064912-62064934 GTGTGGCTTGGGAGGCTACCAGG - Intergenic
991925828 5:71704157-71704179 GTGTGTGGTGGGAGGTCAGCAGG - Intergenic
992074041 5:73174564-73174586 GAGTCGGGTGGGAAGGAAGCAGG + Exonic
992718426 5:79534447-79534469 GTGTGGCTGGGGAGTGATGCAGG - Intergenic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993904146 5:93604452-93604474 GTGTGCGCTGGGAGGGCCGCGGG + Intergenic
995317040 5:110787116-110787138 GTGTGTGTTGGGGGGAAAGGAGG - Intergenic
995550802 5:113279228-113279250 ATGTGGGTTGGGTGGGAAACTGG - Intronic
996228736 5:121034281-121034303 GTGAGGGTGGGGAAGCAAGCAGG + Intergenic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996513201 5:124340786-124340808 ATGTGGGTTTGGAGGTAATCAGG - Intergenic
996644249 5:125795427-125795449 GTGTGTGTTGGGGGGGAGGTGGG - Intergenic
997418848 5:133750439-133750461 GTGATGGGAGGGAGGGAAGCTGG - Intergenic
997732024 5:136188702-136188724 GTGGGGGTTGGGGGAGAGGCTGG - Intronic
998040509 5:138948349-138948371 GTGTGTTTTGGAAGCGAAGCTGG - Intronic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998598785 5:143562826-143562848 GTCTGAGTTGGGAGGTAAGATGG - Intergenic
999192403 5:149758057-149758079 GTGTGGGTTTGGAGGTGGGCAGG - Intronic
999197445 5:149792075-149792097 GAGTGGCCTGGGAGGGAAGGTGG + Intronic
999233397 5:150076213-150076235 ATGTGGGTTGGGTGGGAACCTGG - Intronic
999382759 5:151132972-151132994 GTTTGGGTTGGGAATGAAGTAGG + Intronic
999730647 5:154474614-154474636 GTGTTTATTGGGAGGGAAGGGGG - Intergenic
1001003838 5:168031994-168032016 GTCTGGCTTTGGAGGGAAGTAGG + Intronic
1001157235 5:169283320-169283342 TGGCGGGGTGGGAGGGAAGCAGG + Intronic
1001278181 5:170366212-170366234 GTGTGGGCTGGGAGTGGGGCAGG - Intronic
1001575893 5:172763641-172763663 GTGCAGGCTGGGAGGGAAGGAGG + Intergenic
1001747556 5:174103419-174103441 GTTTGAGTTGGGAGGAGAGCAGG + Intronic
1001777330 5:174338437-174338459 GTGTGGGTTGGGAGGCCCGCAGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002017032 5:176332921-176332943 GGTTGGGATGGGAGGGAAGTGGG - Intronic
1002061788 5:176629788-176629810 GGGTGGGATGGGGGGAAAGCGGG - Exonic
1002807122 6:587963-587985 GTGAGGGAGGGGAGAGAAGCAGG + Intronic
1003263557 6:4546808-4546830 GTGTGGACTTGGAGGGAAGGGGG + Intergenic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1004179333 6:13367456-13367478 ATGGGGGTCGGGAAGGAAGCAGG - Intronic
1004570540 6:16840389-16840411 GTGGGGGTGGGGAGGGAAAGTGG + Intergenic
1004585376 6:16994646-16994668 GAGTGGGTCAGGAGGTAAGCAGG + Intergenic
1006101671 6:31689555-31689577 GTGGGGGATGGGAGGGAGGCTGG + Intronic
1006191617 6:32213034-32213056 GTGTGGGGTGGGAGGCAGCCTGG + Intronic
1006266472 6:32929183-32929205 GTATGGGATGGTAGGGAAGTGGG + Intergenic
1006271221 6:32968813-32968835 GCGGGGGGTGGGGGGGAAGCGGG + Intronic
1006294712 6:33165037-33165059 GGGAGGGCTGGGAGGGAAGAGGG - Intronic
1006333630 6:33409774-33409796 GTGAGGGGTGGGAGGGTTGCTGG + Exonic
1006394735 6:33779948-33779970 ATGTGGGTTAGGATGGAAGTGGG - Intronic
1006882690 6:37353922-37353944 GGGTGGGTTGGGAGCCAATCCGG - Intergenic
1006942686 6:37763353-37763375 GTGTGGGTGGTAAGGGAAGAGGG + Intergenic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007553279 6:42746288-42746310 GGGTGGGGTGGGAGGCAGGCGGG + Intergenic
1007695426 6:43729691-43729713 GTGGGGACTGGGAGGGAAGTAGG - Intergenic
1009522797 6:64705824-64705846 TTGTGGGGTGGGAGGGAGGGGGG + Intronic
1009560828 6:65240427-65240449 GAGAGGGTTGGGAGGGAAGGAGG - Intronic
1009955096 6:70444154-70444176 TAGTGCTTTGGGAGGGAAGCAGG + Intronic
1010448153 6:75972254-75972276 ATGTTGGTTGGGAGGGAACGGGG - Intronic
1010759434 6:79706089-79706111 GTCTGGGTTGGGGGGCAAGGTGG - Intergenic
1010810027 6:80290248-80290270 GGCTGGGGTGGGAGGGGAGCAGG + Intronic
1011372802 6:86656694-86656716 GTGGGGGATGAGAGGGAAGTGGG + Intergenic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1012398948 6:98828830-98828852 GGGTGGGCGGGGAGGGGAGCAGG - Intergenic
1012973003 6:105751706-105751728 GGGAGGGGTGGCAGGGAAGCGGG - Intergenic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013463224 6:110395409-110395431 GGGTGAGTTGGCAGGCAAGCAGG - Intronic
1013970894 6:116017165-116017187 GTGTGTGTTGGGAGGTAGGGAGG - Intronic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1016390447 6:143569178-143569200 GTGTGGGCTGTGAGGGAAAGAGG + Intronic
1017754591 6:157518634-157518656 GGGTGAGTTGGGAGGGAGGGTGG - Intronic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1018030388 6:159836909-159836931 GGGAGGGCTGGGAGGGAGGCGGG + Intergenic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018826039 6:167408508-167408530 GTGTGGGTTGGGAAGGTGCCTGG + Intergenic
1018891517 6:167986282-167986304 GTGGACGGTGGGAGGGAAGCAGG + Intergenic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1019216909 6:170449946-170449968 GGGTGGCTTGGGAGCCAAGCAGG + Intergenic
1019426940 7:982437-982459 GTGAGGGGTGGGAGGGCTGCTGG - Intergenic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020438913 7:8196614-8196636 TTGTGGGGTGGTTGGGAAGCGGG + Intronic
1020680596 7:11232324-11232346 GGGTGGGGTGGGATGGGAGCTGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1022090002 7:27102004-27102026 GAGTGGGCTGGGAGAGAAGGAGG - Intronic
1022130949 7:27403911-27403933 TGGTGGGGTGGGAGGGAAGGTGG + Intergenic
1023109010 7:36791543-36791565 GTGTGGCTTGGGAAGGAGGCAGG + Intergenic
1023987116 7:45103197-45103219 GTGTGGCATGGGAGGGCAGGGGG - Intronic
1024054106 7:45648520-45648542 GTGTGGCCTGGGCGGGAAGGTGG + Intronic
1024089184 7:45921349-45921371 GTGGGGGTTGGGAGGGGGGCGGG + Intronic
1024326762 7:48114900-48114922 GTGGAGGTTGGGAGAGAGGCAGG + Intergenic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1024525254 7:50343158-50343180 GGGAGGGTGGGGAGGGAAGGAGG - Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025819203 7:64947260-64947282 GTGCGGTTTGGGAGTGAAGCCGG - Intergenic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1027044237 7:74981089-74981111 GGGTGGGCTGGGTGGGAAGGGGG - Intronic
1027329181 7:77073498-77073520 GTGGGAGTGGGGAGGGAGGCAGG - Intergenic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027519671 7:79189782-79189804 GTCAGGGGTGGGAGGGAAGAAGG - Intronic
1028513460 7:91650482-91650504 GTGTGGGTTAGGAATGAAGATGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029052020 7:97699739-97699761 CTGTGGGTTGCCATGGAAGCAGG - Intergenic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1029359159 7:100075686-100075708 CTGTGGGTTGGGAAGTCAGCAGG - Intronic
1029745163 7:102512445-102512467 GTGGGGGTTAAGAGGGAAGGGGG + Intronic
1029763155 7:102611606-102611628 GTGGGGGTTAAGAGGGAAGGGGG + Intronic
1029786583 7:102797872-102797894 GTGGGAGTGGGGAGGGAGGCAGG + Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1030541653 7:110837736-110837758 ATGGGGGTTGGGAGGAAGGCAGG + Intronic
1031761265 7:125716071-125716093 ATGTGGGTTGTCAGGGAAGTGGG + Intergenic
1031913331 7:127540195-127540217 GTGTGGCTAGAGAGGAAAGCAGG + Intergenic
1032364334 7:131285207-131285229 GGCTGGCCTGGGAGGGAAGCTGG + Intronic
1032392200 7:131562604-131562626 GTGTGGATGGGAAGGGAAGGAGG + Intergenic
1032502230 7:132408849-132408871 GTGGGGGGCGGGAGGGAGGCAGG - Intronic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033036674 7:137882102-137882124 GTGTGGCTTGGAAGGGAGGATGG + Intronic
1033220610 7:139524291-139524313 GGGTGGGGTGGGAGGGAACCGGG + Intronic
1033281527 7:140009715-140009737 GTGTGGGGTGGGAGTGGGGCAGG - Intronic
1033718135 7:144024513-144024535 GAGTGGCTTGGGTGGGAAGAGGG - Intergenic
1034277166 7:149829047-149829069 GTGTGGGGTGGCAGGGGAGAAGG - Intergenic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034628692 7:152514056-152514078 GTGGAGGGTGGGAGGGAAGGAGG - Intergenic
1034982856 7:155489726-155489748 GTGTGGATTGGGACCGGAGCTGG + Intronic
1034994837 7:155571037-155571059 GTGGGGGTGGGGAGGGAGGTGGG - Intergenic
1035245187 7:157558667-157558689 GTGCGGCCTGGGAGGGGAGCTGG - Intronic
1035397801 7:158546581-158546603 GTGTGGCCTGGGAGGGCAACAGG - Intronic
1035444397 7:158929910-158929932 GTGTTGTTTGAGAAGGAAGCTGG + Intronic
1036374966 8:8192138-8192160 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1036678424 8:10853176-10853198 GTGTGGGAGGGCAGGGAAGGTGG + Intergenic
1036854577 8:12231013-12231035 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1036875936 8:12473506-12473528 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037750941 8:21682023-21682045 GAGTGGGTGGAGAGGGCAGCTGG + Intergenic
1038179486 8:25213100-25213122 GTGTGTGTTGGAATGGAAGATGG + Intronic
1038411320 8:27361833-27361855 GTGTGGGTGTGGAGCGGAGCAGG - Intronic
1039433526 8:37544116-37544138 ATGTGGGCTGGGAGGGATACAGG - Intergenic
1039559741 8:38503658-38503680 GTGTGGGCTGGGAGGGAAAAGGG - Intergenic
1039913534 8:41843404-41843426 GTGTGGGGTGGGCGGGGAGTGGG - Intronic
1040017090 8:42708525-42708547 GTGTGTGTTTGGAGGGAGGTGGG + Intronic
1040295115 8:46145050-46145072 GGGTGGAGTGGGAGGGACGCAGG - Intergenic
1040308280 8:46223512-46223534 GTGTGGCATGGGAGGGTCGCAGG + Intergenic
1040333993 8:46406867-46406889 GGGTGGCTTGGGTGGGACGCAGG + Intergenic
1040336595 8:46419188-46419210 GAGTGGAGTGGGAGGGCAGCAGG + Intergenic
1040338485 8:46428079-46428101 GTGTGGCGTGGGAGGGCCGCAGG + Intergenic
1041128520 8:54669874-54669896 TGGTGGGGTGGGAGGGAAGGGGG + Intergenic
1041537161 8:58939468-58939490 GAGTGGTCTGGGAGGGAAGGAGG + Exonic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1042187366 8:66150523-66150545 GAGTTGGGTGGGAGGAAAGCGGG + Intronic
1042586848 8:70349008-70349030 GTGGGGGATGGGAGGGAAAAGGG + Intronic
1043267742 8:78287633-78287655 GTATGTGTTGGGAGGGTAGAGGG - Intergenic
1045257114 8:100535543-100535565 GACTGGCATGGGAGGGAAGCAGG - Intronic
1045491319 8:102671393-102671415 GGGTGGGGTGGGAGGGAACCTGG - Intergenic
1045535295 8:103021619-103021641 GTGTGTGTTGGGGGGGGCGCGGG + Intronic
1046189643 8:110776241-110776263 GTTAGGGTTGGGGGTGAAGCAGG - Intergenic
1046653086 8:116860905-116860927 GTGGGGGTTGTGAGGTAAGCTGG + Intronic
1046717976 8:117587893-117587915 GTGTGTGTTGGGGGGGGGGCGGG - Intergenic
1047498595 8:125426116-125426138 GTGAGGCTTGGAAGGGAAGTGGG + Intergenic
1047540640 8:125762310-125762332 TTCTGGGGTGGGAGGGATGCGGG + Intergenic
1047641773 8:126828425-126828447 GTGTGTGTTGGGGGGGTGGCAGG - Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1048008827 8:130440628-130440650 GTGAGGTTTGAGAGGGAAGCAGG - Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048888901 8:138931059-138931081 GTGGGGACTGGGAGGGCAGCTGG - Intergenic
1049205387 8:141361215-141361237 GTGTGGGTGGGGAGCAGAGCTGG - Intronic
1049263777 8:141654072-141654094 GTGTGGCCTGGCAGGGAAACTGG - Intergenic
1049509574 8:143020734-143020756 GAGTGGGTCAGGAGAGAAGCAGG + Intronic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1049672795 8:143877288-143877310 GTGGGGCCTGGGAGGGCAGCTGG + Intronic
1049891071 9:71900-71922 GAGAGGGTTGGGAAGGAAGGAGG + Intergenic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1053732512 9:41072955-41072977 GAGAGGGTTGGGAAGGAAGGAGG + Intergenic
1054453958 9:65420199-65420221 GGGAGGGATGGGAGGGAAGAAGG + Intergenic
1054695919 9:68358620-68358642 GAGAGGGTTGGGAAGGAAGGAGG - Intronic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1055166429 9:73201014-73201036 GTGTGTGTTGGAAGGGAGGGTGG - Intergenic
1056496407 9:87159802-87159824 GTGAGGGATGGGAGGGAGTCTGG + Intergenic
1056815658 9:89799036-89799058 GTGTGTGGTGTGAGGGAGGCAGG + Intergenic
1057217309 9:93236203-93236225 GTGTGGGATGGGAGGGCCCCTGG + Intronic
1057249921 9:93492902-93492924 AAGTGGGATGGGAGTGAAGCAGG + Intronic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1058077953 9:100669567-100669589 GTGTGTGTGGGGAGGTAGGCGGG + Intergenic
1058179459 9:101779139-101779161 GTGTGGGTGGGGGAGGAAGCTGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059453721 9:114386951-114386973 GTGTGGGTGGGGGTAGAAGCAGG - Intronic
1059691266 9:116687704-116687726 GTGGGAGATGGGAGGGAATCAGG + Intronic
1060512296 9:124242910-124242932 GTGTGGGAGGGGTGGGAGGCAGG - Intergenic
1060599221 9:124866992-124867014 GTGGGGGTTGGGAGGAGAGTAGG - Intronic
1060821241 9:126662651-126662673 GTGTGGGCTGGGCTGGGAGCCGG + Intronic
1061012942 9:127966063-127966085 GGGTGGGCCGGGAGGGAGGCTGG + Intronic
1061301019 9:129705129-129705151 GTGCGGGGTGGGTGGGAGGCAGG - Intronic
1061385468 9:130286937-130286959 GTGTGGGGTGGAGGGAAAGCAGG - Intronic
1061431758 9:130535706-130535728 GTGGGGGTGGGGAATGAAGCTGG + Intergenic
1061724984 9:132577345-132577367 GAGTGAGTGGGGAGGGAAACAGG + Intergenic
1061937486 9:133866159-133866181 GGGTGGGTGGGGAGCCAAGCTGG + Intronic
1062127375 9:134870814-134870836 GAGGGAGGTGGGAGGGAAGCTGG + Intergenic
1062345212 9:136111285-136111307 GTGTGGGCAGGGAGGGCCGCTGG - Intergenic
1062694241 9:137865015-137865037 CTGTGGCCTGTGAGGGAAGCGGG + Intronic
1202795173 9_KI270719v1_random:114675-114697 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1185509484 X:652444-652466 ATGTGAGCTGGGAGGGAAGTGGG + Intronic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186139508 X:6556198-6556220 GTGTGGGTTCGGGGGGAGACTGG - Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186406929 X:9312856-9312878 GTGATGGATGGGAGGGAAGAAGG + Intergenic
1186705798 X:12138420-12138442 GTGGGGGTGGGGAGAGGAGCAGG + Intergenic
1186905174 X:14102876-14102898 GTGGGGGATGGGAGGGCAGGTGG - Intergenic
1187453809 X:19423312-19423334 GGGTGGGATGGGAGGGAGGTAGG - Intronic
1187483138 X:19676354-19676376 GTGGGGGCTGGGTGGGAGGCGGG + Intronic
1187801430 X:23067804-23067826 GTGTGTGCTGGCAGGGCAGCGGG - Intergenic
1187952638 X:24485828-24485850 GTCAGGTTTGGGAAGGAAGCAGG - Intronic
1188594717 X:31885273-31885295 GTATGTTTTGGGAGGGAAGAGGG - Intronic
1189349761 X:40267523-40267545 GTGTTGTTTGGGAGGGAAGCTGG + Intergenic
1189732359 X:44034458-44034480 GTGTTGGTGGGGAGAGAAGAGGG - Intergenic
1190114182 X:47614953-47614975 GGGGAGGTTGTGAGGGAAGCAGG - Intronic
1190482872 X:50894850-50894872 GTGGGGGCTGGCAGGGAGGCAGG + Intergenic
1192185125 X:68941584-68941606 GCGGGGGTGGGGTGGGAAGCGGG - Intergenic
1192238001 X:69308136-69308158 GTGTGTGTTGGGGGAGGAGCAGG - Intergenic
1192419991 X:71021080-71021102 GTGGAGGATGGAAGGGAAGCTGG - Intergenic
1193541607 X:82779658-82779680 GTGGGGTTTGGGAGGGAGGTAGG + Intergenic
1194766950 X:97852459-97852481 GTGGGGGTAGGGTGGGAAGTTGG + Intergenic
1194978653 X:100417630-100417652 GTGGGGGTGGGGTGGGAAGGAGG + Intergenic
1195071114 X:101280965-101280987 GTGTGAGGTGGAAGGGAAGTGGG + Intronic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195720739 X:107865545-107865567 GGGTGGGCGGGGAGGGAAACAGG - Intronic
1196416310 X:115475514-115475536 GTGTGTGTTGGGGGAGAAGTGGG - Intergenic
1196462202 X:115942897-115942919 GAGTGGCTTGGGAGTGAAGTGGG - Intergenic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198216510 X:134560266-134560288 GTGGGTGGTGGGAGGGAACCGGG - Intergenic
1198235614 X:134733730-134733752 GGGTGGGTTGGCAGGGGTGCTGG + Intronic
1198382559 X:136098367-136098389 GTGTGGGGTGTGAGGGCCGCAGG - Intergenic
1198718797 X:139592755-139592777 CTGTGGGTTCAGAGTGAAGCAGG + Intronic
1198719632 X:139602255-139602277 GTGTGTGTTGGGGGGGAGGGTGG + Intronic
1198977307 X:142351288-142351310 GTGTGGGTTGGAAGGGAGGGTGG - Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1199965282 X:152814827-152814849 GGGTGGGTTGGGGTGGAGGCCGG - Intergenic
1200068654 X:153517412-153517434 GGGTGGGTGGGGATGGAAACTGG - Intergenic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201438541 Y:13985329-13985351 GTGTGGGGTGGGAGGGAGGGAGG - Intergenic
1201446032 Y:14057379-14057401 GTGTGGGGTGGGAGGGAGGGAGG + Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic
1202370994 Y:24195303-24195325 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1202499790 Y:25474814-25474836 GTGGGGGGTGGGAGGGATGGCGG - Intergenic