ID: 1130247897

View in Genome Browser
Species Human (GRCh38)
Location 15:82270076-82270098
Sequence CTTCATACCAGTATCTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130247897_1130247901 16 Left 1130247897 15:82270076-82270098 CCATCATAGATACTGGTATGAAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1130247901 15:82270115-82270137 AAGCTGAGATGTAAATTTGAGGG 0: 2
1: 0
2: 0
3: 20
4: 276
1130247897_1130247900 15 Left 1130247897 15:82270076-82270098 CCATCATAGATACTGGTATGAAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1130247900 15:82270114-82270136 CAAGCTGAGATGTAAATTTGAGG 0: 1
1: 1
2: 3
3: 18
4: 228
1130247897_1130247898 -10 Left 1130247897 15:82270076-82270098 CCATCATAGATACTGGTATGAAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1130247898 15:82270089-82270111 TGGTATGAAGCTCACAGAAGAGG 0: 1
1: 0
2: 1
3: 27
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130247897 Original CRISPR CTTCATACCAGTATCTATGA TGG (reversed) Intronic
903873301 1:26453244-26453266 CTTCATATCATTATTTATAATGG + Intronic
904332855 1:29775300-29775322 CTTCATTCCAGTTTTTATGGTGG + Intergenic
908838889 1:68258103-68258125 CTTCATACCATTTTCCATAATGG + Intergenic
909508190 1:76418853-76418875 CTTTTTACCATTATTTATGATGG + Intronic
910748781 1:90604565-90604587 CTTCATACCTATATATATTAAGG + Intergenic
911496010 1:98632224-98632246 CTTCATCCAAGTATCCATGCTGG - Intergenic
911906922 1:103581269-103581291 CTTCATAGCAGTATTAATGATGG + Intergenic
918734366 1:188039307-188039329 TTTTCTACCAGTATTTATGAAGG - Intergenic
1066929184 10:41735374-41735396 CTTCTTTCCAGTTTCTATGTGGG - Intergenic
1070659805 10:78296974-78296996 CTTCTTACCAGAAACTATGGAGG - Intergenic
1070885747 10:79896471-79896493 CTTCTTACCAGGCTCTTTGAGGG + Intergenic
1073917518 10:108423533-108423555 CTTCATACCGTTATCTATAGTGG - Intergenic
1079702250 11:23563160-23563182 CTCCATACCATTTTCTATAATGG + Intergenic
1082206483 11:49441410-49441432 CTTCTTACCAGAAACTATGAAGG - Intergenic
1082305341 11:50565843-50565865 CTTCTTCCCAGTATTTATAATGG + Intergenic
1083495014 11:63043951-63043973 CTTCAGGCCAATATCTCTGATGG + Intergenic
1085957499 11:81417399-81417421 TTTCATACCAGTATCCCTAAAGG + Intergenic
1086648782 11:89260362-89260384 CTTCTTACCAGAAACTATGAAGG + Intronic
1087459510 11:98427379-98427401 CCTCATACCATTTTCCATGATGG - Intergenic
1091942362 12:4499485-4499507 CTTCTAACCAGTTTCTATGTGGG + Intronic
1094024736 12:25950763-25950785 ATTCAAACCAGTCTCCATGAAGG + Intergenic
1095994051 12:48063559-48063581 CTTCATTCTTGTAACTATGAGGG - Intronic
1100402743 12:94246396-94246418 CTTTATAGCAGTATCGTTGAAGG + Intronic
1105675944 13:22671789-22671811 TTTTATACCAGTTGCTATGAGGG + Intergenic
1108480030 13:50859622-50859644 CTTCAGGCCAGTATCCTTGATGG + Intergenic
1111373345 13:87346869-87346891 CTACAAGCCAGTATCTTTGATGG + Intergenic
1112145223 13:96692196-96692218 TTTCCCATCAGTATCTATGAGGG + Intronic
1121411891 14:93753890-93753912 CTTCATAACAGATGCTATGATGG + Intronic
1125085481 15:35724692-35724714 CTTCATACCAGTAGATATCATGG - Intergenic
1125422152 15:39514994-39515016 CTTCAAAAGAGTATCTATCAAGG + Intergenic
1126516794 15:49548453-49548475 CTACAGACCAGTATCACTGATGG - Intronic
1130247897 15:82270076-82270098 CTTCATACCAGTATCTATGATGG - Intronic
1130452242 15:84067457-84067479 CTCCATACCAGTATCTCCGATGG + Intergenic
1136675052 16:31895540-31895562 CTTCATACCATTTTCTATAGTGG + Intronic
1139069864 16:63367056-63367078 CTTCGTACCAGTACCCATGTTGG - Intergenic
1140679611 16:77372187-77372209 CTTCATACCATTTTCCATAATGG - Intronic
1143031176 17:3968094-3968116 CTCCATACCAGCTTCTATGGGGG - Intergenic
1144734696 17:17548513-17548535 ATTCATACCAGAGTCTGTGACGG + Intronic
1144841276 17:18187715-18187737 CTTCTTACCAGTTTATATGCAGG - Intronic
1144898449 17:18561890-18561912 CTACATGCCAGTATCCCTGAAGG + Intergenic
1146997666 17:37334999-37335021 ACTCATACCAGTATGTCTGATGG + Intronic
1153118186 18:1686657-1686679 CTTCATACTTCTATCTATCAAGG + Intergenic
1154409930 18:14133358-14133380 CTTCAAACCAGCAGCCATGAGGG + Intergenic
1157058880 18:44262941-44262963 CTTCTTACTAGCTTCTATGATGG + Intergenic
1159574622 18:70160140-70160162 CTTCAGGCCAATATCTCTGATGG + Intronic
925674258 2:6343562-6343584 CTTCATGCCTTTATCTGTGAAGG - Intergenic
926404571 2:12538061-12538083 TCTCATGCCAGTATCAATGAAGG + Intergenic
927357859 2:22194136-22194158 CTTTAGACCAGTAACAATGAGGG - Intergenic
928484994 2:31721393-31721415 CTTCAGGCCAGTATCCTTGATGG + Intergenic
929233362 2:39582321-39582343 CTTCATACCATTATCCATAATGG + Intergenic
929632901 2:43483873-43483895 ATTTATACCAGTATTTATCAAGG + Intronic
930368694 2:50476537-50476559 AGCCATACCAGTATCAATGACGG - Intronic
930556512 2:52902679-52902701 CTGCATACCACTTTCTATAATGG - Intergenic
930722644 2:54652838-54652860 CTTCATGCCAGTTTCTGTGTTGG + Intronic
931103367 2:59027788-59027810 CCTCATATTAGTATCTATGGTGG - Intergenic
932594732 2:73086867-73086889 CCCCATACCCCTATCTATGAGGG + Intronic
933118460 2:78503874-78503896 CTTCAGGCCAGTATCTTTGATGG + Intergenic
933386284 2:81614502-81614524 CTTCATAGCAGTGTCTGTGAGGG - Intergenic
935204145 2:100883064-100883086 CTCCACAGCAGTGTCTATGATGG + Intronic
936032110 2:109080670-109080692 CTTTATTTTAGTATCTATGAAGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
938507265 2:131899372-131899394 CTTCAGGCCAATATCTTTGATGG + Intergenic
938979477 2:136512532-136512554 CTTCATACCATTTTCCATAATGG + Intergenic
940281736 2:151996127-151996149 TTTCATACTAGTATCTATTACGG - Intronic
940913750 2:159231581-159231603 CTTCATAGCAGTTCCTATAAAGG + Exonic
942387244 2:175455407-175455429 CTTGATACCAGAATGTATGGTGG - Intergenic
942562625 2:177236448-177236470 CTTTAAGCCAGTATCTATTAAGG + Intronic
943419670 2:187655016-187655038 TTTCATACTAGTATTTCTGAAGG + Intergenic
1168954573 20:1826064-1826086 CTTCTTGCCAGTTTCTATGTGGG + Intergenic
1170238525 20:14135212-14135234 CTCCATACCAATATCTGTCATGG + Intronic
1176786364 21:13260954-13260976 CTTCAGGCCAATATCTTTGATGG - Intergenic
1176863293 21:14026493-14026515 CTTCAAACCAGCAGCCATGAGGG - Intergenic
1177329132 21:19633330-19633352 CTAAAGACCAGTATCTCTGATGG + Intergenic
1177458581 21:21378259-21378281 TTTTATACCACTTTCTATGATGG + Intronic
1177984974 21:27963025-27963047 CTTCAGGCCAATATCTTTGATGG - Intergenic
953285736 3:41606541-41606563 CTTCATACCATTTTCTATAATGG + Intronic
959474941 3:106798745-106798767 CTTCTTACCAGAAACAATGAAGG + Intergenic
960450029 3:117795213-117795235 ATTCATAAAAGTATGTATGAAGG + Intergenic
961959209 3:130836589-130836611 CTTCTTTGCAGTTTCTATGATGG + Intergenic
965285612 3:166815910-166815932 TTTCATAGCTATATCTATGAAGG - Intergenic
966910326 3:184556022-184556044 CTGCAGACCAGTATCTCTGCGGG + Intronic
967065432 3:185911096-185911118 CTTCACAACATTCTCTATGAAGG + Intergenic
967074706 3:185991571-185991593 CTTCACAACATTCTCTATGAAGG + Intergenic
968322078 3:197779002-197779024 ATTCCCACCAGCATCTATGAGGG + Intronic
975261400 4:72303992-72304014 CTCCACACCAAGATCTATGAAGG + Exonic
976930919 4:90566229-90566251 CTACAGACCAATATCTCTGATGG - Intronic
976941843 4:90711769-90711791 CTTCAGGCCAGTATCCTTGATGG - Intronic
979880522 4:125952235-125952257 CTACATAGCACTACCTATGAAGG + Intergenic
980687310 4:136244730-136244752 CTTCATACCATTTTCCATAATGG - Intergenic
984149014 4:176102762-176102784 TGTAATACCAGAATCTATGAAGG + Intronic
987689404 5:21247268-21247290 CTTCTTACCATTATCCATAAAGG + Intergenic
989139247 5:38186569-38186591 CTACAGGCCAGTATCTCTGATGG + Intergenic
991239353 5:64439797-64439819 CTTCATACCATTTTCCATAATGG - Intergenic
995939884 5:117569136-117569158 CTGGAGACCAGTATCTCTGAAGG + Intergenic
997021794 5:130011181-130011203 TTTCAGGCCAGTATCTCTGATGG + Intronic
997036600 5:130200386-130200408 CTTCAAATCAATATATATGAAGG - Intergenic
998466483 5:142348560-142348582 CTCCATATCATTCTCTATGATGG - Intergenic
998485854 5:142501554-142501576 CTTCATACCATTATTTGTCATGG - Intergenic
998781116 5:145657853-145657875 CTCTATGCTAGTATCTATGATGG + Intronic
1003547341 6:7070771-7070793 ATTCATACCAGAATATATTAAGG - Intergenic
1006046234 6:31301111-31301133 CTTGAAAGCAGTATCTATGGTGG + Intronic
1006186213 6:32183009-32183031 CATCATAGGAGTATCTGTGAAGG - Exonic
1006240755 6:32676265-32676287 CTTCAGGCCAATATCTCTGATGG - Intergenic
1007045632 6:38771335-38771357 CTTCAAAGAAGTATGTATGAAGG - Intronic
1007878069 6:45129544-45129566 GTTCATACGGGTATCTAGGACGG - Intronic
1008243933 6:49147544-49147566 CTTCAGGCCAATATCTCTGATGG - Intergenic
1010153777 6:72767866-72767888 ATTCCTACCAGCATGTATGAGGG - Intronic
1010336766 6:74694232-74694254 CTTCATATCTATATATATGAAGG + Intergenic
1012169000 6:95994960-95994982 CTCCATACCATTTTCTATAATGG - Intergenic
1012378273 6:98588660-98588682 CTTCCTGCCACTATCTATGATGG - Intergenic
1012903302 6:105032794-105032816 CTTAATATCAGTAGCTATTAAGG - Intronic
1014304543 6:119724237-119724259 CTACAGACCAATATCTCTGATGG - Intergenic
1014656361 6:124110032-124110054 CTACACACCAATATCTATGATGG - Intronic
1015696405 6:135985028-135985050 CTTCATTCCATTATTTCTGAGGG - Intronic
1018995376 6:168706026-168706048 CTTCTTAGCAGCAGCTATGAAGG - Intergenic
1023306365 7:38832884-38832906 TTGCAGACCAGTATCTAAGATGG + Intronic
1023345598 7:39268219-39268241 CTACATTCCATTATCTTTGATGG - Intronic
1023419843 7:39967658-39967680 CTCCATACCATTATCCATGATGG + Intronic
1023763899 7:43492985-43493007 CTTGATACCAGGATTAATGAAGG - Intronic
1027770155 7:82396487-82396509 CTTAATACTAGTATCTGTCAAGG + Intronic
1030427307 7:109395271-109395293 CTACAAACCTGTACCTATGAGGG + Intergenic
1030604649 7:111626785-111626807 CTTCATACCATTTTCCATAATGG + Intergenic
1034366590 7:150554839-150554861 CTTCAGGCCAGTATCTCTGAGGG + Intergenic
1037488006 8:19366972-19366994 CTTCATACCGTTGTTTATGATGG + Intronic
1039378818 8:37065438-37065460 CTTCATACCATTTTCCATAATGG - Intergenic
1040875131 8:52142885-52142907 CTTCATTCCAGAATCTTAGAGGG + Intronic
1041158821 8:55016699-55016721 CTTCAGAGCAGTGTCTAGGAGGG + Intergenic
1044841572 8:96341243-96341265 CTTCATACATGCATGTATGAAGG - Intergenic
1045092291 8:98758356-98758378 CTTCAGACCAATATCTCTGATGG + Intronic
1047419232 8:124692779-124692801 CTTCCCACCAGGATCCATGAGGG + Intronic
1053189474 9:36049924-36049946 CTTGATAGCAGTATCTAACATGG + Intronic
1058293894 9:103280438-103280460 CTTAATCCCATTAACTATGAAGG - Intergenic
1059611357 9:115900512-115900534 CTTCATCCCAATATCTCTTATGG + Intergenic
1060376010 9:123115583-123115605 CTTCTTACCAGGCTCTGTGATGG - Intronic
1187124586 X:16442860-16442882 CTCCATACCATTTTCCATGATGG - Intergenic
1188878216 X:35459421-35459443 CTTCACACTACTATATATGATGG - Intergenic
1190518606 X:51252209-51252231 CTACAAACCAGTATCTTTCATGG - Intergenic
1192850483 X:74950774-74950796 CTTCATACCATTGTCAATAATGG + Intergenic
1193023296 X:76816140-76816162 CTTCATATCACTATTTATCAGGG - Intergenic
1194477409 X:94375797-94375819 CTTCATACTATTTTCTATAATGG - Intergenic
1194485673 X:94482963-94482985 CTTCAGGCCAGTATCTCTGATGG - Intergenic
1195830017 X:109046568-109046590 CTTCCTACCAGTGTCTCTTATGG - Intergenic
1196118110 X:112019120-112019142 CTTCATAGCAGTATCTAGATTGG + Intronic
1196286192 X:113883123-113883145 CTTTTTATCATTATCTATGAAGG + Intergenic
1196577125 X:117332241-117332263 CTGCATTCAAGTATCTATGTGGG - Intergenic
1196793530 X:119484856-119484878 CTTCATACCATTTTCCATAATGG + Intergenic
1197067576 X:122252262-122252284 CTTCATATATGTATATATGAAGG + Intergenic