ID: 1130249918

View in Genome Browser
Species Human (GRCh38)
Location 15:82293255-82293277
Sequence CCGGCCATTTCTCCATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130249910_1130249918 27 Left 1130249910 15:82293205-82293227 CCCTCCTCGGTCTTCCAAAGTGC No data
Right 1130249918 15:82293255-82293277 CCGGCCATTTCTCCATTTGAAGG No data
1130249914_1130249918 13 Left 1130249914 15:82293219-82293241 CCAAAGTGCTGCGATTACAGGTG 0: 375
1: 75394
2: 212732
3: 254594
4: 202480
Right 1130249918 15:82293255-82293277 CCGGCCATTTCTCCATTTGAAGG No data
1130249912_1130249918 23 Left 1130249912 15:82293209-82293231 CCTCGGTCTTCCAAAGTGCTGCG No data
Right 1130249918 15:82293255-82293277 CCGGCCATTTCTCCATTTGAAGG No data
1130249911_1130249918 26 Left 1130249911 15:82293206-82293228 CCTCCTCGGTCTTCCAAAGTGCT 0: 74
1: 4610
2: 102229
3: 192868
4: 132890
Right 1130249918 15:82293255-82293277 CCGGCCATTTCTCCATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130249918 Original CRISPR CCGGCCATTTCTCCATTTGA AGG Intergenic
No off target data available for this crispr