ID: 1130251229

View in Genome Browser
Species Human (GRCh38)
Location 15:82301442-82301464
Sequence TGCCATAGGCTTGGTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130251229_1130251240 19 Left 1130251229 15:82301442-82301464 CCCTCCCCACCAAGCCTATGGCA No data
Right 1130251240 15:82301484-82301506 CTCCCTCCAGTGTCCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130251229 Original CRISPR TGCCATAGGCTTGGTGGGGA GGG (reversed) Intergenic
No off target data available for this crispr