ID: 1130254733

View in Genome Browser
Species Human (GRCh38)
Location 15:82320640-82320662
Sequence CTCTGTGGCCCCAGCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130254733_1130254742 -2 Left 1130254733 15:82320640-82320662 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1130254742 15:82320661-82320683 AGGGCTGGCCGCCAGCACCAGGG No data
1130254733_1130254751 29 Left 1130254733 15:82320640-82320662 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1130254751 15:82320692-82320714 TCCTCGTGTGTTGCAGAACGTGG No data
1130254733_1130254743 -1 Left 1130254733 15:82320640-82320662 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1130254743 15:82320662-82320684 GGGCTGGCCGCCAGCACCAGGGG No data
1130254733_1130254741 -3 Left 1130254733 15:82320640-82320662 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1130254741 15:82320660-82320682 GAGGGCTGGCCGCCAGCACCAGG No data
1130254733_1130254753 30 Left 1130254733 15:82320640-82320662 CCCCCGGGGCTGGGGCCACAGAG No data
Right 1130254753 15:82320693-82320715 CCTCGTGTGTTGCAGAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130254733 Original CRISPR CTCTGTGGCCCCAGCCCCGG GGG (reversed) Intergenic
No off target data available for this crispr