ID: 1130258421

View in Genome Browser
Species Human (GRCh38)
Location 15:82336629-82336651
Sequence CCTGCTCCTTACCCCTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130258421_1130258429 22 Left 1130258421 15:82336629-82336651 CCTTCCAAGGGGTAAGGAGCAGG No data
Right 1130258429 15:82336674-82336696 CACACACTGAACCAGTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130258421 Original CRISPR CCTGCTCCTTACCCCTTGGA AGG (reversed) Intergenic
No off target data available for this crispr