ID: 1130258429

View in Genome Browser
Species Human (GRCh38)
Location 15:82336674-82336696
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130258425_1130258429 -2 Left 1130258425 15:82336653-82336675 CCTGTCGACTTGCTCCTGACCCA No data
Right 1130258429 15:82336674-82336696 CACACACTGAACCAGTCCCTAGG No data
1130258421_1130258429 22 Left 1130258421 15:82336629-82336651 CCTTCCAAGGGGTAAGGAGCAGG No data
Right 1130258429 15:82336674-82336696 CACACACTGAACCAGTCCCTAGG No data
1130258420_1130258429 23 Left 1130258420 15:82336628-82336650 CCCTTCCAAGGGGTAAGGAGCAG No data
Right 1130258429 15:82336674-82336696 CACACACTGAACCAGTCCCTAGG No data
1130258424_1130258429 18 Left 1130258424 15:82336633-82336655 CCAAGGGGTAAGGAGCAGGGCCT No data
Right 1130258429 15:82336674-82336696 CACACACTGAACCAGTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130258429 Original CRISPR CACACACTGAACCAGTCCCT AGG Intergenic