ID: 1130268785

View in Genome Browser
Species Human (GRCh38)
Location 15:82432615-82432637
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 2, 1: 22, 2: 20, 3: 22, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130268785_1130268790 -8 Left 1130268785 15:82432615-82432637 CCCTGCAGGATCTGGAGGTAAGA 0: 2
1: 22
2: 20
3: 22
4: 177
Right 1130268790 15:82432630-82432652 AGGTAAGAGGCCCTGGGCCGAGG 0: 9
1: 8
2: 22
3: 27
4: 293
1130268785_1130268794 9 Left 1130268785 15:82432615-82432637 CCCTGCAGGATCTGGAGGTAAGA 0: 2
1: 22
2: 20
3: 22
4: 177
Right 1130268794 15:82432647-82432669 CCGAGGTGCAGTGACCCTGCAGG 0: 8
1: 17
2: 10
3: 20
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130268785 Original CRISPR TCTTACCTCCAGATCCTGCA GGG (reversed) Exonic
901028162 1:6290188-6290210 TCTTCCCTCCAGCTCCTGGTAGG + Intronic
901631081 1:10648437-10648459 TCTTCCTTCCAGAACCTGCTCGG + Intronic
903500572 1:23798111-23798133 TCTCACCTCCAGAAGCTGGATGG + Exonic
904531444 1:31172323-31172345 TCTTGCAGCCAGAGCCTGCATGG - Intergenic
906582997 1:46952052-46952074 CCATCCCTCCAGATCCAGCAGGG + Intergenic
908785565 1:67731497-67731519 TTCTAGCTCCAGATCCTGCAGGG - Intronic
908974413 1:69880298-69880320 TCTCACCTCCAGCTCCCACAAGG - Intronic
913273533 1:117117093-117117115 CCTAAGCTCCAGATCCTGCTGGG + Intronic
915290550 1:154880243-154880265 TCTCACCTCCAGAGCCCGCAGGG + Intergenic
915661664 1:157410277-157410299 TATCACCTCCAGCTCCTCCACGG - Intergenic
916648330 1:166811385-166811407 TCTTACATCCAGAATCTACAAGG - Intergenic
919082771 1:192886750-192886772 CCATACCTCCAGATCCAGCAGGG - Intergenic
920259590 1:204679862-204679884 TTTTTCCTCCTGCTCCTGCAGGG - Intronic
921574997 1:216824541-216824563 TCTTAGGCACAGATCCTGCAGGG + Intronic
922199810 1:223392559-223392581 CCTGACCTCCAGTTCCAGCAAGG - Intergenic
923554822 1:234992307-234992329 TCATACCTGCAGATTCTGCAGGG - Intergenic
923945808 1:238885932-238885954 TCTAACATCCAGACCCTACAAGG - Intergenic
1065784699 10:29202410-29202432 TTTTCCCTCCAAATCCTGAAAGG - Intergenic
1065918468 10:30371059-30371081 TCTTACCTCCAGATCCTTCAGGG + Intronic
1066022412 10:31318201-31318223 TCTTGCCTTAAGGTCCTGCACGG + Intergenic
1066422218 10:35273993-35274015 TGCTACCTCCAGAACCTGGAAGG + Intronic
1067070328 10:43126270-43126292 TCTTATCTCCAGGGCCTGGAGGG - Intronic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1070282176 10:75057990-75058012 TCTTCCCTCCAGGTGCTGCAGGG - Intronic
1070557394 10:77539173-77539195 TGTTCCCTCAAGAGCCTGCAAGG + Intronic
1072188806 10:93064520-93064542 ACCTACCTTCAGCTCCTGCATGG - Exonic
1073219087 10:101854638-101854660 CCTTACCTCCAGAGGCTTCAGGG - Intronic
1073542279 10:104323926-104323948 TCCTACCTACAGTTCCAGCATGG + Intronic
1073641220 10:105254575-105254597 TCTTACATGCAGGTTCTGCAGGG - Intronic
1077431819 11:2519386-2519408 TCTCACCTCCAGATCCTTAATGG - Intronic
1079090111 11:17475013-17475035 TCTGACTTCCCCATCCTGCAGGG + Exonic
1079927568 11:26513715-26513737 TTTTACTTTCAAATCCTGCAGGG + Intronic
1080578840 11:33624414-33624436 ACTGGCCTCCAGCTCCTGCAGGG - Intronic
1083105840 11:60357894-60357916 TGTTTCCTTCAGATTCTGCATGG + Intronic
1083590361 11:63890090-63890112 TCTTACCTCTTTATCCTTCAGGG + Intronic
1084008992 11:66337424-66337446 TCTTGCCTCCAGATCCAGCCAGG + Exonic
1085475698 11:76787541-76787563 TCTAACCTGCTGATCCTGCAGGG + Intronic
1085545353 11:77312939-77312961 TCTTTCCAACACATCCTGCAAGG - Intergenic
1086610791 11:88753216-88753238 TCTTATATCCAGATTCTACAAGG + Intronic
1088506415 11:110531976-110531998 TTTTACCTGCAGAGCCTGAAAGG - Intergenic
1092669783 12:10849626-10849648 TCCTACCACCACATCCTGCTGGG - Intronic
1094641006 12:32275705-32275727 CCATCCCTCCAGATCCGGCAGGG + Intronic
1096967034 12:55636943-55636965 TCTGACCTCAAGGCCCTGCAGGG + Exonic
1097376738 12:58852181-58852203 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1097377746 12:58859310-58859332 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1098665810 12:73161919-73161941 TCTTACCTCAATATCCAGCCTGG + Intergenic
1100461037 12:94799414-94799436 CCTTACCTCCAGATACTGGGTGG + Intergenic
1101742587 12:107512354-107512376 TCTTACCTTCAGCTCCTACTAGG - Intronic
1102746062 12:115250146-115250168 TCCTTCCTCCCTATCCTGCAAGG - Intergenic
1103067965 12:117915638-117915660 TCTTATCTCCATATCCTCCATGG + Intronic
1104187860 12:126449627-126449649 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1107877636 13:44804760-44804782 TATTACCCCCAGATTCTTCAAGG + Intergenic
1108876210 13:55054068-55054090 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1109451677 13:62522712-62522734 TATTACCTCCAAATCTTTCAGGG - Intergenic
1109523580 13:63545099-63545121 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1110987069 13:81984397-81984419 CCATCCCTCCAGATCCGGCAGGG - Intergenic
1112589238 13:100748622-100748644 TTTTATCTCCAGAACCTGCAAGG - Intergenic
1114384832 14:22243826-22243848 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1114757037 14:25270896-25270918 TCTTCCCTCCAGAAGATGCAGGG - Intergenic
1114840848 14:26260628-26260650 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1115464585 14:33700928-33700950 TTTTTCCTCCAGAACCTACATGG - Intronic
1116172972 14:41426768-41426790 TCTTGCAGCCAGAGCCTGCATGG + Intergenic
1116740335 14:48746746-48746768 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1117889639 14:60405309-60405331 TCTTATATCCAGAGTCTGCAAGG - Intronic
1118005652 14:61562455-61562477 TCTTACCTGCAGATCCAGCCTGG + Intronic
1118457621 14:65959058-65959080 GCATACTTCCAGATCATGCAGGG + Intronic
1119530016 14:75353445-75353467 ACGTCCCTCCAGATCCTCCACGG - Intergenic
1119664237 14:76473173-76473195 TCTGAGCTTCAGATCTTGCATGG + Intronic
1120989740 14:90364641-90364663 ACCAACCTCCAGATCCTACAAGG + Intergenic
1121227158 14:92329374-92329396 TCTTTCCTGAAGATTCTGCATGG + Intronic
1123472373 15:20564968-20564990 TCTTACCTCCAGATCCTTCAGGG - Intergenic
1123645630 15:22435385-22435407 TCTTACCTCCAGATCCTTCAGGG + Intergenic
1123666884 15:22614950-22614972 TCTTACCTCCAGATCTTTCAGGG + Intergenic
1123732678 15:23159959-23159981 TCTTACCTCCAGATCCTTCAGGG - Intergenic
1123750811 15:23357339-23357361 TCTTACCTCCAGATCCTTCAGGG - Exonic
1123885914 15:24728263-24728285 TTTTACTTACAGATCCTGCCAGG - Intergenic
1124283182 15:28381255-28381277 TCTTACCTCCAGATCCTTCAGGG - Exonic
1124299517 15:28530358-28530380 TCTTACCTCCAGATCCTTCAGGG + Exonic
1124320724 15:28709523-28709545 TCTTACCTCCAGATCTTTCAGGG + Exonic
1124481769 15:30085826-30085848 TCTTACCTCCAGATCTTTCAGGG - Exonic
1124488225 15:30137924-30137946 TCTTACCTCCAGATCTTTCAGGG - Exonic
1124521822 15:30411375-30411397 TCTTACCTCCAGATCTTTCAGGG + Exonic
1124536842 15:30554844-30554866 TCTTACCTCCAGATCTTTCAGGG - Exonic
1124543316 15:30606898-30606920 TCTTACCTCCAGATCTTTCAGGG - Exonic
1124563275 15:30794350-30794372 TCCTACCTCCAGATCCTTCAGGG - Intergenic
1124755301 15:32400396-32400418 TCTTACCTCCAGATCTTTCAGGG + Exonic
1124761810 15:32452747-32452769 TCTTACCTCCAGATCTTTCAGGG + Exonic
1124776819 15:32596321-32596343 TCTTACCTCCAGATCTTTCAGGG - Exonic
1124960011 15:34386883-34386905 TCCTACCTCCAGATCCTTCAGGG + Intronic
1124976640 15:34533104-34533126 TCCTACCTCCAGATCCTTCAGGG + Intronic
1125270838 15:37936936-37936958 TTCTTCCTCCAGCTCCTGCAAGG - Exonic
1127774094 15:62252164-62252186 TCTTACTTCCAGATCCTTCAGGG + Intergenic
1127775671 15:62262384-62262406 TCTTACGTCCAGATTCTTCAGGG + Intergenic
1129029342 15:72607314-72607336 TCTTACCTCCAGATCCTTTAGGG - Intergenic
1129037280 15:72658358-72658380 TCTTACTTCCAGATCCTTCAGGG - Intronic
1129119792 15:73389301-73389323 TCTTGCTTCCCGGTCCTGCAGGG + Intergenic
1129212607 15:74078867-74078889 TCTTACTTCCAGATCCTTCAGGG + Intronic
1129397792 15:75262212-75262234 TCTTACTTCCAGATCCTTCAGGG - Intronic
1129401403 15:75286493-75286515 TCTTACTTCCAGATCCTTCAGGG - Intronic
1129475000 15:75779193-75779215 TCTTACCTCCAGATCCTTCAGGG - Intergenic
1129729745 15:77923188-77923210 TCTTACTTCCAGATCCTTCAGGG + Intergenic
1129838778 15:78730787-78730809 TCTTACCTCCAGATCCTTCAGGG - Intergenic
1130259940 15:82346821-82346843 TCTTACCTCCAGATCCTGCAGGG + Exonic
1130268785 15:82432615-82432637 TCTTACCTCCAGATCCTGCAGGG - Exonic
1130281289 15:82522188-82522210 TCTTACCTCCAGATCCTCCAGGG - Intergenic
1130472664 15:84238371-84238393 TCTTACCTCCAGATCCTCCAGGG - Exonic
1130480155 15:84352942-84352964 TCTTACCTCCAGATCCTCCAGGG - Intergenic
1130484385 15:84390513-84390535 TCTTACCTCCAGATCCTCCAGGG - Intergenic
1130491614 15:84435187-84435209 TCTTACCTCCAGATCCTCCAGGG + Intergenic
1130503229 15:84514227-84514249 TCTTACCTCCAGATCCTCCAGGG + Intergenic
1130594959 15:85243005-85243027 TCTTACCTCCAGATCCTCCAGGG - Intergenic
1131836703 15:96398166-96398188 TTTTGCCTCCAGATTCTGTAAGG - Intergenic
1132433602 15:101779358-101779380 TCTTACCTCCAGATCCTTCAGGG + Intergenic
1133234508 16:4381671-4381693 GCTCACATCCAGCTCCTGCAGGG - Exonic
1134353312 16:13458187-13458209 TGTTTCCTCCAGATACTGCTTGG - Intergenic
1137484296 16:48878907-48878929 TCATACCTCCAAAGCCTCCAAGG + Intergenic
1137527573 16:49249771-49249793 TCTTACTTGCAGATTCTGGAAGG - Intergenic
1141245301 16:82301721-82301743 TCTTCCCTCTGGATCCTCCAAGG + Intergenic
1141255425 16:82397482-82397504 CCCTACCTACAGACCCTGCAAGG - Intergenic
1143289380 17:5817482-5817504 TCTTACATCCAGTTCCTGTGAGG - Intronic
1144718166 17:17448900-17448922 ACTGACCTCCACATGCTGCAGGG + Intergenic
1146225289 17:31060699-31060721 TCTTACCCCCAGCTCCTCCTGGG - Intergenic
1147440940 17:40446927-40446949 TCTCACCCACAGACCCTGCAGGG - Intronic
1147458041 17:40550771-40550793 TCTTCCCACCAGACCCTGCTGGG - Intergenic
1149243102 17:54673728-54673750 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1149294430 17:55249155-55249177 TGTTTCCTCCATTTCCTGCAAGG + Intergenic
1149315677 17:55436171-55436193 TCTTTCTTCCAGCTCCTGGAAGG + Intergenic
1152919192 17:83057322-83057344 TCCTAACTCCAATTCCTGCAGGG - Intergenic
1156800996 18:41113719-41113741 TCTTACTTCCAGTTCTTGCATGG + Intergenic
1157260035 18:46169616-46169638 TCACTCCTCCAGAGCCTGCAAGG + Intergenic
1161605214 19:5211060-5211082 TCTTCCCTCCATCTCCTTCAAGG + Intronic
1162551280 19:11359809-11359831 TCTTGCCCACAGATCCTGCTGGG + Exonic
1162793663 19:13075796-13075818 TCTTGCCTCCTGATCTTCCAGGG + Intronic
1164056878 19:21629520-21629542 TCATCCCTCCAGATCCAGCAAGG + Intergenic
1166366861 19:42282206-42282228 TCTGACCTCCAGAGACTGCAGGG - Intronic
1166697531 19:44861618-44861640 TCTAACATCCAGAACCTACAAGG + Intronic
925668909 2:6290800-6290822 TCATGCCTCCAGGTGCTGCATGG - Intergenic
925876760 2:8317875-8317897 TTCTACCTCCAGATTCTGTAAGG + Intergenic
927895678 2:26780293-26780315 TCCTACCCTCAGCTCCTGCAAGG + Exonic
931099616 2:58981896-58981918 TCTTATCTCCAGTGACTGCATGG + Intergenic
932111031 2:69000508-69000530 TCTAATATCCAGAGCCTGCAAGG - Intergenic
932329628 2:70890719-70890741 TCTTACCCCAAGATGCTGCTAGG - Intergenic
933842830 2:86301310-86301332 TCTTCCTTCCAGTTCCTGCCAGG + Intronic
933935655 2:87201640-87201662 TCTATCCTCCAGGCCCTGCATGG - Intergenic
936357494 2:111764185-111764207 TCTATCCTCCAGGCCCTGCATGG + Intergenic
938927833 2:136060655-136060677 TCTTCCCTTCAGAGCCTCCATGG + Intergenic
940144540 2:150532526-150532548 TCTTTCCTCCATCTCCTTCAAGG + Intronic
942689707 2:178572545-178572567 TTTTACCTTCAGATCCTGTGGGG + Exonic
943019263 2:182552947-182552969 CCATCCCTCCAGATCCAGCAGGG + Intergenic
944879063 2:203992819-203992841 TTTTACCCCCAGATCCTACGTGG - Intergenic
946334442 2:219027995-219028017 CATGTCCTCCAGATCCTGCATGG + Exonic
1172609250 20:36237211-36237233 TATTACCTACAAAGCCTGCACGG - Intronic
1175377330 20:58537242-58537264 CATTACCTCCATATACTGCATGG - Intergenic
1175571583 20:60026774-60026796 TCTGACCTACAGACCCTGTAGGG + Intronic
1179025400 21:37675234-37675256 TATTAACTCCAGATCCTTAAAGG - Intronic
1183105272 22:35610878-35610900 TCCTACCTCCAGGTACTTCACGG + Exonic
1184198883 22:42951457-42951479 CCTGAGCTCCAGATCCGGCATGG + Intronic
1184689080 22:46109337-46109359 TCCTACCTCCAGAGCCAGGATGG - Intronic
1184923419 22:47621464-47621486 GCTTATCTCTAGATCCTGCGGGG - Intergenic
951131002 3:19044952-19044974 TCTCACCTGGAGATCGTGCATGG + Intergenic
951326066 3:21303088-21303110 CCATCCCTCCAGATCCGGCAGGG - Intergenic
954823555 3:53351567-53351589 TCTTACCTCCAGCCACTGGAAGG - Intergenic
955957410 3:64304795-64304817 TCTTATTTCCAGTTCATGCAAGG - Intronic
961731108 3:128965505-128965527 TCTTACCTCTAGTTCCTGAATGG + Intronic
966270547 3:178099269-178099291 TCTTAACTCTAGATCCAGGAAGG + Intergenic
969162624 4:5274841-5274863 TCATCCCTCCAGATCCAGCAGGG + Intronic
973667449 4:53177366-53177388 TCTCTCCTCCAGATTCTGCATGG - Intronic
973782261 4:54300018-54300040 TTTTAGCTCCAGATCCTGAGAGG + Intergenic
974438976 4:61892942-61892964 ACTTACCTATAGTTCCTGCAGGG - Exonic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976763146 4:88571506-88571528 TTTTTCCCCCAGATCCTGGAAGG + Intronic
980519456 4:133911404-133911426 TCTAACATCCAGAGTCTGCAAGG + Intergenic
980695217 4:136345792-136345814 TCTGATCTACAGATACTGCAAGG + Intergenic
983297085 4:165879786-165879808 TCTGAGCTCAAGATGCTGCAGGG - Intronic
983798086 4:171891386-171891408 TCTTTCCTCAAGATTCTTCAAGG - Intronic
984678179 4:182574737-182574759 TCTTACTACCAAATCTTGCAGGG - Intronic
985519577 5:367204-367226 TCTTCCCCCCAGCTCCTCCAGGG - Intronic
986347602 5:6849194-6849216 TCTTAGCTCCAGGTGCTGCATGG + Intergenic
991996662 5:72394487-72394509 TCTTAACTCCAGATGGTCCAAGG + Intergenic
993225650 5:85165372-85165394 CCATCCCTCCAGATCCAGCAGGG + Intergenic
993642090 5:90417641-90417663 TCCACCCTCCAGATCCAGCAGGG - Intergenic
993704648 5:91155764-91155786 TCTTTCCTCCAAAACCTACATGG - Intronic
995125588 5:108574443-108574465 CCATCCCTCCAGATCCAGCAGGG - Intergenic
995862824 5:116660328-116660350 TCTGACCTCCAGCTGCAGCAGGG + Intergenic
996128280 5:119751571-119751593 CCATCCCTCCAGATCCGGCAGGG + Intergenic
997605796 5:135174900-135174922 TCTTACTACCACCTCCTGCAGGG + Intronic
998644322 5:144045580-144045602 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1000509749 5:162165861-162165883 TGATACCTCCAGATACTGGAAGG + Intergenic
1001942432 5:175750303-175750325 TCTTCCAACCAGAACCTGCAAGG + Intergenic
1006937005 6:37725595-37725617 TCTTTCCTCAAAATGCTGCAGGG - Intergenic
1009679833 6:66877993-66878015 ACTTTCCTCCAGTTCCTGAAAGG - Intergenic
1014912191 6:127108084-127108106 TCTTTCCTCCAGTTCCAGAAAGG + Intergenic
1017984200 6:159428265-159428287 TCTTACCTTCAGTTCTTGCCTGG + Intergenic
1018713891 6:166516808-166516830 TCTCAGCTTCAGATCATGCAGGG - Intronic
1018760558 6:166891239-166891261 CCATCCCTCCGGATCCTGCAGGG + Intronic
1019217313 6:170452268-170452290 TCCACCCTCCAGAACCTGCAGGG + Intergenic
1019706515 7:2499562-2499584 TCTAAGCTCCAGTTCCTCCAAGG - Intergenic
1022117661 7:27276512-27276534 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1022451874 7:30523401-30523423 TCTTACCTCCAGATCCTTCAGGG + Intronic
1024366743 7:48528930-48528952 TGTTACCCACAGAGCCTGCAGGG - Intronic
1025716569 7:63962592-63962614 CCATCCCTCCAGATCCGGCAGGG - Intergenic
1025962820 7:66238513-66238535 TCTTAACTCCAGATTCTGCTCGG + Intronic
1026148035 7:67764967-67764989 TTTTAAGGCCAGATCCTGCATGG - Intergenic
1027868356 7:83675029-83675051 CCATACCTCCGGATCCGGCAGGG - Intergenic
1028013992 7:85684152-85684174 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1029192789 7:98783615-98783637 TCTTGCCTCCAGATGCTTCTTGG - Intergenic
1029544371 7:101202508-101202530 TTTTGCCTCCAGCGCCTGCAGGG + Intergenic
1031299582 7:120047511-120047533 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1032653851 7:133906731-133906753 CCATCCCTCCAGATCCGGCAGGG + Intronic
1034215597 7:149403341-149403363 GCTTACCTCCAGTTTCTCCAAGG - Intergenic
1034738223 7:153448880-153448902 CCTTACAGCCAGATCCTCCAGGG + Intergenic
1035813422 8:2513004-2513026 TCTTACTCCCTGTTCCTGCATGG + Intergenic
1038441303 8:27572579-27572601 TCTTACCTCCAGAACCACAAGGG - Intergenic
1040893305 8:52339461-52339483 TCACAGTTCCAGATCCTGCAGGG + Intronic
1048354700 8:133643481-133643503 TCTTAGCTCCTGACCCTGGAGGG + Intergenic
1048718848 8:137299188-137299210 TCTTTCCTCCAAATGCTACATGG - Intergenic
1050719774 9:8574102-8574124 TAATACCTACAGATACTGCACGG + Intronic
1050722256 9:8604163-8604185 TCTAACCTCAAGATCCTCCCAGG + Intronic
1053134326 9:35640620-35640642 CCATCCCTCCAGATCCGGCAGGG - Intronic
1053174588 9:35912778-35912800 TCTCCCTTCCAGATCCTGCACGG - Intergenic
1055009835 9:71553133-71553155 TATTCCCTCCTGATCCCGCAAGG - Intergenic
1055170536 9:73253148-73253170 TCCTACCTCAAGAACCTGGAAGG + Intergenic
1057871518 9:98721764-98721786 CTTTACCTCCACCTCCTGCAGGG + Intergenic
1057880423 9:98788736-98788758 TCCCACCTGCAGCTCCTGCATGG - Intronic
1058274291 9:103021170-103021192 TCCCATCTCCAGATCCTTCAGGG - Intergenic
1058306459 9:103447962-103447984 GCTTACCTCCAGATGTTCCAGGG + Intergenic
1059806357 9:117805240-117805262 TCTGACCTCTAGATCTTGCAAGG + Intergenic
1203368110 Un_KI270442v1:275962-275984 TATGAGCTCAAGATCCTGCAAGG - Intergenic
1189550635 X:42088897-42088919 TCTTGCATCCAGACGCTGCATGG - Intergenic
1190240568 X:48654947-48654969 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1191614696 X:63156626-63156648 TCTAACATCCAGAGTCTGCAAGG + Intergenic
1191621600 X:63222301-63222323 TCTAACATCCAGAGTCTGCAAGG - Intergenic
1191788217 X:64940284-64940306 TCTAATATCCAGATCCTACAAGG - Intronic
1193161999 X:78238715-78238737 TCTTACCTCCAGTGGCAGCATGG - Intergenic
1193306259 X:79956083-79956105 CCATGCCTCCAGATCCAGCAGGG + Intergenic
1196993639 X:121356667-121356689 TCACCCCTCCAGATCCCGCAGGG + Intergenic
1198566832 X:137913866-137913888 CCATCCCTCCAGATCCGGCAGGG - Intergenic
1199172392 X:144746371-144746393 GCCTAGCTCCAGTTCCTGCAGGG - Intergenic
1199368816 X:147020948-147020970 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1202366695 Y:24170699-24170721 TCTTACCTCCAGATCCTCCAGGG - Intergenic
1202373710 Y:24214783-24214805 TCTTACCTCCAGATCCTCCAGGG + Intergenic
1202497071 Y:25455337-25455359 TCTTACCTCCAGATCCTCCAGGG - Intergenic
1202504087 Y:25499424-25499446 TCTTACCTCCAGATCCTCCAGGG + Intergenic