ID: 1130270646

View in Genome Browser
Species Human (GRCh38)
Location 15:82445268-82445290
Sequence CAGGGGGCGCGCGGGTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130270631_1130270646 27 Left 1130270631 15:82445218-82445240 CCGGAAGCGCGCGCATGCTCTGG No data
Right 1130270646 15:82445268-82445290 CAGGGGGCGCGCGGGTTGAGGGG No data
1130270638_1130270646 -6 Left 1130270638 15:82445251-82445273 CCGCCGAAACGGGTGCGCAGGGG No data
Right 1130270646 15:82445268-82445290 CAGGGGGCGCGCGGGTTGAGGGG No data
1130270635_1130270646 1 Left 1130270635 15:82445244-82445266 CCTGCAGCCGCCGAAACGGGTGC No data
Right 1130270646 15:82445268-82445290 CAGGGGGCGCGCGGGTTGAGGGG No data
1130270641_1130270646 -9 Left 1130270641 15:82445254-82445276 CCGAAACGGGTGCGCAGGGGGCG No data
Right 1130270646 15:82445268-82445290 CAGGGGGCGCGCGGGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130270646 Original CRISPR CAGGGGGCGCGCGGGTTGAG GGG Intergenic