ID: 1130276163

View in Genome Browser
Species Human (GRCh38)
Location 15:82477373-82477395
Sequence AGGTGAGTAGGTCCTGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130276163_1130276167 -8 Left 1130276163 15:82477373-82477395 CCCATGCCAGGACCTACTCACCT No data
Right 1130276167 15:82477388-82477410 ACTCACCTGCAGCTTCTCCATGG No data
1130276163_1130276170 4 Left 1130276163 15:82477373-82477395 CCCATGCCAGGACCTACTCACCT No data
Right 1130276170 15:82477400-82477422 CTTCTCCATGGCCCCCTGCAGGG No data
1130276163_1130276174 13 Left 1130276163 15:82477373-82477395 CCCATGCCAGGACCTACTCACCT No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276163_1130276169 3 Left 1130276163 15:82477373-82477395 CCCATGCCAGGACCTACTCACCT No data
Right 1130276169 15:82477399-82477421 GCTTCTCCATGGCCCCCTGCAGG No data
1130276163_1130276173 12 Left 1130276163 15:82477373-82477395 CCCATGCCAGGACCTACTCACCT No data
Right 1130276173 15:82477408-82477430 TGGCCCCCTGCAGGGCCCGGTGG No data
1130276163_1130276172 9 Left 1130276163 15:82477373-82477395 CCCATGCCAGGACCTACTCACCT No data
Right 1130276172 15:82477405-82477427 CCATGGCCCCCTGCAGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130276163 Original CRISPR AGGTGAGTAGGTCCTGGCAT GGG (reversed) Intergenic