ID: 1130276168

View in Genome Browser
Species Human (GRCh38)
Location 15:82477393-82477415
Sequence GGGGGCCATGGAGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130276168_1130276174 -7 Left 1130276168 15:82477393-82477415 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276168_1130276185 28 Left 1130276168 15:82477393-82477415 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130276185 15:82477444-82477466 CAGACTCACCCCCACTCTCTGGG No data
1130276168_1130276173 -8 Left 1130276168 15:82477393-82477415 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130276173 15:82477408-82477430 TGGCCCCCTGCAGGGCCCGGTGG No data
1130276168_1130276184 27 Left 1130276168 15:82477393-82477415 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130276184 15:82477443-82477465 ACAGACTCACCCCCACTCTCTGG No data
1130276168_1130276186 29 Left 1130276168 15:82477393-82477415 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130276186 15:82477445-82477467 AGACTCACCCCCACTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130276168 Original CRISPR GGGGGCCATGGAGAAGCTGC AGG (reversed) Intergenic