ID: 1130276174

View in Genome Browser
Species Human (GRCh38)
Location 15:82477409-82477431
Sequence GGCCCCCTGCAGGGCCCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130276168_1130276174 -7 Left 1130276168 15:82477393-82477415 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276165_1130276174 7 Left 1130276165 15:82477379-82477401 CCAGGACCTACTCACCTGCAGCT No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276162_1130276174 22 Left 1130276162 15:82477364-82477386 CCTTGTTGGCCCATGCCAGGACC No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276155_1130276174 30 Left 1130276155 15:82477356-82477378 CCCGCCCCCCTTGTTGGCCCATG No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276161_1130276174 23 Left 1130276161 15:82477363-82477385 CCCTTGTTGGCCCATGCCAGGAC No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276160_1130276174 24 Left 1130276160 15:82477362-82477384 CCCCTTGTTGGCCCATGCCAGGA No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276157_1130276174 26 Left 1130276157 15:82477360-82477382 CCCCCCTTGTTGGCCCATGCCAG No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276164_1130276174 12 Left 1130276164 15:82477374-82477396 CCATGCCAGGACCTACTCACCTG No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276163_1130276174 13 Left 1130276163 15:82477373-82477395 CCCATGCCAGGACCTACTCACCT No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276166_1130276174 1 Left 1130276166 15:82477385-82477407 CCTACTCACCTGCAGCTTCTCCA No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276156_1130276174 29 Left 1130276156 15:82477357-82477379 CCGCCCCCCTTGTTGGCCCATGC No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data
1130276158_1130276174 25 Left 1130276158 15:82477361-82477383 CCCCCTTGTTGGCCCATGCCAGG No data
Right 1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130276174 Original CRISPR GGCCCCCTGCAGGGCCCGGT GGG Intergenic