ID: 1130279362

View in Genome Browser
Species Human (GRCh38)
Location 15:82508184-82508206
Sequence ATTTATAAAAAGAGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130279360_1130279362 -10 Left 1130279360 15:82508171-82508193 CCAATAAAACTTCATTTATAAAA 0: 9
1: 227
2: 1159
3: 1697
4: 2716
Right 1130279362 15:82508184-82508206 ATTTATAAAAAGAGGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130279362 Original CRISPR ATTTATAAAAAGAGGCAGCA TGG Intergenic
No off target data available for this crispr