ID: 1130280919

View in Genome Browser
Species Human (GRCh38)
Location 15:82519921-82519943
Sequence CTGCCCTTGCCAATCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130280914_1130280919 -1 Left 1130280914 15:82519899-82519921 CCTTCAGCAAGCAGCCCAGTCCC No data
Right 1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG No data
1130280907_1130280919 25 Left 1130280907 15:82519873-82519895 CCAAAGCCTAGTCAGTCAGCCCC No data
Right 1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG No data
1130280909_1130280919 6 Left 1130280909 15:82519892-82519914 CCCCACCCCTTCAGCAAGCAGCC No data
Right 1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG No data
1130280905_1130280919 30 Left 1130280905 15:82519868-82519890 CCCAACCAAAGCCTAGTCAGTCA No data
Right 1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG No data
1130280913_1130280919 0 Left 1130280913 15:82519898-82519920 CCCTTCAGCAAGCAGCCCAGTCC No data
Right 1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG No data
1130280911_1130280919 4 Left 1130280911 15:82519894-82519916 CCACCCCTTCAGCAAGCAGCCCA No data
Right 1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG No data
1130280906_1130280919 29 Left 1130280906 15:82519869-82519891 CCAACCAAAGCCTAGTCAGTCAG No data
Right 1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG No data
1130280912_1130280919 1 Left 1130280912 15:82519897-82519919 CCCCTTCAGCAAGCAGCCCAGTC No data
Right 1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG No data
1130280910_1130280919 5 Left 1130280910 15:82519893-82519915 CCCACCCCTTCAGCAAGCAGCCC No data
Right 1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG No data
1130280908_1130280919 19 Left 1130280908 15:82519879-82519901 CCTAGTCAGTCAGCCCCACCCCT No data
Right 1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130280919 Original CRISPR CTGCCCTTGCCAATCACCCC AGG Intergenic
No off target data available for this crispr