ID: 1130283402

View in Genome Browser
Species Human (GRCh38)
Location 15:82536514-82536536
Sequence GGCTGAAGACCCAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130283393_1130283402 1 Left 1130283393 15:82536490-82536512 CCCAAATTGTATGTACCCAGCAG No data
Right 1130283402 15:82536514-82536536 GGCTGAAGACCCAGGGAAGCAGG No data
1130283391_1130283402 24 Left 1130283391 15:82536467-82536489 CCTTCTGAACATGGGCAAGTTGG No data
Right 1130283402 15:82536514-82536536 GGCTGAAGACCCAGGGAAGCAGG No data
1130283394_1130283402 0 Left 1130283394 15:82536491-82536513 CCAAATTGTATGTACCCAGCAGG No data
Right 1130283402 15:82536514-82536536 GGCTGAAGACCCAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130283402 Original CRISPR GGCTGAAGACCCAGGGAAGC AGG Intergenic
No off target data available for this crispr