ID: 1130283871

View in Genome Browser
Species Human (GRCh38)
Location 15:82540062-82540084
Sequence GAAAAGTACTACACGCGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 2, 1: 4, 2: 4, 3: 2, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130283871_1130283875 6 Left 1130283871 15:82540062-82540084 CCCAGGCGCGTGTAGTACTTTTC 0: 2
1: 4
2: 4
3: 2
4: 29
Right 1130283875 15:82540091-82540113 GACCCGGGCCGCCTTCTTCACGG 0: 2
1: 2
2: 3
3: 11
4: 90
1130283871_1130283874 -9 Left 1130283871 15:82540062-82540084 CCCAGGCGCGTGTAGTACTTTTC 0: 2
1: 4
2: 4
3: 2
4: 29
Right 1130283874 15:82540076-82540098 GTACTTTTCTATGATGACCCGGG 0: 4
1: 5
2: 3
3: 7
4: 72
1130283871_1130283878 12 Left 1130283871 15:82540062-82540084 CCCAGGCGCGTGTAGTACTTTTC 0: 2
1: 4
2: 4
3: 2
4: 29
Right 1130283878 15:82540097-82540119 GGCCGCCTTCTTCACGGTTTTGG 0: 4
1: 0
2: 1
3: 5
4: 69
1130283871_1130283873 -10 Left 1130283871 15:82540062-82540084 CCCAGGCGCGTGTAGTACTTTTC 0: 2
1: 4
2: 4
3: 2
4: 29
Right 1130283873 15:82540075-82540097 AGTACTTTTCTATGATGACCCGG 0: 4
1: 0
2: 1
3: 8
4: 138
1130283871_1130283881 23 Left 1130283871 15:82540062-82540084 CCCAGGCGCGTGTAGTACTTTTC 0: 2
1: 4
2: 4
3: 2
4: 29
Right 1130283881 15:82540108-82540130 TCACGGTTTTGGTGCGAACGCGG 0: 1
1: 2
2: 3
3: 2
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130283871 Original CRISPR GAAAAGTACTACACGCGCCT GGG (reversed) Exonic
906201927 1:43966050-43966072 GAAAAGTACAGCAGGAGCCTTGG - Intronic
913430568 1:118786839-118786861 GTAAAGTACTACTCGAGACTGGG + Intergenic
916687779 1:167162764-167162786 GAAAAGTACTACACGCGCCTGGG - Intergenic
1077845234 11:6015726-6015748 GAAAAGTGCTACAGGCCCCATGG - Intergenic
1081511222 11:43775338-43775360 GAAAAGTAATACATACTCCTAGG + Intronic
1088560083 11:111105822-111105844 GAAAAGTATTACATGCACCCCGG - Intergenic
1104080482 12:125426032-125426054 GAAAAATGCTACACCCGCTTTGG - Intronic
1106993883 13:35457900-35457922 AAAAAGGACTACATGCGGCTGGG - Intronic
1111746201 13:92272627-92272649 GAAAAGTTCAACCCGGGCCTGGG + Intronic
1126115832 15:45206819-45206841 GAAAAGTACTATGCATGCCTTGG - Intergenic
1130283871 15:82540062-82540084 GAAAAGTACTACACGCGCCTGGG - Exonic
1146198178 17:30830957-30830979 GAAAAGTACTACATGCGCCTGGG + Intergenic
1150159649 17:62885081-62885103 TAAAAGTACTACCCGAGACTGGG - Intergenic
1154021100 18:10664768-10664790 GAAAAGTAATACCCGCCCCCTGG + Intergenic
1161247771 19:3263607-3263629 TAAAAGTACTACACACGGCCGGG + Intronic
931516527 2:63053388-63053410 GAAAAATACTAGCCGCCCCTGGG - Intronic
932562867 2:72887960-72887982 GGAAAGTTCTACAGGCGCTTTGG - Intronic
937372503 2:121310047-121310069 GAAAAGCACTACATGAGCCTGGG + Intergenic
942071792 2:172322916-172322938 CAAAGGTACTACACGTGGCTGGG - Intergenic
1168877414 20:1181110-1181132 GAGATGTACTACGCCCGCCTAGG - Exonic
1175439463 20:58980883-58980905 AAAAAGTACTAAACGCGACCGGG - Intergenic
1182675888 22:32039540-32039562 GAAAAGTACTACACACGCCTGGG + Intergenic
959351411 3:105269225-105269247 TAAAAGAACTACCCGAGCCTGGG - Intergenic
963174973 3:142288795-142288817 GAAAAATACTACATGGGACTAGG + Intergenic
963325319 3:143856070-143856092 GAAAAGTACTGCACGCGCCTAGG - Intergenic
977303477 4:95295322-95295344 GAAAACTACCAGACCCGCCTAGG + Intronic
995868267 5:116716294-116716316 GAAAAGTACTACATGTGCCTGGG + Intergenic
997013609 5:129905427-129905449 GAAAAGAACTCCACGCGGCCCGG - Exonic
998973288 5:147615906-147615928 GAAAGGTCCTGCACGTGCCTGGG + Intronic
1005807641 6:29489603-29489625 GAAAAGTACTACATGTGCCTGGG - Intergenic
1008383255 6:50857589-50857611 GAAAAGTACTACATGCACCTGGG - Intergenic
1011852059 6:91641204-91641226 GAAAACTACTGCACATGCCTGGG + Intergenic
1017092542 6:150773236-150773258 GAAAAGTACTTCTCTCGGCTGGG + Intronic
1023142559 7:37116829-37116851 GAAAAGTACTACATGTGCCTCGG + Intronic
1024242644 7:47447494-47447516 GAAAGGTCCTCCACTCGCCTAGG + Intronic
1034195766 7:149245870-149245892 GAAAAATACTACACACTCTTAGG - Intronic
1041120185 8:54578646-54578668 GAAAGGTACTACATGATCCTGGG - Intergenic
1045983560 8:108220859-108220881 TAAAAGTACTACACATGCCTGGG + Intronic
1045997421 8:108379472-108379494 GAAAAGTACTACACGTGCCTGGG - Intronic
1046669580 8:117042969-117042991 GAATAGTACTACATTAGCCTGGG - Intronic
1187874536 X:23793275-23793297 GAAATGTACTAGATGAGCCTGGG - Intergenic