ID: 1130283883

View in Genome Browser
Species Human (GRCh38)
Location 15:82540117-82540139
Sequence TGGTGCGAACGCGGCCCTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130283880_1130283883 -8 Left 1130283880 15:82540102-82540124 CCTTCTTCACGGTTTTGGTGCGA 0: 2
1: 1
2: 3
3: 4
4: 56
Right 1130283883 15:82540117-82540139 TGGTGCGAACGCGGCCCTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 68
1130283876_1130283883 1 Left 1130283876 15:82540093-82540115 CCCGGGCCGCCTTCTTCACGGTT 0: 3
1: 2
2: 0
3: 5
4: 94
Right 1130283883 15:82540117-82540139 TGGTGCGAACGCGGCCCTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 68
1130283877_1130283883 0 Left 1130283877 15:82540094-82540116 CCGGGCCGCCTTCTTCACGGTTT 0: 3
1: 1
2: 1
3: 8
4: 106
Right 1130283883 15:82540117-82540139 TGGTGCGAACGCGGCCCTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 68
1130283879_1130283883 -5 Left 1130283879 15:82540099-82540121 CCGCCTTCTTCACGGTTTTGGTG 0: 3
1: 1
2: 1
3: 13
4: 165
Right 1130283883 15:82540117-82540139 TGGTGCGAACGCGGCCCTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130283883 Original CRISPR TGGTGCGAACGCGGCCCTGC GGG Exonic
901261335 1:7874195-7874217 TGGTGGGAATGCAGCCTTGCGGG - Intergenic
920331448 1:205211300-205211322 GGGGCCGAGCGCGGCCCTGCAGG - Exonic
1070846972 10:79531087-79531109 AGGTGAGAACACAGCCCTGCTGG - Intergenic
1070926824 10:80229190-80229212 AGGTGAGAACACAGCCCTGCTGG + Intergenic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1077159802 11:1107533-1107555 GGGTGCGCACGCGGCCGTGAGGG - Intergenic
1084591263 11:70092033-70092055 TAGAGGGAGCGCGGCCCTGCTGG - Intronic
1086950138 11:92883137-92883159 TGGGGCGCACGGGGACCTGCGGG - Exonic
1088085891 11:105979784-105979806 TGGTGGAAACGCAGCCCTGAGGG + Exonic
1088481023 11:110296550-110296572 TGGTGCGAGCGCTGGCCCGCGGG + Exonic
1090094452 11:123729647-123729669 TGGTGTGGACGCTGCTCTGCCGG + Exonic
1092260735 12:6952106-6952128 TGGTGCCGTCGCGGTCCTGCAGG - Exonic
1101603121 12:106227496-106227518 TGGTCCGAATGCTGGCCTGCCGG - Intergenic
1122375077 14:101251985-101252007 TGGTGTGAGCGGAGCCCTGCGGG - Intergenic
1123172382 14:106386251-106386273 TGGTACGAAAGCAGACCTGCAGG - Intergenic
1127260267 15:57322346-57322368 AGGTGCGAACAAGGCCCTGGCGG - Intergenic
1129874965 15:78968747-78968769 TGGTTTGAAAGTGGCCCTGCTGG + Intronic
1130283883 15:82540117-82540139 TGGTGCGAACGCGGCCCTGCGGG + Exonic
1132572927 16:651828-651850 GGGTGCCAAGGCGGCCCGGCCGG - Exonic
1132893200 16:2214615-2214637 TGGCGCGCCCGAGGCCCTGCGGG - Exonic
1133634664 16:7653870-7653892 CGGTGCGACCGCGGCCTCGCAGG - Exonic
1139591440 16:67935452-67935474 TGGTCAGGACGCGGCCCTGGCGG - Exonic
1139947086 16:70648834-70648856 TAGAGGGAACGCAGCCCTGCAGG - Intronic
1142499485 17:324245-324267 GGGTGCGGAGGCGGCCCTGGGGG - Intronic
1148839348 17:50484662-50484684 TGCTGGGAGCTCGGCCCTGCTGG + Intronic
1152750612 17:82060828-82060850 TGGTGGGAGCCCGGCCTTGCAGG - Intronic
1161216928 19:3099272-3099294 TGGGGAGAACACAGCCCTGCTGG - Intronic
1161401594 19:4067968-4067990 TGGTGCGACCGCGCGCCTGGGGG + Intergenic
948756453 2:240162274-240162296 TGCGGCGAGCGTGGCCCTGCAGG + Intergenic
949000503 2:241610340-241610362 GGGGGCGAGCGCGGCCCTCCCGG - Intronic
1172482138 20:35277526-35277548 GACTGCGAAGGCGGCCCTGCCGG + Intergenic
1172702758 20:36863141-36863163 TGAGGAGAACGCGGCGCTGCAGG + Exonic
1174130372 20:48340108-48340130 TGGTGTGACCGCAGCCCTGTGGG + Intergenic
1174554341 20:51383054-51383076 TGGTGCTAACGCGCTCCGGCTGG - Intergenic
1175213008 20:57373206-57373228 TGGCGTGAACGCGGCCTTGCAGG + Intronic
1179880106 21:44290011-44290033 GGGCGGGAACGCTGCCCTGCTGG - Exonic
1179975825 21:44865508-44865530 TGGTGCCCACCCTGCCCTGCTGG - Intronic
1181473779 22:23156458-23156480 TGGTGAGCATCCGGCCCTGCTGG - Intronic
1184544086 22:45153982-45154004 TGGAGGGAGCGTGGCCCTGCTGG - Intergenic
1185297859 22:50063011-50063033 TGGTGGGGACGCGGTTCTGCAGG - Intronic
953444115 3:42947972-42947994 TGGTGGGAACTCGGAACTGCTGG - Intronic
961674184 3:128555085-128555107 TGGTGTGAACGATACCCTGCCGG + Intergenic
963268885 3:143266363-143266385 TGCTGCGAATGCGGCTCTCCAGG - Exonic
968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG + Intergenic
968848111 4:3058608-3058630 TCCTGGGAACGCGGCCCAGCAGG + Intergenic
969747989 4:9088989-9089011 AGGAGGGAACGTGGCCCTGCTGG - Intergenic
975562891 4:75724417-75724439 TGGTGGAAGCCCGGCCCTGCAGG - Intronic
985820471 5:2156616-2156638 TCCTGGGAATGCGGCCCTGCAGG - Intergenic
985957635 5:3276775-3276797 CGGTTCTTACGCGGCCCTGCAGG + Intergenic
992080914 5:73233792-73233814 TGCTGGGAACGCGGCCGAGCAGG - Intergenic
1001704779 5:173733966-173733988 TGGTGCCAAGGCGGCACTGCTGG + Intergenic
1005363831 6:25057457-25057479 TGGTGCTTCCGGGGCCCTGCTGG + Intergenic
1005396465 6:25387052-25387074 TGGTGCGATCTCGGCCTCGCAGG - Intronic
1007413297 6:41677697-41677719 TGGTGCAAACGCGGAGCTGACGG - Intergenic
1013368865 6:109453947-109453969 TGGTGCAGGCCCGGCCCTGCTGG + Exonic
1016790988 6:148066654-148066676 TGGTGCCTACGCAGCCCTGTGGG - Intergenic
1019018831 6:168900723-168900745 TGGGGGGAGTGCGGCCCTGCTGG + Intergenic
1019199954 6:170306351-170306373 TTGTGCGAGCGCGGCCCAGGCGG - Intronic
1019565225 7:1675680-1675702 CGGTGCGCAGGAGGCCCTGCAGG + Intergenic
1020325014 7:6967644-6967666 AGGAGGGAACGTGGCCCTGCTGG + Intergenic
1027420227 7:78011542-78011564 TGGAGCCAACCCAGCCCTGCAGG + Intergenic
1033283811 7:140023984-140024006 TGGTGCCATCGAGTCCCTGCTGG - Exonic
1034275443 7:149821928-149821950 AGGTCCGAACCCGGGCCTGCAGG + Intergenic
1034335236 7:150318684-150318706 TGGTGCGATCTCGGCTCTTCGGG - Intronic
1049644851 8:143731651-143731673 TGGTGCCCACAGGGCCCTGCAGG + Intronic
1049681434 8:143920299-143920321 TGGTGCCGACAGGGCCCTGCTGG + Exonic
1061879717 9:133562618-133562640 CGGTGCGAACCGGGCCCAGCCGG - Intronic
1062064174 9:134517503-134517525 TGGTGCCAACCCTGCCCTGAGGG + Intergenic
1187391252 X:18887835-18887857 TGGAGCGAAAGTGGCCCAGCAGG - Intergenic
1195067207 X:101248407-101248429 TGGTTGGAACAGGGCCCTGCTGG + Intronic
1197617246 X:128707775-128707797 TGGTGCTAAGGTAGCCCTGCAGG + Intergenic