ID: 1130284127

View in Genome Browser
Species Human (GRCh38)
Location 15:82541259-82541281
Sequence ACCAGCGCAGGCTGCCCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130284120_1130284127 6 Left 1130284120 15:82541230-82541252 CCATCCTCAAACCAGGGCCTTCC 0: 1
1: 0
2: 2
3: 23
4: 381
Right 1130284127 15:82541259-82541281 ACCAGCGCAGGCTGCCCCGATGG 0: 1
1: 0
2: 0
3: 6
4: 91
1130284115_1130284127 16 Left 1130284115 15:82541220-82541242 CCTGCCGCACCCATCCTCAAACC 0: 1
1: 0
2: 1
3: 6
4: 188
Right 1130284127 15:82541259-82541281 ACCAGCGCAGGCTGCCCCGATGG 0: 1
1: 0
2: 0
3: 6
4: 91
1130284117_1130284127 12 Left 1130284117 15:82541224-82541246 CCGCACCCATCCTCAAACCAGGG 0: 1
1: 0
2: 0
3: 30
4: 297
Right 1130284127 15:82541259-82541281 ACCAGCGCAGGCTGCCCCGATGG 0: 1
1: 0
2: 0
3: 6
4: 91
1130284119_1130284127 7 Left 1130284119 15:82541229-82541251 CCCATCCTCAAACCAGGGCCTTC 0: 1
1: 0
2: 0
3: 15
4: 234
Right 1130284127 15:82541259-82541281 ACCAGCGCAGGCTGCCCCGATGG 0: 1
1: 0
2: 0
3: 6
4: 91
1130284121_1130284127 2 Left 1130284121 15:82541234-82541256 CCTCAAACCAGGGCCTTCCGAAG 0: 1
1: 0
2: 1
3: 12
4: 377
Right 1130284127 15:82541259-82541281 ACCAGCGCAGGCTGCCCCGATGG 0: 1
1: 0
2: 0
3: 6
4: 91
1130284122_1130284127 -5 Left 1130284122 15:82541241-82541263 CCAGGGCCTTCCGAAGCCACCAG 0: 1
1: 0
2: 0
3: 15
4: 193
Right 1130284127 15:82541259-82541281 ACCAGCGCAGGCTGCCCCGATGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130284127 Original CRISPR ACCAGCGCAGGCTGCCCCGA TGG Intronic
901075859 1:6554376-6554398 ACCAGCGCAGGCTCCCGAGCCGG + Exonic
902451845 1:16501209-16501231 GCCAGCGCAGGCTGCCCGCAGGG - Intergenic
902501106 1:16912456-16912478 GCCAGCGCAGGCTGCCTGCAGGG + Intronic
902818167 1:18927788-18927810 ACCAGAGCAGGCTCCCCGGTGGG + Intronic
910138383 1:83999027-83999049 ACCAGTGCAGGCTGCCGAGTCGG - Exonic
912234643 1:107835909-107835931 TTCAGCTCAGGCTGCCCCTAAGG + Intronic
919699850 1:200620716-200620738 TCCAGCGCCGGCTCCCCAGAAGG + Exonic
1064106067 10:12502045-12502067 ACCAGGGCAGGCAGCCACCAGGG + Intronic
1069862508 10:71480455-71480477 CCCAGCACAGGCTGCTCTGAAGG + Intronic
1075408002 10:122207380-122207402 ACCAGAGCAGGCTGCTCCACGGG - Intronic
1081625875 11:44654793-44654815 GCCAGCGCAGGGAGCCCCGCAGG + Intergenic
1090950686 11:131470609-131470631 ACCAGCACAAGTTGCCCCAAAGG + Intronic
1096774389 12:53955314-53955336 CCGAGCGCAGGCGGCCCCGACGG - Exonic
1105280917 13:18962170-18962192 ACCAGCTCAGGCTTCCCCTCTGG + Intergenic
1105290107 13:19048182-19048204 ACCAGCTCAGGCTTCCCCACTGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1113667870 13:112153530-112153552 CCCAGAGCAGGCTGCTCCAAGGG + Intergenic
1113916173 13:113875304-113875326 AACAGAGCCGCCTGCCCCGAGGG + Intergenic
1114591624 14:23870062-23870084 ACCAGAACAGGCTGCCATGATGG - Intergenic
1117176624 14:53152722-53152744 ACCAGCGGAGGCTGCTGCGGCGG + Exonic
1118686957 14:68300824-68300846 GCTAGCGCAGGCTGTCCCCATGG + Intronic
1121561999 14:94882791-94882813 AACAGTGCAGGCTGCACAGACGG - Intergenic
1121675069 14:95745876-95745898 AGCAGCTCAGGCTGCCTCAAAGG + Intergenic
1126422525 15:48489963-48489985 AGTACCCCAGGCTGCCCCGACGG + Exonic
1128002624 15:64207520-64207542 GCCAGGGGAGGCTGCCTCGAAGG + Exonic
1130284127 15:82541259-82541281 ACCAGCGCAGGCTGCCCCGATGG + Intronic
1132744911 16:1432546-1432568 GCCAGCGCCTGCTGCCCCGGAGG + Intergenic
1133198920 16:4190437-4190459 CCCAGCCCGGGCTGCCTCGAGGG - Exonic
1134254913 16:12602903-12602925 AGCAACGCAAGCAGCCCCGACGG + Intergenic
1136774639 16:32865262-32865284 ACCCGAGAAGGCTGCCCCAAAGG - Intergenic
1136895973 16:33996252-33996274 ACCCGAGAAGGCTGCCCCAAAGG + Intergenic
1137469311 16:48740422-48740444 ACCAGGGCAGGCTGACCCCAGGG - Intergenic
1138598242 16:58040868-58040890 CCCAGGGCAGGCTGCCTCCAGGG + Intronic
1141312741 16:82930959-82930981 ACCAGCGGAAGCTGCCCCTGTGG - Intronic
1203077066 16_KI270728v1_random:1127398-1127420 ACCCGAGAAGGCTGCCCCAAAGG - Intergenic
1147998502 17:44374668-44374690 CCCCGCTCAGCCTGCCCCGAGGG - Exonic
1148744418 17:49910436-49910458 ACCAGCGGGCGCTGCCCCGGGGG - Intergenic
1151496905 17:74463347-74463369 AACAGCCCAGGCTGCCCTGGCGG + Intergenic
1151552227 17:74828676-74828698 ACCAGATCAGGCTGCCCTGGGGG + Intronic
1152162362 17:78676793-78676815 AGCAGCGCAGGCCGCGCCGCGGG + Intronic
1152794759 17:82301507-82301529 AGCAGCGCAGGCTGAGCTGAGGG + Intergenic
1155188751 18:23410985-23411007 ACCAGCACAGGAGGCCCAGATGG - Intronic
1157384088 18:47247580-47247602 ACCTGCGGGGGCTGCCCCGGCGG + Intronic
1163589820 19:18186372-18186394 ACCACCGCAGCCAGCCCAGAAGG - Intergenic
926144880 2:10390861-10390883 AACAGCCCAGGCTGCCACCATGG - Intronic
927689086 2:25194806-25194828 AACAGAGCAGACTGCTCCGAGGG + Intergenic
938737725 2:134201628-134201650 ACAAGCACAGGTCGCCCCGAAGG - Intronic
940855224 2:158724094-158724116 GCCAGTGCAGGCTGGCCCCAGGG + Intergenic
949042244 2:241854721-241854743 ACCACCGCAGGCAGCCCCTCGGG + Intronic
1169867537 20:10217796-10217818 ACCCGTGCAGGCTGCCTCGGGGG - Intergenic
1172873504 20:38150188-38150210 ACCAGCCCAGGCTGGCCCACTGG + Intronic
1175930105 20:62489863-62489885 CCCAGCGCAGGCTGCAGAGAAGG - Intergenic
1176040104 20:63060760-63060782 CCCAGGGCAGGGTGCCCGGAAGG + Intergenic
1177677317 21:24317346-24317368 TGCAGAGCAGGCTGCCCCGTAGG + Intergenic
1178810551 21:35877450-35877472 AACAGCCCAGGCTGCCCAGGAGG + Intronic
1179172720 21:38985255-38985277 GCCACCGCAGGCTGCCCCCACGG + Intergenic
1180905882 22:19411165-19411187 ACCAGCGCTGGCTGCAACCAAGG + Intronic
1181104931 22:20568592-20568614 GACAGCTCAGGCTGCCCAGATGG + Exonic
1182016890 22:27047924-27047946 ACAAGCCCAGGCTGGCCTGATGG - Intergenic
1182316777 22:29452962-29452984 AGCAGGGCAGGCTTCCCAGATGG - Intergenic
1182524563 22:30907199-30907221 ACCAGCCCAGGCTGGGCCAAGGG - Exonic
1185372896 22:50469143-50469165 ACCACCGAAGGATGCCCAGATGG + Intronic
950550631 3:13663963-13663985 TCGGCCGCAGGCTGCCCCGATGG + Intergenic
952278936 3:31904392-31904414 ACCAGACCAGGCTGCCACAAAGG + Intronic
954882776 3:53846719-53846741 GCCAGTCCAGGCTGCCCCGAAGG + Intronic
961825193 3:129595624-129595646 ACCAAGGCAGGCCTCCCCGAAGG - Intronic
966874938 3:184316141-184316163 ACCGGCGCTGTCTGCCCCGGGGG - Exonic
968515346 4:1013309-1013331 CACAGCGCTGGCTGCCCCCATGG + Intronic
969316278 4:6383176-6383198 ACCTGCGCAGGCTGGCCCACTGG + Intronic
969446998 4:7250902-7250924 ACCAGGGCAGGCTGGCCAGTGGG + Intronic
969605272 4:8199308-8199330 CCCAGCGCTGGCTGGCCCCACGG - Intronic
983939483 4:173525213-173525235 CCCAGCGCCGGCTGACCCAAGGG + Intronic
985381440 4:189399080-189399102 AGCAGAGCAGGCTGCCCCCAGGG - Intergenic
991955709 5:71994426-71994448 ACCATCACAGGTTCCCCCGATGG + Intergenic
998374484 5:141681977-141681999 GGCAGCGCAGGCTGCGACGAGGG + Intronic
1001118908 5:168962650-168962672 GCCAGCTCAGGCTGCCCTGGGGG - Intronic
1003121489 6:3322318-3322340 CCCAGCGAAGGCTGCCACAAGGG + Intronic
1007434284 6:41797448-41797470 ACAAGCTCTGGCTGCCCCAAGGG + Intronic
1013920390 6:115396260-115396282 ACCAGTGGAGGCTGCAGCGATGG + Intergenic
1019540898 7:1550541-1550563 ACCCTCTCAGGCTGCCCCGCTGG - Intronic
1019791549 7:3017245-3017267 CCCAGCTCAGGCTGCCCAGGAGG + Intronic
1026858226 7:73768924-73768946 TCCAGCCAAGGCCGCCCCGAGGG + Intergenic
1031917558 7:127577488-127577510 ACCAGGGCAGAATGCCCCCAAGG + Intergenic
1032119273 7:129144848-129144870 CGCAGCGCAGGCTCCCCCGCCGG + Intergenic
1035261051 7:157661839-157661861 ACCAGCGCAGGCTTTTCTGAAGG + Intronic
1037881056 8:22573684-22573706 ACGAGCACGGGCTGCCCCCAAGG + Intronic
1037893413 8:22636199-22636221 ACCGGCTCAGGCTGTCCAGAGGG - Intronic
1039395156 8:37219559-37219581 ACCTGCAAAGGCTGCCACGATGG + Intergenic
1045392800 8:101732050-101732072 ACCAGAGCAGGCTGCATCCAGGG + Intronic
1048201967 8:132382067-132382089 CCCAGGGCAGGCTGGCCAGAAGG + Intronic
1061978869 9:134088306-134088328 GCCAGGGCAGGCTTCCCTGAAGG - Intergenic
1062009841 9:134261065-134261087 TCCTGCTCAGGGTGCCCCGAAGG + Intergenic
1203772033 EBV:54343-54365 AGCAGCCGAGGCTGCCCTGACGG - Intergenic
1190260757 X:48795409-48795431 ACCAGGCCAGACTGCCCCGCTGG - Intergenic
1198448762 X:136745062-136745084 ACCAATTCAGGCTGGCCCGAAGG - Intronic
1200105303 X:153708793-153708815 ACCCGAGAAGGCTGCCCCAAAGG + Intronic
1200210687 X:154345493-154345515 ACCAGGGCCCGCTCCCCCGAAGG - Intergenic
1200220165 X:154386599-154386621 ACCAGGGCCCGCTCCCCCGAAGG + Intergenic