ID: 1130290444

View in Genome Browser
Species Human (GRCh38)
Location 15:82594942-82594964
Sequence TCTTACATGGGAATGGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 2, 2: 61, 3: 162, 4: 459}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130290439_1130290444 30 Left 1130290439 15:82594889-82594911 CCGACTGGTGGAGCAGTCACAGC 0: 1
1: 0
2: 1
3: 37
4: 252
Right 1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG 0: 1
1: 2
2: 61
3: 162
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130290444 Original CRISPR TCTTACATGGGAATGGTTTG TGG Intronic
900609464 1:3538371-3538393 GCTGACATTGGAATGGTTCGGGG - Intronic
901261117 1:7871783-7871805 TCTTATATGGGCACTGTTTGTGG - Intergenic
901949454 1:12730492-12730514 TCTTATATGGGTGTGGTTCGTGG + Intergenic
903184400 1:21621185-21621207 TCTCACACGAGAGTGGTTTGTGG - Intronic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
903881121 1:26510190-26510212 TCTTATATGGGCACAGTTTGTGG - Intergenic
904202495 1:28830177-28830199 TCTTACAGGCGTGTGGTTTGTGG + Intronic
904680947 1:32228800-32228822 TCTTACATGGTCATAGTTGGGGG - Exonic
905086213 1:35379884-35379906 TCTTACATTGACGTGGTTTGTGG + Intronic
906208628 1:44000151-44000173 GGTTACATGGGAATGGTGTGTGG + Intronic
907077112 1:51588998-51589020 GCTTACATGGGAACTTTTTGGGG + Intronic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
907685065 1:56602598-56602620 TTTTATACGGGAATGGTTTGTGG - Intronic
908849652 1:68362960-68362982 TCTTAAATGGGTGTGATTTGTGG + Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
910824049 1:91386947-91386969 TCTTACATTGAAATGGTTATTGG - Intronic
911173509 1:94795466-94795488 TCTTAAATTGGCATGGTTTTAGG + Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911968538 1:104399291-104399313 TGTTACATGGGCATACTTTGTGG + Intergenic
913075077 1:115335344-115335366 TGTCTCATGGGAATGGATTGGGG + Intronic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
913216937 1:116628558-116628580 TCTTGGTGGGGAATGGTTTGGGG - Intronic
914436161 1:147661411-147661433 TCTTATATGGGGGCGGTTTGTGG - Intronic
914977143 1:152377098-152377120 TCTTGTATGGGTGTGGTTTGTGG - Intergenic
915305614 1:154975748-154975770 TCTTCCCTGGGCTTGGTTTGGGG + Intronic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
917353277 1:174100698-174100720 TCTTACATAGTCATGGTTTGTGG + Intergenic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919123419 1:193368827-193368849 TCTTATACTGGCATGGTTTGTGG + Intergenic
919548905 1:198959941-198959963 TCTTATATGGGTGTGGTTTATGG + Intergenic
921276209 1:213523240-213523262 TCTTACATGGGCACAGTTTGTGG + Intergenic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
921807842 1:219476405-219476427 TCTCACTTGGGAATGTGTTGGGG - Intergenic
922090992 1:222394896-222394918 TATTAAATGGGAATTGTGTGTGG - Intergenic
922279650 1:224111602-224111624 TCTTATATGGGTATGATTGGTGG + Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922646053 1:227288120-227288142 CCTAACATGGGGATGGTCTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
923131439 1:231078238-231078260 TTTTAGATGGGAAAAGTTTGAGG - Intergenic
923481317 1:234386970-234386992 TCTTACATGGGTACAGTTTGTGG + Intergenic
924006810 1:239621175-239621197 TTTTATATGGGAGTGGTTTATGG - Intronic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1062777233 10:162235-162257 TCTTACATAGGTGTGGTTTGTGG + Intronic
1063169323 10:3492916-3492938 TCTAACCTGGAAATGGGTTGTGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1063984937 10:11492208-11492230 TCTTACTTGGAAATTGTTTAAGG + Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065129788 10:22608898-22608920 CCTCACATGGGAGTGATTTGAGG + Intronic
1065641551 10:27787447-27787469 TCTTTTATGGGAATGGAGTGGGG + Intergenic
1066237935 10:33505133-33505155 TCTTAGATGGGCACAGTTTGTGG + Intergenic
1068243940 10:54340726-54340748 TTCTACATTGGCATGGTTTGGGG + Intronic
1068248275 10:54402717-54402739 TGTAATGTGGGAATGGTTTGCGG - Intronic
1068748701 10:60566150-60566172 TCTTATATGGATGTGGTTTGTGG - Intronic
1068928083 10:62560450-62560472 TCCTAGCTGGGAATGGTTTCAGG - Intronic
1068952979 10:62795921-62795943 TCATACATTGGCATGGTTCGGGG + Intergenic
1069427012 10:68297410-68297432 TCTTTCATGGGAAGGGCTTCAGG + Intronic
1069947207 10:71995751-71995773 TCTTCTATGGGTGTGGTTTGTGG + Intronic
1070218548 10:74414014-74414036 TCTTCTATGGGTGTGGTTTGTGG + Intronic
1070955273 10:80459575-80459597 TCCTGCATGGGTAAGGTTTGGGG + Intronic
1071368997 10:84931879-84931901 TCTTATATGGGTGTGTTTTGTGG + Intergenic
1071400847 10:85269056-85269078 TCTTACATGGGTACAGTTTGTGG + Intergenic
1072059593 10:91797197-91797219 TCTTCTATGGGTGTGGTTTGTGG + Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073155326 10:101341888-101341910 TTTAGCATGGGACTGGTTTGGGG - Intergenic
1073681493 10:105708999-105709021 TCTTACATGTGTGAGGTTTGTGG - Intergenic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074548891 10:114425051-114425073 TGTTACATGGGAATATTGTGTGG + Intergenic
1075322591 10:121504029-121504051 TCTTAGAAAGGAATGGGTTGGGG + Intronic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1078193672 11:9115968-9115990 GCTTACATAGGCATGGTTTGTGG + Intronic
1078243260 11:9549978-9550000 TCTTGTATGGGCACGGTTTGTGG - Intergenic
1078713081 11:13813922-13813944 TCTTACATGGCAATGGCAAGAGG + Intergenic
1078784359 11:14473615-14473637 TTTTATATGGGAATGGTTCCTGG + Intronic
1079272452 11:19001004-19001026 TCTTTTATGGGCATAGTTTGTGG - Intergenic
1079343387 11:19631450-19631472 TCTTACATGGGCATTTTATGAGG - Intronic
1080100448 11:28453708-28453730 TTATTCATGGGAATGGTTTTTGG + Intergenic
1080171060 11:29303499-29303521 TCTCATATGGAAATAGTTTGTGG - Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080376264 11:31716243-31716265 TGAGACAGGGGAATGGTTTGAGG - Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081062308 11:38494685-38494707 CCTTATATAGGTATGGTTTGAGG + Intergenic
1081261551 11:40967660-40967682 TCTTATATGGGCATGATTTGTGG - Intronic
1081266171 11:41024998-41025020 TCTTATAAGGGCTTGGTTTGTGG - Intronic
1082205354 11:49427097-49427119 TCTTATATGGATGTGGTTTGTGG - Intergenic
1082900540 11:58245553-58245575 TCTTTCATGAGACTGGTTTCTGG + Intergenic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1085436516 11:76509019-76509041 TCTTACACGAGCATGGTTTGTGG + Intronic
1085500508 11:77018286-77018308 TCTTCTATGTGCATGGTTTGTGG - Intronic
1085858128 11:80198903-80198925 TCTTATATTGGTGTGGTTTGTGG - Intergenic
1086318601 11:85620216-85620238 TCTTATGTGGGTATGATTTGTGG - Intronic
1086649751 11:89273439-89273461 TCTTATATGGATGTGGTTTGTGG + Intronic
1086896977 11:92324532-92324554 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1087339858 11:96890244-96890266 TCTTACGTGGGAACAGTTTGTGG + Intergenic
1087421933 11:97940046-97940068 TCTTTTATGGGCATGATTTGTGG - Intergenic
1087540564 11:99512729-99512751 TCTTATATGGGATCTGTTTGTGG - Intronic
1087609444 11:100416119-100416141 TCTTACACGGGCTTTGTTTGTGG + Intergenic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088156985 11:106818395-106818417 TCTTATACGGGTGTGGTTTGTGG - Intronic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088548920 11:110990827-110990849 TCTTGCATGGGAAGGCTTTCTGG + Intergenic
1088560984 11:111116129-111116151 TCTGTCATGAGAATGTTTTGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1090523117 11:127500077-127500099 TCTAATATGGGACTGGTTTGTGG - Intergenic
1090818655 11:130320523-130320545 TCTTACATGGGTGCAGTTTGTGG + Intergenic
1091155334 11:133366763-133366785 TCTTACATGTGAATGCTCTGAGG - Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091597358 12:1886980-1887002 GCTCACAGGGGAAAGGTTTGCGG - Intronic
1091865186 12:3828019-3828041 TGTTATATGGGCATGTTTTGGGG - Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093261138 12:16939791-16939813 TCTTAAATGTTAATTGTTTGTGG + Intergenic
1094250416 12:28353683-28353705 TCTGATATGGGCATGGTTTGTGG + Intronic
1095523075 12:43091578-43091600 TCTTATATGAGCATAGTTTGTGG - Intergenic
1095605995 12:44068618-44068640 TCTTAAATAGGTGTGGTTTGTGG + Intronic
1096321064 12:50613254-50613276 TCTTCCATGGAATTGTTTTGAGG + Intronic
1096652057 12:53066658-53066680 TCTTCCATGGCAGTGGTGTGGGG - Exonic
1097087112 12:56476918-56476940 ACTTAGATGGGAATGGGATGAGG + Exonic
1098427399 12:70380289-70380311 CCTCATATGGGCATGGTTTGTGG + Intronic
1098752084 12:74306434-74306456 TCTTATATGGGTTTGGTTTATGG + Intergenic
1098785665 12:74751091-74751113 TCTTATGTGGGTATAGTTTGTGG - Intergenic
1098800728 12:74953985-74954007 TCTTATATGGGCATGTTTTCTGG + Intergenic
1099120030 12:78677705-78677727 TGTTACATTGGAATTGTTTTGGG - Intergenic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1099726585 12:86437816-86437838 TCTTACATGGTTGTGGTGTGTGG - Intronic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100516446 12:95332860-95332882 TTTTATATGGGCTTGGTTTGTGG + Intergenic
1100994568 12:100289808-100289830 TGTGACATGGGAATGGTATTGGG + Intronic
1101872347 12:108576467-108576489 TCTTACATGGGCACAGTTCGTGG + Intergenic
1102849571 12:116227604-116227626 TTTTATATGGGTGTGGTTTGTGG - Intronic
1104096522 12:125563063-125563085 TCTCACATAGGCATCGTTTGTGG + Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104949932 12:132435144-132435166 TCTTATATGGGGACAGTTTGTGG + Intergenic
1105393001 13:19999452-19999474 TCTCATATGGGTATGGTTTGTGG - Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107233239 13:38136907-38136929 TGTTACATGGGTATGTTGTGTGG + Intergenic
1108095140 13:46893613-46893635 TCTTACATTGGAATTGTCTGGGG - Intronic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109192723 13:59344875-59344897 TCTGAAAGGGGAATAGTTTGAGG + Intergenic
1109254706 13:60065019-60065041 TCTAACATGGGTGTGGTTTGTGG + Intronic
1109527223 13:63592346-63592368 TCTTCCATGTGAAGGGCTTGTGG - Intergenic
1109735411 13:66478185-66478207 TCTAATATGGGCATGGCTTGTGG - Intronic
1109771241 13:66976388-66976410 TTTCATATGGGTATGGTTTGAGG + Intronic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109853886 13:68103396-68103418 TCTTATATGGGTATGGATTGTGG + Intergenic
1109856742 13:68139505-68139527 TCTTCCATTGGAATGGTTTCGGG + Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110022023 13:70486875-70486897 TCTTACATTGCCATGGTTTGTGG + Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110766480 13:79285069-79285091 CCTTACATGGGTGTGGTTTGTGG - Intergenic
1110946739 13:81430744-81430766 CCTGAGATGGGAATGGTGTGGGG + Intergenic
1111065257 13:83082696-83082718 TACTACATGGGTGTGGTTTGTGG + Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111936641 13:94564462-94564484 TCTTACATGGGCATGATATGCGG + Intergenic
1112543864 13:100344963-100344985 CCTTACACGTGCATGGTTTGTGG - Intronic
1112556245 13:100471263-100471285 TCGTACATGGGCACAGTTTGTGG + Intronic
1112728795 13:102335905-102335927 TCTTACATGGGCACAGTTTGGGG - Intronic
1113304448 13:109061609-109061631 TCTTATATCGGTGTGGTTTGTGG + Intronic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113695023 13:112339153-112339175 TCTTATATGGGCACTGTTTGTGG - Intergenic
1115278031 14:31630315-31630337 TAATAAATGGGAATGGTTTTGGG + Intronic
1115293567 14:31800366-31800388 TATTATATGGGTGTGGTTTGTGG + Intronic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1115542073 14:34430321-34430343 TGTTAAATAGGGATGGTTTGTGG - Intronic
1115627986 14:35214583-35214605 TCTTACATGGGTGTGGTTCCTGG + Intronic
1116193761 14:41694818-41694840 TCTTGTATGGGAATGTTTTTTGG - Intronic
1117320859 14:54622095-54622117 TCTTGAATGGGAATATTTTGTGG + Intronic
1117709551 14:58511235-58511257 TCTAACAAGGGAATTTTTTGAGG - Intronic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1118260603 14:64243259-64243281 GCTTATATGGGCATAGTTTGTGG + Intronic
1118553169 14:66980016-66980038 TCTTACATGGGCACCATTTGTGG + Intronic
1118657960 14:67973684-67973706 TCTTACATTGAAAATGTTTGTGG - Intronic
1120264678 14:82233912-82233934 TTTTATATGGGCATGGTTTCTGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1120544120 14:85789266-85789288 TCTTATCTAGGAATAGTTTGTGG - Intergenic
1120592568 14:86392955-86392977 TCTTATATGAATATGGTTTGTGG + Intergenic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1124255228 15:28136046-28136068 TCTTTTATGGGTATGTTTTGTGG - Intronic
1124255390 15:28137590-28137612 TCTTCTATGGGTGTGGTTTGTGG - Intronic
1124461003 15:29891716-29891738 TCTTATATGGGCAGGGTTTGTGG - Intronic
1124568921 15:30842035-30842057 TCTTCTATGGGTGTGGTTTGTGG + Intergenic
1124580381 15:30948724-30948746 TTTTACATTCGAATGGTTTGTGG + Intronic
1125313606 15:38407609-38407631 TTTTACATGCGAATGGTTTGGGG - Intergenic
1125810477 15:42536090-42536112 TCTTATATTGGCATGGTTTGTGG + Intronic
1126828224 15:52572196-52572218 TCTTATGTGGGAGTGGTTTGTGG - Intergenic
1126885920 15:53149944-53149966 TCTTACATGAACATGATTTGTGG - Intergenic
1127190547 15:56525898-56525920 TCTTACCTGGGAAGCCTTTGAGG + Intergenic
1127948574 15:63781500-63781522 TCTTATATGGGTGTGCTTTGTGG - Intronic
1129049166 15:72763926-72763948 TCTTATGTGGGAATGATCTGTGG - Intronic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129289156 15:74550156-74550178 TGTCACTTGGGAAAGGTTTGGGG + Intronic
1129326232 15:74801611-74801633 TCTTGGATGGGTAGGGTTTGAGG + Intronic
1129948813 15:79567318-79567340 TCTTAGATGGGCATGGCTTGTGG - Intergenic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1130408158 15:83621493-83621515 TCTTATATAGGCATTGTTTGTGG + Intergenic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132032414 15:98449623-98449645 ACTTACACGGGCATGGTTTGTGG + Intronic
1134272994 16:12750528-12750550 CCTTAAATGGACATGGTTTGTGG + Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1136501538 16:30672466-30672488 TCTTACATGGGCACTGTTTGTGG + Intergenic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1137843726 16:51666316-51666338 ACTTACAAGGGAATCGTGTGGGG - Intergenic
1138444539 16:57055189-57055211 TGTTCCAGGGGAATGTTTTGTGG - Intronic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1139125900 16:64077031-64077053 TCTTATATGGGCACAGTTTGTGG - Intergenic
1140734104 16:77882898-77882920 TCTTACCTGGCAAGGGTTTGTGG - Intronic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141304465 16:82848598-82848620 TCTTATATGGGCACAGTTTGTGG - Intronic
1142922732 17:3205213-3205235 TCTTATATGGGCATGATTTGTGG - Intergenic
1143014249 17:3883233-3883255 TCTTGCTTGAGACTGGTTTGGGG - Intronic
1143184949 17:5004449-5004471 TCTTACAGGGTCATGGTCTGAGG - Intronic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1145726862 17:27137169-27137191 TGTGATGTGGGAATGGTTTGTGG - Intergenic
1146352469 17:32106326-32106348 TCTTACTTGTGAATTGCTTGTGG + Intergenic
1146412710 17:32601446-32601468 TCCTACATGGGTACAGTTTGTGG + Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1149326054 17:55530829-55530851 TCTTATTTGGGAATTGTCTGCGG + Intergenic
1149972050 17:61228656-61228678 TTTTACATGGGCATAGCTTGAGG - Intronic
1150306209 17:64087502-64087524 ACTTAAAAGGGACTGGTTTGGGG - Intronic
1150306323 17:64088371-64088393 ACTTAGAAGGGACTGGTTTGGGG - Intronic
1150757579 17:67929471-67929493 TCTTACTTGTGAATTGCTTGTGG - Exonic
1151027414 17:70694865-70694887 TCTTACATGGGTAGGGTTTGTGG - Intergenic
1151076762 17:71282296-71282318 TGTTAGGTGGGAATGGTTTTTGG - Intergenic
1152978963 18:254778-254800 TCTTAGATGGGCACAGTTTGTGG - Intronic
1153175426 18:2366907-2366929 TGTCATATGGGTATGGTTTGTGG - Intergenic
1153270650 18:3317957-3317979 TATTATATGGGTGTGGTTTGTGG + Intergenic
1153405051 18:4728577-4728599 TCTAAAATGGGAAAGTTTTGGGG - Intergenic
1153467324 18:5403129-5403151 TCTGTCATGGGAAAGGTCTGTGG + Intronic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1154392490 18:13952026-13952048 TCTTAGATGGGAGTGGGTCGTGG - Intergenic
1155023854 18:21922785-21922807 TCTGACATGGGACAGGCTTGGGG + Intergenic
1155101584 18:22615754-22615776 TCATACATGGGTGCGGTTTGTGG - Intergenic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155741197 18:29290327-29290349 TCTTATATGGGCAAGGTTTCTGG - Intergenic
1155809958 18:30219821-30219843 TCTTATATGGGCACAGTTTGTGG + Intergenic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156131013 18:33974537-33974559 TCTTATATGGGAGAAGTTTGTGG + Intronic
1156875971 18:42011965-42011987 TCCTATATGGGTATGCTTTGTGG + Intronic
1157371853 18:47120895-47120917 CTTAACATGGGCATGGTTTGTGG + Intronic
1158758014 18:60349763-60349785 TCCTACATGGTGATGCTTTGGGG - Intergenic
1159026758 18:63190190-63190212 TCTTACATGGGATTCTTTTTAGG - Intronic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1159700536 18:71621162-71621184 TGTTACATGGGTGTGGTTTGTGG + Intergenic
1159906275 18:74095560-74095582 TCTTACATGGGCACTGTCTGAGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1160402837 18:78623325-78623347 ACAGACATGGGAGTGGTTTGAGG - Intergenic
1163047899 19:14658474-14658496 TGTTACCTGGGAAGGGTCTGGGG + Intronic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1166541103 19:43606537-43606559 GCTTACATGGGAGTGGGTAGAGG - Intronic
1167332210 19:48863112-48863134 GCTTCTATGGGAATGGGTTGAGG - Intronic
1167397590 19:49241389-49241411 TTTTATATGGGCATAGTTTGTGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
926472803 2:13282177-13282199 CATTACATGGGAATGGTTGTTGG + Intergenic
926834842 2:17007067-17007089 TCTTATATAGGCATGGTTTCTGG - Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928264021 2:29794742-29794764 CCTTATAGGGGCATGGTTTGTGG + Intronic
928290771 2:30035556-30035578 TCCTTCATGGCAATGGTTTGGGG - Intergenic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929434981 2:41921891-41921913 TCTCACCTGGAAACGGTTTGAGG - Intergenic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
929643494 2:43604849-43604871 TCTTACGTGGGAAGGAATTGTGG - Intergenic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
932116756 2:69057530-69057552 TCTTACATGTGTGTGGTTTGTGG - Intronic
933160345 2:79016925-79016947 TCTCACATGGGGGAGGTTTGTGG - Intergenic
934560687 2:95311793-95311815 GCTTCCATGGGAAGGGGTTGGGG - Intronic
934664687 2:96161910-96161932 TCTTACATTGTAATGGGGTGGGG + Intergenic
935036664 2:99383287-99383309 TCTTATAGGGGTGTGGTTTGTGG - Intronic
936005298 2:108881800-108881822 TCTTACATGGGTGTGGTTCTTGG + Intronic
936678852 2:114747598-114747620 TCTGACTTAGGAATGGTTTCAGG - Intronic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
937796666 2:126030620-126030642 TCCTATATGGATATGGTTTGTGG + Intergenic
937962525 2:127471540-127471562 TCTTACATAGAACTGGTCTGGGG + Intronic
938174189 2:129109248-129109270 CCTTATATGGGCATGATTTGTGG + Intergenic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938621305 2:133057099-133057121 TCTTATATGGGCACGATTTGTGG - Intronic
938876957 2:135541638-135541660 TCTTATATGGGTGTGATTTGTGG + Intronic
938987237 2:136589290-136589312 TCTCATATAGGCATGGTTTGTGG + Intergenic
939486577 2:142820004-142820026 TTTCATATGGGTATGGTTTGTGG + Intergenic
939569303 2:143821635-143821657 TCTTACATGTGTAGGTTTTGGGG + Intergenic
939722739 2:145675200-145675222 TCTTAAATGGGCACGGTTTGTGG + Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
940891009 2:159035350-159035372 TTTTACATGAGAATATTTTGTGG + Intronic
941016426 2:160362565-160362587 TCCTATATGGGAATGGTTTGTGG + Intronic
941077465 2:161022171-161022193 TCTTTTATGGGCATGGTGTGTGG - Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
942876851 2:180810840-180810862 TCTTATATGGGCAAGGTTTGTGG - Intergenic
943229192 2:185224022-185224044 TTTTACATGTAAATGGTTTTGGG + Intergenic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
943978021 2:194508833-194508855 TCTTATATGAGTGTGGTTTGTGG - Intergenic
944623034 2:201538629-201538651 TCTTAGATGGGTGTGGTTTGTGG - Intronic
945477618 2:210304004-210304026 TTTTGGATGGGACTGGTTTGGGG + Intronic
945830211 2:214775435-214775457 TGTTACATGGCCAGGGTTTGTGG + Intronic
946133109 2:217622842-217622864 TCTGATATGGGAATGGTTTTTGG - Intronic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947037134 2:225872238-225872260 TCTACCATGAGAATGGTATGGGG - Intergenic
947555423 2:231088597-231088619 TTTTACATGGGTGTGGTTCGTGG - Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169157549 20:3345511-3345533 TCTAACTTGGTAATGATTTGAGG + Intronic
1169313922 20:4572177-4572199 TCTTACTTGGGATTGGTTCAAGG - Intergenic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1171313163 20:24162417-24162439 TCTCACATGGGTGTGGTTTGTGG - Intergenic
1172257763 20:33534814-33534836 TCTTATATGGGCACAGTTTGTGG + Intronic
1173259068 20:41417145-41417167 TCAAAGCTGGGAATGGTTTGGGG + Intronic
1173942087 20:46920033-46920055 TCTTATATGGGCACAGTTTGTGG + Intronic
1173997381 20:47348832-47348854 TCATAGATGCAAATGGTTTGAGG + Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1177335717 21:19723465-19723487 GCTTATATGGGCATGGTTTGTGG + Intergenic
1177654639 21:24002184-24002206 TCTTATATGGGCACAGTTTGTGG - Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1180878980 22:19190390-19190412 TCTTATAGGGGCATGGTTTGTGG + Intronic
1181315894 22:21970762-21970784 TGTCACATGGGATGGGTTTGGGG - Intronic
1181640956 22:24198238-24198260 TCTTGCATGGGAATCTCTTGTGG - Intergenic
1183811103 22:40258149-40258171 TCTTCCAGAGGAAAGGTTTGTGG - Intronic
1184083008 22:42238783-42238805 TCTTATATGGGAGTGCTTTGTGG + Intronic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
1185262155 22:49873423-49873445 TCTGACATGGGTGTGGCTTGTGG + Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949812634 3:8022496-8022518 TAATACATGTGAATGGTATGAGG + Intergenic
949813554 3:8034188-8034210 CTTTATATGGGCATGGTTTGTGG + Intergenic
950112654 3:10429508-10429530 TCTGATATGGGCATGGTTTGTGG - Intronic
951313230 3:21156112-21156134 TCCTATATGGAAGTGGTTTGTGG + Intergenic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
952585052 3:34882324-34882346 TGTTCCATGGGAAAGTTTTGGGG + Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
953088306 3:39696392-39696414 TCTTTCTTGGGAAGGATTTGTGG - Intergenic
954772461 3:52984156-52984178 TCTGAAGTAGGAATGGTTTGAGG + Intronic
954850155 3:53593361-53593383 TCTTCCCTGGGAATTGTTTTAGG + Intronic
955211150 3:56942428-56942450 TCTTATATGAGGATGGTTCGTGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955678306 3:61472719-61472741 CCTTATATGGGCATGATTTGTGG + Intergenic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
956409564 3:68965554-68965576 TTTTACTTGGGAAAGGTTTGGGG + Intergenic
956711037 3:72039099-72039121 TCTTACAAGAGGATGATTTGTGG - Intergenic
957499733 3:81038954-81038976 TCTAAGATGGGTGTGGTTTGTGG + Intergenic
957645245 3:82913910-82913932 TCCTATATGGGTTTGGTTTGTGG - Intergenic
957782914 3:84842777-84842799 TCTTACATGGGTGTGGTTTGTGG - Intergenic
957863734 3:85994795-85994817 TCCTATATGAGCATGGTTTGTGG + Intronic
957955752 3:87184988-87185010 TCTTATATGGGTGTAGTTTGTGG + Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959726234 3:109545026-109545048 TATTACATGGGAATGTTGTGTGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
960351196 3:116595197-116595219 ACTTACATGGGAATGGCTGGAGG - Intronic
960476386 3:118134543-118134565 TCTTACATGGGTGAGGTTTGTGG - Intergenic
961092142 3:124122654-124122676 TTTTATATGGGCATGGTTTGTGG - Intronic
961521680 3:127470765-127470787 TCTAACATGGGAAGGCCTTGTGG + Intergenic
962628918 3:137256418-137256440 TCTCACCAGGGAATGGTTGGGGG - Intergenic
963195217 3:142520154-142520176 TCTTATATGGGCACAGTTTGTGG - Intronic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965514040 3:169601472-169601494 TCTTACATGGGAATGTTGGATGG + Intronic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
965932481 3:174062032-174062054 TCATACATGTGAATGCTTGGGGG + Intronic
967429372 3:189363902-189363924 TCTTACTTGGGAGAGGTTGGGGG - Intergenic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
968053479 3:195673025-195673047 TCATACCTGTGAGTGGTTTGCGG + Intergenic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970605391 4:17676327-17676349 TCTTCTACGGGCATGGTTTGTGG + Intronic
970629793 4:17927720-17927742 TCTCATATGGGAGTGGTTCGTGG + Intronic
970877749 4:20892057-20892079 TCTTAAAAGTGAATGATTTGGGG - Intronic
971016746 4:22496871-22496893 TCTGTCATGGGCATGGTATGGGG - Intronic
971073356 4:23120423-23120445 TCTTAGATGAGAATGTTTTAGGG + Intergenic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
971477907 4:27089583-27089605 TCATACATTGGCATGGTTTTGGG + Intergenic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971709065 4:30088079-30088101 TCTCATATGGGCATGGTTTGTGG + Intergenic
971868554 4:32205636-32205658 TATTAATTGGGTATGGTTTGTGG - Intergenic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
972630830 4:40840466-40840488 TCTTACATGTGTGTGTTTTGCGG - Intronic
973850033 4:54952543-54952565 TCTTCCATAGGTGTGGTTTGTGG + Intergenic
974316227 4:60284711-60284733 TCTTATATGGGCACAGTTTGTGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974632506 4:64511609-64511631 TCTTTCAGGGGAATGATTGGTGG + Intergenic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975175430 4:71283289-71283311 TCTTTCATGGCAATGTTTTTAGG + Intronic
975567884 4:75779095-75779117 TCTTATATGGGCACTGTTTGTGG - Intronic
975762056 4:77630302-77630324 TCTTATATGGGTACAGTTTGTGG + Intergenic
976328553 4:83800792-83800814 TGTTACATGGATATAGTTTGTGG + Intergenic
976465460 4:85363207-85363229 TCTTGTATGGGTATGGTTTCTGG + Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977356059 4:95948320-95948342 TCTTATATGGGCACAGTTTGTGG + Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977656580 4:99528768-99528790 ACTTTCATGGGAATGGTATGGGG + Intronic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
979213623 4:118136197-118136219 TGTTACATGGAAATGTTATGTGG - Intronic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979377979 4:119970826-119970848 TATTTCATGTAAATGGTTTGGGG + Intergenic
979626001 4:122846178-122846200 TCTTATATGGGTGTAGTTTGTGG + Intronic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
979911250 4:126368660-126368682 TTTAACATGGCAATGGTTTTTGG - Intergenic
980435962 4:132774240-132774262 CCTTACCTGGTAATGTTTTGGGG - Intergenic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980549720 4:134318853-134318875 TCTTATATGGGCATAGTTTGTGG + Intergenic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981493002 4:145361112-145361134 TCTTACATGGGTGTGGTTTGTGG - Intergenic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
981984784 4:150840575-150840597 TCTTAAATGGGTGTGGTTTGTGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982132282 4:152240654-152240676 GCTAACATGGTAATGATTTGTGG - Intergenic
982149389 4:152435945-152435967 TCTTCCATGGGTGCGGTTTGTGG - Intronic
982344650 4:154344122-154344144 TCTTTCATGGCCATGGTTTGTGG + Intronic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
982876028 4:160651016-160651038 TCTTATATGGGTACAGTTTGTGG - Intergenic
983086710 4:163454016-163454038 TCTTATACGGGCATGGTTTGTGG + Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983631676 4:169855688-169855710 TCATACATGGGGATGGGATGGGG + Intergenic
983808595 4:172027437-172027459 TCTTACAAGGGCACAGTTTGTGG - Intronic
983963235 4:173779316-173779338 TCTACTATGGGTATGGTTTGTGG - Intergenic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987328940 5:16837973-16837995 TCTTGTATGGGTGTGGTTTGTGG - Intronic
987392777 5:17391577-17391599 TCTCCCAAGGAAATGGTTTGCGG - Intergenic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
988160427 5:27513207-27513229 TCTTATATGGGTACAGTTTGTGG - Intergenic
988278702 5:29115497-29115519 TCTTATATGGGGGTGATTTGTGG + Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988669778 5:33368912-33368934 TTTTATAGGGGCATGGTTTGTGG + Intergenic
988704412 5:33710297-33710319 TCTTATATGGCAATGGTTGGAGG - Intronic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
990097450 5:52134907-52134929 TTTATCATGGGAATGGTATGTGG + Intergenic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
991394132 5:66185660-66185682 TCTTATATGGGCACGGTTTGTGG - Intergenic
992362956 5:76061048-76061070 TCTTATATGGGCATAGTTTGTGG + Intergenic
992918353 5:81483099-81483121 TCTTGTATGGGCACGGTTTGTGG + Intronic
993082121 5:83314742-83314764 TATTTTATGGGCATGGTTTGTGG - Intronic
993124338 5:83814090-83814112 TCTTATATGGGCACTGTTTGTGG + Intergenic
993126350 5:83840677-83840699 TCTTATATGGGAGTAGTTAGTGG - Intergenic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994870295 5:105339490-105339512 TCTTATATGGGTACAGTTTGTGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995534661 5:113123028-113123050 TGGTACATGGGTATGTTTTGTGG - Intronic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996650963 5:125875445-125875467 TGTTCCAAGGGAATGGATTGTGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
996841975 5:127856823-127856845 TCTTATATGGGTACAGTTTGTGG + Intergenic
997162904 5:131627933-131627955 TCTTACATGGGCACAGTTTGTGG - Intronic
997274305 5:132571088-132571110 TCTTATATGTGGATGGTTTGTGG + Intronic
997961473 5:138325199-138325221 TCTTTTATGGTAATGATTTGGGG + Intronic
998863646 5:146472493-146472515 TCTTACATGGGTGTGGTTTGTGG - Intronic
999856918 5:155605086-155605108 CCTTACATGGGTACAGTTTGTGG + Intergenic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1000821259 5:165987190-165987212 TCTTATATGGGCATGCTTTGTGG - Intergenic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1001117331 5:168950713-168950735 CCTTACGTGGTAATGTTTTGAGG - Intronic
1002813092 6:653052-653074 TCTCATATGAGCATGGTTTGTGG - Intronic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004152848 6:13136853-13136875 TCTTATATGGGTGTGATTTGTGG + Intronic
1004653815 6:17638686-17638708 TCTTAAATAGGAAATGTTTGGGG - Intronic
1004891454 6:20104916-20104938 TCTCACATGGGAAGGGGTGGAGG - Intronic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1005689879 6:28293716-28293738 TTTTAAACGGGCATGGTTTGTGG - Intronic
1005703317 6:28426485-28426507 TCTTATATGGGTGTGGTTAGCGG + Intergenic
1007565897 6:42850115-42850137 ACTTACATGTGAATGGTTGGTGG + Intronic
1007650898 6:43420939-43420961 TCTTACATAGGTGTGATTTGTGG - Intergenic
1008152267 6:47968288-47968310 TCTTACATGGGTGTGGTTTGTGG + Intronic
1009240521 6:61180608-61180630 TCTTACATAGGTATGGTTTCTGG - Intergenic
1009431209 6:63568435-63568457 TCTTAAATGGGTACAGTTTGTGG + Intronic
1009461061 6:63914040-63914062 TCTTATATAGGAGTGGTTTGTGG - Intronic
1009513207 6:64579449-64579471 TCATACATGAGAATGATCTGGGG - Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010449916 6:75991069-75991091 TCCTTCATGCAAATGGTTTGAGG - Intronic
1010588700 6:77686850-77686872 TCTTGAATAGGAATGGTCTGTGG + Intergenic
1010608478 6:77921837-77921859 TCTGATATGGGCATGGTTTGTGG + Intronic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1010724600 6:79318995-79319017 CGTCACATGGGCATGGTTTGTGG + Intergenic
1011391757 6:86861565-86861587 TCTTATATGGGTGTAGTTTGTGG + Intergenic
1012325635 6:97912871-97912893 TCATACATGGGAATGTATGGCGG - Intergenic
1012651442 6:101758830-101758852 TCTTACATAGGAAAGCTTTTTGG + Intronic
1012983317 6:105852256-105852278 TCTTATATGGGCACAGTTTGTGG + Intergenic
1012995290 6:105966843-105966865 TCTTACATGTGAATGGCTTCAGG - Intergenic
1013088826 6:106880546-106880568 TCTTACATGAGTGTGGTTTGTGG + Intergenic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013729760 6:113151265-113151287 TCTTATATGGGCATGACTTGTGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013943575 6:115695258-115695280 TTTTATATGGGCATGGTTTGTGG - Intergenic
1014076404 6:117240445-117240467 TCTTATATAGGCATGGTTTGTGG - Intergenic
1014521510 6:122449033-122449055 TCTTATATGGGTGTGATTTGTGG - Intronic
1014528296 6:122527619-122527641 TTTTATATGGGAATGGTTTGTGG + Intronic
1015282284 6:131446675-131446697 CTTTACATGGGGCTGGTTTGAGG - Intergenic
1015433407 6:133156432-133156454 TCTTACATGGGCACAGTTTGTGG + Intergenic
1015559677 6:134501318-134501340 TCTTACATGGAAATGGATGAAGG - Intergenic
1015648301 6:135421126-135421148 TCTTATATGGGTACAGTTTGTGG + Intronic
1016081599 6:139863928-139863950 TCTTATATGGGCACAGTTTGTGG - Intergenic
1016220371 6:141661784-141661806 TCTTATATGGGAGTGATTTGTGG + Intergenic
1016260815 6:142167816-142167838 TCTTTCTAGGGAATGGGTTGGGG + Intronic
1016490841 6:144600048-144600070 TCTTATATGGGTGTGGCTTGAGG - Intronic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016720484 6:147290382-147290404 CCTAACTTGGGAATGGTCTGAGG - Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016946161 6:149536140-149536162 TCTTATATGGGCACAGTTTGTGG - Intronic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1019159495 6:170059606-170059628 TCTTACATGGATGTGGTTTGTGG - Intergenic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021132810 7:16931589-16931611 TCTTATATGGGTGTAGTTTGTGG + Intergenic
1021267980 7:18548234-18548256 TCTTATATGGGTGTGGTTCGTGG + Intronic
1021472840 7:21025268-21025290 TTTAACATGGGAATAGTTTGGGG + Intergenic
1022365748 7:29714312-29714334 TCTTACTTGGGAATGGCTCAGGG - Intergenic
1022392218 7:29953082-29953104 TCATATTTGGGAATGCTTTGAGG - Intronic
1022474947 7:30703864-30703886 TCTGATATGAGAATGGTCTGTGG - Intronic
1022613941 7:31909159-31909181 TCTTACGTGGTAAAGGGTTGTGG + Intronic
1022951366 7:35341348-35341370 TCTTATATGGGCACAGTTTGTGG - Intergenic
1023193494 7:37609242-37609264 TTGTACATGAGCATGGTTTGTGG - Intergenic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1026466722 7:70660733-70660755 TTTTACATGGGAAGGCTCTGGGG + Intronic
1026565747 7:71488475-71488497 TCTTAAATGGGAATGGCATCAGG + Intronic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG + Intronic
1028138617 7:87247668-87247690 TCAGACATGGGGATGGTGTGGGG + Intergenic
1028138866 7:87249798-87249820 TCTTATATGTGAAGGATTTGTGG - Intergenic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1029378124 7:100194452-100194474 TCTTATATGGGCACGGTTTGTGG + Intronic
1029805486 7:102991770-102991792 TGTTCCATTGGAATGGTTGGTGG - Intronic
1030479130 7:110080250-110080272 TTTTATATGGGCACGGTTTGTGG + Intergenic
1030567714 7:111180446-111180468 TCTTACATGGGTGAGGTTTGTGG + Intronic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031057316 7:117006895-117006917 TCTTATATGGATGTGGTTTGCGG - Intronic
1031183699 7:118448804-118448826 TCTTATATGGGTGTAGTTTGTGG + Intergenic
1031498729 7:122485031-122485053 TCTTATATGGGTGTAGTTTGTGG - Intronic
1031564555 7:123279141-123279163 TCTTATATGGGTGGGGTTTGTGG + Intergenic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1032927773 7:136628699-136628721 TCTTGCATGGGCACAGTTTGTGG - Intergenic
1033107574 7:138542430-138542452 TCTTACATGGGTGTGGTTTGTGG + Intronic
1033112509 7:138593776-138593798 TCTTACATGAGTGTGGTTAGTGG + Intergenic
1033629873 7:143147246-143147268 TTTTACATTGGAATGGAATGAGG - Intergenic
1035066964 7:156112948-156112970 TCTTCTATGCGTATGGTTTGTGG + Intergenic
1035167124 7:156998165-156998187 TCTTATATGGGCAAGGTTTGTGG + Intronic
1036469106 8:9034565-9034587 TCTTATATGGGTGTGGTCTGTGG - Intronic
1037191741 8:16134446-16134468 TCTTTTACGGGCATGGTTTGTGG - Intronic
1037914367 8:22763732-22763754 TCTTTCATGGTAGTTGTTTGGGG - Intronic
1038184935 8:25264492-25264514 TGCTATATGGGAATGGATTGTGG - Intronic
1038526891 8:28282462-28282484 TCTTCCATGGGCACGGTTTGTGG - Intergenic
1038630538 8:29239140-29239162 TATTACGTGTGTATGGTTTGGGG - Intronic
1038894111 8:31761669-31761691 TCTTGCGTGGGAGTGATTTGTGG + Intronic
1039255477 8:35714153-35714175 TCAAATATGAGAATGGTTTGAGG + Intronic
1039836055 8:41257069-41257091 TTGTACTTGGGAATGGATTGAGG - Intergenic
1039889670 8:41675771-41675793 GGTCACCTGGGAATGGTTTGGGG - Intronic
1039926265 8:41934727-41934749 TCTTCCAGTGGATTGGTTTGCGG + Exonic
1040560008 8:48515241-48515263 TCTTTCATGGGAGTGGTGGGAGG - Intergenic
1040636268 8:49277161-49277183 TCTTACATGGGTGCAGTTTGTGG - Intergenic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1042409843 8:68451653-68451675 TCTTACATGGGTGTGGTTTGTGG + Intronic
1042493993 8:69435611-69435633 TCTTACAGTGAAATTGTTTGAGG - Intergenic
1042547998 8:69967980-69968002 TCTTACACGGGGGTGGTTTATGG - Intergenic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042882423 8:73508438-73508460 TCTTATATGGGCATGATTTGTGG + Intronic
1043098999 8:76016115-76016137 TCTTATATGGGAATAGTTTGTGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043990891 8:86752662-86752684 TCTTATATGGGCATAGTTTGTGG + Intergenic
1044030897 8:87235590-87235612 TCTTATATGTGCATAGTTTGCGG + Intronic
1044114304 8:88315564-88315586 TCTTAAATGGGCAGAGTTTGTGG - Intronic
1044289506 8:90451265-90451287 TCTTACGTGAGCATGGTTTTTGG + Intergenic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044807729 8:96025396-96025418 TCTTATATGGGTAGGGTTTGTGG - Intergenic
1044889521 8:96818299-96818321 TCTTACATGGGTGTAGTTCGTGG + Intronic
1045110039 8:98931679-98931701 TCTTACAAGGCAATGATTTAGGG - Intronic
1045399813 8:101802222-101802244 TATTTTATGGGCATGGTTTGTGG - Intronic
1046677738 8:117130244-117130266 TCTTTCATGGGAAAGCTCTGAGG + Intronic
1046702504 8:117417607-117417629 TTTAGCATGGGAATGGTTTAGGG - Intergenic
1047009906 8:120660974-120660996 ACTTACATGGGTGTAGTTTGTGG + Intronic
1047106512 8:121736791-121736813 TCTTCTATGGGCATAGTTTGTGG + Intergenic
1047147710 8:122223427-122223449 TCTTCTATGGGTGTGGTTTGTGG + Intergenic
1047625767 8:126654548-126654570 TATCACATGGGAATGGTGAGAGG - Intergenic
1047888789 8:129283385-129283407 TCTTATATGGAAGTGATTTGTGG - Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051753568 9:20370318-20370340 TCTTACATGGGTGCGGTTTGTGG - Intronic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052060474 9:23954450-23954472 TACTACATGGGAATGGTTCATGG - Intergenic
1052111336 9:24586809-24586831 TCTTACATGGGCACGGTTACTGG + Intergenic
1053208709 9:36209589-36209611 TCTTATCTGGGAACGGTTTGAGG + Intronic
1053227575 9:36374142-36374164 AATTACATGGGAATGTTTTTAGG - Intronic
1053296470 9:36917950-36917972 TCTTATATGGGCACAGTTTGTGG - Intronic
1053610651 9:39709952-39709974 TCTAATATGGGAATTGATTGAGG - Intergenic
1054242871 9:62632443-62632465 TCTAATATGGGAATTGATTGAGG + Intergenic
1054556996 9:66666961-66666983 TCTAATATGGGAATTGATTGAGG + Intergenic
1054994493 9:71370039-71370061 TGTTATGTGGGTATGGTTTGTGG - Intronic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1055922820 9:81479413-81479435 GCTTACATGGGAATGGGAAGTGG + Intergenic
1056227201 9:84507315-84507337 TCTTATATGTGCATGGCTTGTGG - Intergenic
1056274276 9:84977952-84977974 TCTTACATGGATATAGTTTGTGG - Intronic
1057727166 9:97575836-97575858 TCTGACATGGTAAAGGTGTGAGG + Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059264747 9:113016623-113016645 TCTTATATGTGCATGGTCTGTGG - Intergenic
1060066437 9:120505308-120505330 TCTTATATGGGTGTGATTTGAGG - Intronic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1061593618 9:131614493-131614515 TCATCCTTGGGGATGGTTTGTGG + Intronic
1186539586 X:10386894-10386916 TCTTATCTGGGACTGATTTGAGG - Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188291452 X:28393695-28393717 TCTTGTATGTGCATGGTTTGTGG + Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189930869 X:46008395-46008417 TCTTATATGGGCATTGTTTGTGG + Intergenic
1190024151 X:46907370-46907392 TCAAGCCTGGGAATGGTTTGGGG - Intergenic
1190210316 X:48441708-48441730 TATGAGAAGGGAATGGTTTGGGG - Intergenic
1190460827 X:50672133-50672155 TCTTATATGGGCACAGTTTGTGG + Intronic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1191957784 X:66664951-66664973 TGTCATATGGGCATGGTTTGTGG + Intergenic
1192028745 X:67485981-67486003 TCTTACATTGGCATGAGTTGTGG + Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1192606556 X:72524959-72524981 TTTTCCATGGGCATGGTTGGGGG + Intronic
1193286533 X:79721494-79721516 TTATACATTGGCATGGTTTGGGG - Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1193850018 X:86525782-86525804 TCTCATTTGGGGATGGTTTGAGG - Intronic
1193968563 X:88020901-88020923 TCTCACATGGGAAAGGATTCAGG + Intergenic
1194100510 X:89697422-89697444 TTTTACATGGGTATGGTTTGTGG + Intergenic
1194759800 X:97782448-97782470 TCTTAGATGGGAGGAGTTTGTGG - Intergenic
1194940208 X:100000104-100000126 TCTTAAAAAGGCATGGTTTGTGG - Intergenic
1195231184 X:102849921-102849943 TCTTAGATGGGTGTAGTTTGTGG + Intergenic
1195593332 X:106657761-106657783 TCTCACATGGGTGTGGTTTGTGG + Intronic
1195628394 X:107028474-107028496 TCTTATATGGGCATAGTTTGTGG + Intergenic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196564041 X:117183726-117183748 TCTTACATAGGCATGGTTGGTGG - Intergenic
1197323969 X:125069054-125069076 TGTTACATGGGAATGATGGGGGG + Intergenic
1197444172 X:126528183-126528205 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198999700 X:142620220-142620242 TCTTATATGGGTGTGGTTTATGG + Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199103011 X:143827911-143827933 TTTTATATGGGCATAGTTTGTGG - Intergenic
1199359239 X:146898342-146898364 TCTTACATAGGCGTGGTTTGTGG - Intergenic
1200453462 Y:3358483-3358505 TTTTACATGGGTATGGTTTGTGG + Intergenic
1200635054 Y:5641589-5641611 TCTTATCTGGGCCTGGTTTGTGG + Intronic