ID: 1130298076

View in Genome Browser
Species Human (GRCh38)
Location 15:82661135-82661157
Sequence GGCCAAGGACAGAACCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 7, 3: 32, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130298076 Original CRISPR GGCCAAGGACAGAACCTTGG GGG (reversed) Intronic
900031359 1:375263-375285 GGCCCAGGACTGACCCCTGGAGG - Intergenic
900051911 1:603463-603485 GGCCCAGGACTGACCCCTGGAGG - Intergenic
900991674 1:6100972-6100994 GGACAAGGACAGAAGGTGGGAGG - Exonic
901447484 1:9317150-9317172 CCCCAAGGCCAGAACCTTGCTGG - Intronic
901731102 1:11280357-11280379 GCCCAAGGACTGAGCCCTGGAGG - Intronic
902312724 1:15594028-15594050 GGCCAAGCAAAGAATCTTTGTGG + Intergenic
902800137 1:18824366-18824388 GGCCAAGGACAGAAGCATGGGGG + Intergenic
903775946 1:25793923-25793945 GGCCAAGGAGGGAACCGTGCTGG - Intergenic
904995031 1:34625062-34625084 GGCCAAGGATAGATCCTGAGGGG + Intergenic
905858646 1:41331344-41331366 GGCCTGGGACCGAAGCTTGGAGG + Intergenic
907459045 1:54594336-54594358 GGCCAAGGAAGGGACCTGGGTGG + Intronic
907688519 1:56638183-56638205 GCCCAAGGACAGGACCTAGTGGG - Intronic
908436567 1:64112707-64112729 GGGCAGGGACAGAAACTTGTGGG - Intronic
909059670 1:70865778-70865800 GGCTGAGCACAGAACCTTGAAGG + Intronic
910180469 1:84477518-84477540 GATCAAGGACTGAACCCTGGAGG - Intergenic
912308349 1:108594183-108594205 CGCCAAGGACAGAAGCTTGGTGG + Intronic
913599585 1:120410377-120410399 GGCCATGGGAAGAACCCTGGAGG - Intergenic
914087796 1:144469238-144469260 GGCCATGGGAAGAACCCTGGAGG + Intergenic
914314358 1:146495756-146495778 GGCCATGGGAAGAACCCTGGAGG + Intergenic
914499991 1:148237625-148237647 GGCCATGGGAAGAACCCTGGAGG - Intergenic
914591288 1:149108180-149108202 GGCCATGGGAAGAACCCTGGAGG + Intergenic
915905686 1:159875311-159875333 GCCCAAGGGCAGAATCTTGGGGG + Intronic
916519765 1:165553165-165553187 GGCCAAGTACAGAAGCTTTGGGG + Intronic
919877325 1:201879412-201879434 GGCCAAGGACACAGCCCTGGGGG - Exonic
1063016616 10:2084241-2084263 AGCCAAGGAGAGACCCTGGGAGG + Intergenic
1063113703 10:3057973-3057995 GGCCAAGCCCAGAGCCTAGGTGG - Intergenic
1065117273 10:22495156-22495178 GCCCAAGCACAGAACCCTGAGGG - Intergenic
1067242188 10:44506459-44506481 GGCAAAGGACAGAAACCTGGAGG - Intergenic
1068887526 10:62112610-62112632 GGCCAAGGACAAAGCCTTCAGGG + Intergenic
1072692654 10:97582184-97582206 TGCCAAGGCCTGAGCCTTGGAGG - Intronic
1075262543 10:120975773-120975795 AGCCAAGGACAGAGCCTGGGAGG - Intergenic
1076064908 10:127441364-127441386 GTCAGAGCACAGAACCTTGGCGG + Intronic
1076638472 10:131898864-131898886 GACCAAGGACAGAGCCCTGAAGG - Intergenic
1077868069 11:6239546-6239568 GGAGAAGGGCAGACCCTTGGTGG + Intronic
1078448233 11:11421062-11421084 GACGAAGGACAGCACCTGGGAGG - Intronic
1081483394 11:43508750-43508772 GGCCAAGGAGGGCGCCTTGGAGG - Intergenic
1081662051 11:44894309-44894331 GGCCAAGGGCAGAGCCTCAGAGG - Intronic
1083695445 11:64439355-64439377 AGCCAAGGACAGAACCTACGGGG - Intergenic
1084021916 11:66422840-66422862 GGCCAGGGCCAGGACCTGGGCGG - Exonic
1085250180 11:75138141-75138163 TGAGAAGGACAGAACCATGGGGG + Intronic
1086257969 11:84902549-84902571 AGCTACGGACAGAACCCTGGGGG - Intronic
1087004119 11:93452233-93452255 GGCCAATGTCTGACCCTTGGTGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088471842 11:110195312-110195334 GTCCAAGGACCGAAGCTTAGAGG - Intronic
1089663300 11:119999847-119999869 GGCCACGAACAGAATGTTGGTGG + Intergenic
1089762421 11:120738034-120738056 AGCCCAGGACTGAGCCTTGGGGG + Intronic
1091393299 12:138865-138887 GGCCACCGACAGAGCCGTGGAGG - Exonic
1091885690 12:4015548-4015570 GGCCAAGGACAGCAACATGGAGG - Intergenic
1096106603 12:48999691-48999713 AGCCAGGGGCAGAACCCTGGTGG - Intergenic
1097265196 12:57740279-57740301 GCCCCAGGACAGAACATTGGAGG - Intronic
1101876918 12:108602216-108602238 GGCCAAGGTCAGGCCCTGGGAGG + Intergenic
1102554003 12:113713900-113713922 TGCCAAGAACAGAAGCTGGGAGG + Intergenic
1103340627 12:120219429-120219451 GGCCAAGGCCAGAGCCAGGGAGG - Intronic
1110565973 13:76957816-76957838 GTCCCAGGACAGCATCTTGGAGG - Exonic
1110684174 13:78352199-78352221 GGCCAAGAACAGGACACTGGGGG - Intergenic
1111556227 13:89884239-89884261 GGCCAAGGCCGGAGCCTTGCTGG - Intergenic
1111685389 13:91495303-91495325 AGGCAAGGACAGAAACTGGGAGG - Intronic
1112023674 13:95393448-95393470 GGCCAAGGACAGTACCAAGGGGG + Intergenic
1112261077 13:97879051-97879073 GGCAAAGGGCAGAATCTTTGGGG + Intergenic
1113450172 13:110403645-110403667 GGCCATGAACAGAACCTTAAGGG - Intronic
1113842425 13:113367773-113367795 GGCAAAAGACAGGACTTTGGAGG - Intergenic
1114617725 14:24077070-24077092 GGCCAGGGTCTGCACCTTGGTGG + Intronic
1115430161 14:33308082-33308104 GGCCAAGGACAGGAGAATGGGGG + Intronic
1118245297 14:64104408-64104430 GGAAGAGGACAGAACATTGGGGG - Intronic
1119531556 14:75364963-75364985 AGGCAAGGACTGAGCCTTGGAGG + Intergenic
1120759662 14:88274133-88274155 GGCCAGGGAAAGAACCATGGCGG - Intronic
1122093295 14:99353891-99353913 GTCCAAGGTCAGAGCCCTGGTGG + Intergenic
1122616581 14:103022103-103022125 GGCCAAGGACAGAACCCTGGGGG + Intronic
1124199468 15:27665957-27665979 GGCCAAGGAGAGATCCCTGCTGG + Intergenic
1124403259 15:29369306-29369328 GGCCAAAGAGAGAAGCTTGAAGG + Intronic
1125604932 15:40934855-40934877 GGCCAAAGTCAGACCCTGGGGGG - Intronic
1127629605 15:60814755-60814777 TGCCAAGGACAGTGCTTTGGAGG - Intronic
1128080364 15:64853640-64853662 GGCCTAGGTCCCAACCTTGGAGG + Intronic
1128458745 15:67850098-67850120 AGCCAAGGAGAGGACCTTAGGGG + Intergenic
1130298076 15:82661135-82661157 GGCCAAGGACAGAACCTTGGGGG - Intronic
1131261128 15:90888463-90888485 GAGCAAGGACAGAAGCTGGGAGG + Intronic
1133841686 16:9415859-9415881 GGGCAAGCATAGAACCTGGGAGG + Intergenic
1134452800 16:14373705-14373727 GGCCAAGGACAGCACCAGGCTGG - Intergenic
1135659005 16:24278268-24278290 GACCAAAGACAGAGCCTTGGGGG + Intronic
1136503672 16:30688582-30688604 AGCCAAGCACAGAGCCTTCGTGG - Intergenic
1137044012 16:35639609-35639631 GGCCAAGCACAGCACCTTCAGGG + Intergenic
1137724902 16:50650569-50650591 GGCCTAAGACAGAGACTTGGGGG + Intergenic
1137778212 16:51074160-51074182 GGCCAGATTCAGAACCTTGGAGG - Intergenic
1139129093 16:64118684-64118706 GTCCAAGGGTAGGACCTTGGGGG + Intergenic
1139735951 16:68988434-68988456 GACCAAGGGCAGAGCCCTGGGGG - Intronic
1140407112 16:74718329-74718351 GGCCAAGGACAGCACAATGCAGG + Intronic
1141984748 16:87572483-87572505 GGGCAAGGCCAGAAGCCTGGAGG - Intergenic
1142033823 16:87851761-87851783 GGCCAGGGCCAGGAGCTTGGCGG + Exonic
1142961692 17:3555736-3555758 GGCAGAGGACAGAGCCTGGGAGG + Intronic
1144741422 17:17584640-17584662 GGCCCAGGACAGAACCTGCTAGG + Intronic
1145784747 17:27586571-27586593 GGCCCTTCACAGAACCTTGGAGG + Intronic
1147791023 17:43014330-43014352 GGCCAGTGTGAGAACCTTGGCGG - Exonic
1150274466 17:63887231-63887253 GTCCAAGGACAGGACTTTGAAGG + Intergenic
1150806335 17:68322233-68322255 CCCCAAGCACAGCACCTTGGTGG - Intronic
1151162131 17:72174798-72174820 TGCTAAGGACAGTACCTAGGAGG + Intergenic
1151280944 17:73073585-73073607 TGCAAAGAATAGAACCTTGGAGG + Intronic
1151433151 17:74078558-74078580 GCCCAAGGACACAAGCTTGGAGG + Intergenic
1151800576 17:76377045-76377067 GGCACAGGACAGGACCTGGGAGG + Intronic
1151834489 17:76574067-76574089 GGCCAAGGACAGAGGCTGTGGGG - Intronic
1152948294 17:83210450-83210472 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1153260549 18:3219912-3219934 GGCTAAAGACAGGACCCTGGGGG + Exonic
1154940952 18:21111990-21112012 GGCCAAGGCGAGAACCTTGCCGG - Intergenic
1158329442 18:56345231-56345253 TGCCAAGGGCAAAACCTTAGAGG + Intergenic
1160488390 18:79314864-79314886 GGAGAAGGACAGAAGCTCGGTGG + Intronic
1161142053 19:2653852-2653874 GGCCAGGGACAGCGCCTGGGTGG - Intronic
1165053486 19:33158312-33158334 AGCCAAGGACAGAAGCTGGCAGG - Intronic
1165062770 19:33212858-33212880 GGCCATGGACAGCACCCGGGAGG + Exonic
1166567503 19:43774197-43774219 GGCCACGGACAGCACCCAGGCGG + Exonic
1167264574 19:48477379-48477401 GGCCTAGGACAGACCCTAGGGGG + Intronic
1167710478 19:51107521-51107543 GGACAAGGACAGAAGGCTGGAGG + Intronic
1168563575 19:57403950-57403972 GGCCAAGCACAGAGCCATGGTGG + Intronic
1168701187 19:58440526-58440548 GGCGAGGGACGGAATCTTGGAGG + Intergenic
1168714251 19:58517965-58517987 GGCCAAGGCCTGAACCTTTTCGG - Intronic
929863494 2:45698773-45698795 GGCCAAGGACAGACTTGTGGAGG + Intronic
930613060 2:53564221-53564243 GGCCAAGTACAGAGCCTTTCTGG + Intronic
930857440 2:56033819-56033841 GACCAAGGACAGAACCAGAGTGG - Intergenic
931288861 2:60855091-60855113 GGCCAAGAAAAGAACTGTGGTGG + Intergenic
932837265 2:75049429-75049451 GGCCTAGGAGAGCACATTGGAGG + Exonic
933854014 2:86395990-86396012 GCCCAAGGACAAAACCTAGATGG + Intergenic
934660695 2:96142259-96142281 GACCACGGACAGATCCTTAGAGG + Intergenic
934714071 2:96533252-96533274 GGGCAAGGAGAGAAAATTGGGGG - Intergenic
935208056 2:100913813-100913835 GGCCAAGGACACAAACTTGGGGG + Intronic
935945475 2:108282322-108282344 GGCCAATGACAGGGTCTTGGTGG - Intergenic
935977733 2:108595674-108595696 AGCCAAGAACAGGACCTGGGGGG - Intronic
939264019 2:139848871-139848893 AGACAAGAACAGAACCCTGGGGG + Intergenic
940255164 2:151720788-151720810 GGCCAAGGGCAGAGTTTTGGAGG - Intronic
943574784 2:189618335-189618357 GGCCAAGGACAGGACCCTAAGGG - Intergenic
943610689 2:190030437-190030459 GAACAAGGACAGAACCTTGGTGG - Intronic
945154850 2:206827781-206827803 GGCCCAGGACAAAACCTTGAGGG - Intergenic
945206281 2:207335528-207335550 GTCCAAGGAGAGAAACTCGGGGG + Intergenic
945682433 2:212930226-212930248 GCCCAAGGACAGAACATGGTTGG + Intergenic
946344516 2:219097897-219097919 GGCCAACGACTGAGCCTTGGAGG + Intronic
946432996 2:219635490-219635512 GGGAAAGGTCAGACCCTTGGAGG + Exonic
946667794 2:222068854-222068876 GGAGTAGGACAGAACCCTGGAGG - Intergenic
947623177 2:231604021-231604043 GCCTAAGAACAGAAACTTGGAGG + Intergenic
948444390 2:238020841-238020863 GGCCAAGGATGGGAACTTGGTGG + Intronic
948592936 2:239063000-239063022 GGCCAAGGTCAGGGCCTTGGCGG - Intronic
948691242 2:239706491-239706513 GGGCAAAGAGAGAATCTTGGAGG - Intergenic
1170043218 20:12060065-12060087 GGCCATGGGCAGAAGCCTGGTGG - Intergenic
1171041541 20:21768591-21768613 GGGCAAGGACAGTACCATGTTGG - Intergenic
1172020661 20:31911532-31911554 GGCCAGGGGAAGAACCTGGGAGG - Intronic
1173349203 20:42229272-42229294 AGCCAAGAGGAGAACCTTGGTGG - Intronic
1173849143 20:46207034-46207056 AGCCAAGGACAGAACTGGGGTGG - Intronic
1174454588 20:50640275-50640297 GACCAAGGACATGAGCTTGGAGG + Intronic
1174472209 20:50769446-50769468 GACCAAGGACATGAGCTTGGAGG - Intergenic
1178247183 21:30964645-30964667 GAACAAGGACAGATCCTTGGAGG + Intergenic
1179541808 21:42087837-42087859 GGCCAAGGAGAGAGGCCTGGGGG - Intronic
1182300621 22:29334907-29334929 GACCAAGGACAGTACCTAAGAGG + Intronic
1182739762 22:32559136-32559158 AGCCAATGACATAACCTTGCTGG - Intronic
1184738986 22:46416283-46416305 GGCCAAGGCCAGCACGGTGGAGG + Intronic
1184757761 22:46526534-46526556 AGCCAAGGGCAGGTCCTTGGTGG - Intronic
1184835163 22:47016647-47016669 GACAAAGGACAGGAGCTTGGTGG - Intronic
949237978 3:1833843-1833865 GGCCAAGGGTAGAAACTTGGAGG - Intergenic
949916207 3:8966593-8966615 TGACAGGGACTGAACCTTGGTGG + Intergenic
951640550 3:24830093-24830115 GGCCAGGGACCGAGCCCTGGAGG + Intergenic
953041164 3:39256052-39256074 GGGCCAGGACAGAACCTTGTAGG + Intergenic
953576921 3:44120143-44120165 GCCCAAGGGAACAACCTTGGAGG - Intergenic
954210528 3:49094425-49094447 GGCCCAGGACAGAAGTTTGTGGG - Intergenic
954618498 3:51982892-51982914 GGCCCCGGGCAGAACCTTGCAGG + Intronic
954698167 3:52438447-52438469 GGCAAAGGTCAGCACCTGGGAGG - Intronic
955925352 3:63998940-63998962 GGCCATGAACAGACTCTTGGGGG - Intronic
957277881 3:78112524-78112546 GGCCAAGGAGAGAACATTGCTGG - Intergenic
957959179 3:87227434-87227456 GGAAAAGGACAGGACCTTGGCGG - Exonic
958833833 3:99120528-99120550 GGCCAGGGACAGAACCTTGAGGG + Intergenic
959379073 3:105619887-105619909 GGGCAGGGACAGACCATTGGGGG + Intergenic
960848130 3:122023254-122023276 TGGCAAGGTCAAAACCTTGGTGG - Intergenic
963535208 3:146519807-146519829 GGCCAAGTTAAGAATCTTGGAGG - Intronic
963809553 3:149762169-149762191 GACCAAAGATAGAATCTTGGAGG - Intronic
966308258 3:178562488-178562510 GGCTAAGAAAAGAAACTTGGAGG + Intronic
967130995 3:186470588-186470610 GGCCAAGGACAGAGCCACAGTGG - Intergenic
967315763 3:188150883-188150905 GGCCAAGGATAGCACACTGGTGG - Intergenic
968563790 4:1298676-1298698 GGCCAAGGACTGAGCCCGGGGGG - Intronic
969655794 4:8497844-8497866 GGCAAAGGGCAGAACCCTGAGGG - Intergenic
970898810 4:21134728-21134750 GGCAGAGGACACAAGCTTGGGGG - Intronic
972614012 4:40680849-40680871 GATCAAAGACAGAATCTTGGGGG + Intergenic
973825955 4:54708040-54708062 GGCCAAGGACTAAAGGTTGGAGG + Intronic
976881398 4:89929805-89929827 AGGCAAGCACAGCACCTTGGAGG - Intronic
978347871 4:107790179-107790201 GTCCAAGCACAGATCCTTGCGGG + Intergenic
979625080 4:122835360-122835382 GGCTAAAAACAGAACCTTGGGGG - Intronic
979654320 4:123174613-123174635 GGTCAAAAACAGAACCATGGTGG + Intronic
979678401 4:123434252-123434274 GGCCAAGCACACAGCCATGGCGG - Intergenic
980736878 4:136901269-136901291 TGCCAAGGAAAGAAACTTTGAGG - Intergenic
980992335 4:139748568-139748590 GGCCAAGAACAGACCCTGGCTGG + Intronic
983287202 4:165754801-165754823 GACCAAGGACAGAACCCAGAGGG + Intergenic
983903740 4:173164130-173164152 TTCCAAGGACAAAACTTTGGAGG - Intergenic
984707335 4:182857182-182857204 GTCAAAAGACAAAACCTTGGGGG - Intergenic
985215521 4:187649523-187649545 GGCCAATGACAGAAACTGGCTGG - Intergenic
985690783 5:1311068-1311090 GCCCAGGTACAGAATCTTGGGGG + Intergenic
986639225 5:9855647-9855669 GGCCAAAGATAAAAACTTGGAGG - Intergenic
991435673 5:66595885-66595907 GGAAAAGGACAGAAACTTCGTGG - Intergenic
992738738 5:79751310-79751332 GGCCAAGTACAGCACATTCGAGG - Intronic
993182407 5:84571148-84571170 GGCCAAGGAGAGAAGCGGGGAGG - Intergenic
995972124 5:117985301-117985323 AGACAAGGACAGAACCTATGAGG - Intergenic
996814005 5:127553968-127553990 GGCCAAGAACAGAACCAGAGAGG - Exonic
997284665 5:132669526-132669548 GGCCATGGGCAGTGCCTTGGCGG - Intergenic
997516202 5:134491617-134491639 GCCCAAGGATTGAGCCTTGGGGG - Intergenic
997595265 5:135103136-135103158 GGCCATGGAGAGAACTTTGGGGG + Intronic
998779017 5:145635619-145635641 GGCCAAAGACAGAATGTTAGAGG - Intronic
1001823240 5:174725684-174725706 GGCGAAGCTCAGAACCTTGCCGG - Intronic
1001830066 5:174778807-174778829 TGGCAAGGAAAGAACCTTGAGGG - Intergenic
1002196447 5:177504123-177504145 GGCCAACGACAGTACCCTGGAGG - Exonic
1002742461 5:181443605-181443627 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1003153912 6:3575121-3575143 GGCTCACGACAAAACCTTGGTGG - Intergenic
1003317227 6:5023944-5023966 GGTCCAGAACAGCACCTTGGTGG + Intergenic
1003405062 6:5821256-5821278 GGGCAAGGACAGAACACAGGTGG - Intergenic
1005559644 6:27025271-27025293 GACCAATGACTGAATCTTGGGGG - Intergenic
1005615268 6:27566617-27566639 GTCCAAGGACAGTAGCTGGGAGG + Intergenic
1005852226 6:29830185-29830207 GGCTAAGGACAGACCTTAGGAGG + Intronic
1007132127 6:39485010-39485032 GGCCAAGGAGAGAGCCCTGGGGG - Intronic
1007731175 6:43947999-43948021 GGTAGAGGAGAGAACCTTGGTGG - Intergenic
1007771873 6:44198846-44198868 GGCCAAGGACAGATCACTTGAGG - Intergenic
1007905867 6:45460172-45460194 GGCCAAGGACAGATCCCTGGGGG + Intronic
1014555070 6:122836069-122836091 TGCCAAGGATACAACCTTGAAGG + Intergenic
1016325170 6:142892766-142892788 CACTAAGGACAGAGCCTTGGGGG - Intronic
1017516098 6:155156914-155156936 GATCAAGGACAGCGCCTTGGAGG - Intronic
1019247597 6:170719344-170719366 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1019600038 7:1876771-1876793 GGCCAAGGACATCACCTTCTGGG - Intronic
1022427419 7:30282726-30282748 GGCCAAGGAAAGAACATAGAAGG + Intergenic
1032192227 7:129771752-129771774 GGCCAAGTCCAGGACCTCGGTGG + Intergenic
1033682138 7:143604915-143604937 GGACAAGGCCAGACCCTGGGAGG - Intergenic
1033702752 7:143856998-143857020 GGACAAGGCCAGACCCTGGGAGG + Intronic
1033963614 7:146945996-146946018 GGCCAAAGAGAGACCTTTGGTGG + Intronic
1035500540 8:88592-88614 GGCCCAGGACTGACCCCTGGAGG - Intergenic
1037570359 8:20152731-20152753 ATCCAAGGACTGAGCCTTGGGGG + Intronic
1037898814 8:22675722-22675744 TGCCAAGGCCAGCACCTTTGGGG + Intergenic
1040481770 8:47833357-47833379 GGCCCATGACAGAACCCTGGGGG - Intronic
1040577767 8:48669143-48669165 GGTCAAGGACAGAAGCTCAGGGG - Intergenic
1040775232 8:51035116-51035138 TGCCAAGGAAAATACCTTGGTGG + Intergenic
1044354776 8:91208379-91208401 CCAGAAGGACAGAACCTTGGAGG + Intronic
1045253860 8:100503047-100503069 GGCCTAGGACAGATCCTGGATGG - Intergenic
1047376098 8:124298435-124298457 GGCCAAGGACAGAACTCTTAAGG - Intergenic
1047580903 8:126214131-126214153 AGCCAAGGTCAGAACCTTGGGGG - Intergenic
1047836298 8:128697134-128697156 GGCCAAGGAAAGCTCCTTAGAGG - Intergenic
1048262488 8:132956790-132956812 GGCCAAGGTCAAAGCCTGGGTGG + Intronic
1048982220 8:139708772-139708794 AGCCAAGGCCTAAACCTTGGGGG - Intergenic
1049737044 8:144214115-144214137 GGCCAAGGAGAGGTCCCTGGTGG - Intronic
1052290405 9:26833848-26833870 GCACAAGGTCAGGACCTTGGAGG - Intergenic
1054994260 9:71366538-71366560 GGCCTAGGACTTAACCTTGTAGG + Intronic
1057191237 9:93088776-93088798 GACCAAGGAAATAAACTTGGTGG - Intergenic
1059249563 9:112876612-112876634 AACCAAGGACAGGACCTTGGAGG + Intronic
1060929764 9:127481544-127481566 GGCCAAGGAGAGCAGCTTTGAGG + Intronic
1061012436 9:127963588-127963610 GGCCAAGGACACCAGCCTGGTGG - Intronic
1061719461 9:132542759-132542781 GGCCAGAGACAGGACCATGGAGG + Intronic
1062026119 9:134341583-134341605 GGCCCAGGCCAGGACCTTGGAGG + Intronic
1062040287 9:134401418-134401440 GGCGCAGAACAGTACCTTGGAGG + Intronic
1062109120 9:134772513-134772535 GGCCAAGGCCAGAGACTTGCGGG - Intronic
1062112881 9:134791707-134791729 GGCCAAGGGCGAAACCTGGGAGG - Intronic
1203608368 Un_KI270748v1:74824-74846 GGCCCAGGACTGACCCATGGAGG + Intergenic
1186216935 X:7310707-7310729 GGCCCAGGACAGAGCCCTGGAGG - Intronic
1187327271 X:18302581-18302603 GGACCAGGACAGAACCTTGTGGG - Intronic
1187405032 X:18996422-18996444 GGCCAAGGACAGGATGTGGGAGG - Intronic
1187716136 X:22104375-22104397 GGCCAGGGAGGGACCCTTGGAGG + Intronic
1192930633 X:75801982-75802004 GGCCAAGGTCACAGCCTTGATGG - Intergenic
1194657991 X:96596983-96597005 GGCAAAGGACACGTCCTTGGAGG - Intergenic
1195471031 X:105230139-105230161 GGCAGAGGCTAGAACCTTGGAGG - Intronic