ID: 1130298663

View in Genome Browser
Species Human (GRCh38)
Location 15:82664382-82664404
Sequence CAGGATGAGGATGAGGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2151
Summary {0: 1, 1: 2, 2: 18, 3: 223, 4: 1907}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130298663_1130298667 -9 Left 1130298663 15:82664382-82664404 CCTTTCTCCTCATCCTCATCCTG 0: 1
1: 2
2: 18
3: 223
4: 1907
Right 1130298667 15:82664396-82664418 CTCATCCTGGTCTTCATTGTCGG 0: 1
1: 0
2: 3
3: 17
4: 176
1130298663_1130298669 3 Left 1130298663 15:82664382-82664404 CCTTTCTCCTCATCCTCATCCTG 0: 1
1: 2
2: 18
3: 223
4: 1907
Right 1130298669 15:82664408-82664430 TTCATTGTCGGACTCACTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130298663 Original CRISPR CAGGATGAGGATGAGGAGAA AGG (reversed) Exonic
Too many off-targets to display for this crispr