ID: 1130301499

View in Genome Browser
Species Human (GRCh38)
Location 15:82682408-82682430
Sequence CATGATCACAATACAGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130301499_1130301506 28 Left 1130301499 15:82682408-82682430 CCTTACACTGTATTGTGATCATG 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1130301506 15:82682459-82682481 CAGCAGCAGCTATATATTACAGG 0: 1
1: 0
2: 2
3: 6
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130301499 Original CRISPR CATGATCACAATACAGTGTA AGG (reversed) Intronic
900280721 1:1866405-1866427 GATGACCACAATACAGTAAATGG - Intronic
902143338 1:14375558-14375580 CATGCTCAGCATAAAGTGTAAGG + Intergenic
909264915 1:73544935-73544957 CAAGATCCCAATACAGTGACTGG + Intergenic
909347736 1:74611854-74611876 GATGAACACAAAACAGGGTAAGG - Intronic
910845009 1:91596186-91596208 CATGATCACAGTTCCGTGTTAGG - Intergenic
913143068 1:115961339-115961361 CATGATCACAAAATAGAGCAAGG + Intergenic
915068410 1:153245158-153245180 GATGATAACAATAAAGTGTTAGG + Intergenic
917627239 1:176858857-176858879 CATGATGGCAGTATAGTGTAAGG + Intronic
917902628 1:179557862-179557884 GATGATCACAATATATTGTTGGG + Intronic
918427982 1:184429666-184429688 CATAACCACAAGACAGTGTTGGG + Intronic
923898443 1:238299344-238299366 CATGTGCACAGAACAGTGTATGG + Intergenic
924858228 1:247895972-247895994 CATGATCACCATGTAGTGCAGGG - Exonic
1062840808 10:670446-670468 AATAATCACAAAACAGGGTAGGG + Intronic
1064461357 10:15537654-15537676 CATTATGACACTAGAGTGTAGGG - Intronic
1064633141 10:17337760-17337782 CATGTTCACAATAATGGGTATGG + Intronic
1065963016 10:30749598-30749620 CATCATCTCAAGACAGTGCATGG - Intergenic
1066087641 10:31986587-31986609 AATGATCACAATATATTGTTAGG + Intergenic
1066462870 10:35627302-35627324 CACAATCATAAGACAGTGTAAGG + Intergenic
1067710537 10:48648094-48648116 CATCATCACAATCCAGTTTTAGG - Intronic
1071264469 10:83952541-83952563 CATGTTCAAAGTACAGTGCATGG + Intergenic
1072201651 10:93165322-93165344 GAGGATCACAGCACAGTGTAAGG - Intergenic
1072270919 10:93775524-93775546 AATGATCAGAATTTAGTGTAAGG + Intronic
1072811172 10:98463237-98463259 ATTGTTCACAATAAAGTGTAAGG - Intronic
1074547209 10:114410190-114410212 CATGATCACAAAAGAGTGCCTGG - Intergenic
1076863178 10:133151925-133151947 CATGACTACCACACAGTGTAAGG + Intergenic
1082748091 11:56989299-56989321 CATGATTACAGTATAGTGAAGGG - Exonic
1086371467 11:86159563-86159585 CATGATTGCAGTACAGTGTGAGG + Intergenic
1088759511 11:112915821-112915843 CATGAAGACAATACAGAGGATGG - Intergenic
1088774476 11:113069154-113069176 AATGATCAGAGTACAGTGGAGGG + Intronic
1089579036 11:119470096-119470118 GATGTTCTCAATTCAGTGTAAGG - Intergenic
1091679759 12:2518779-2518801 CATGATCACTCAACAGTGCAAGG - Intronic
1099775960 12:87130768-87130790 CATGATCATAATACACTATCTGG + Intergenic
1099951660 12:89310752-89310774 CAGGATCCCAATACATTGCACGG - Intergenic
1100912939 12:99386341-99386363 GATGATCAGAATCCAGTGTGCGG - Intronic
1100944914 12:99770989-99771011 CACTATCACAATACAGTCTTTGG + Intronic
1101836713 12:108300892-108300914 CATGATCACCCTACAGGGTCGGG + Intronic
1102535976 12:113581852-113581874 AAATATCACAACACAGTGTATGG + Intergenic
1102749394 12:115279160-115279182 CATGAGCCCACTAGAGTGTAAGG - Intergenic
1103217493 12:119213267-119213289 TATCATCACAATACATTGAAAGG + Intronic
1104147621 12:126050653-126050675 CCTGATCACTATACAGTAAAGGG + Intergenic
1110308337 13:74016782-74016804 CATGTACACAAAAAAGTGTAGGG - Intronic
1111459577 13:88521075-88521097 CACTATCACAAAACAGTGTGAGG - Intergenic
1111620725 13:90721835-90721857 TATGAAAACAACACAGTGTATGG + Intergenic
1112463200 13:99621158-99621180 CATGATCAGAGTACAGCGTTAGG - Intronic
1113578376 13:111410682-111410704 AATGATCACTATACATTGAAAGG - Intergenic
1115110948 14:29821157-29821179 CATGTTCACAATAGATTTTAGGG + Intronic
1117212811 14:53518948-53518970 CAGGATAGCAATACAATGTAGGG - Intergenic
1118332883 14:64827396-64827418 GAAGATAACAATACAGTGGAAGG - Intronic
1120283609 14:82469663-82469685 CATGATCTCATTCCAGTTTATGG - Intergenic
1123692493 15:22850244-22850266 CCTGATCACAACAGAGTGAAGGG - Intronic
1126275770 15:46878802-46878824 CATCACCACAATCCAGTATAGGG - Intergenic
1130301499 15:82682408-82682430 CATGATCACAATACAGTGTAAGG - Intronic
1133693514 16:8238327-8238349 GATGATGACAATAGTGTGTAGGG + Intergenic
1142043594 16:87911062-87911084 CATAATGACAATACAATGTCAGG + Intronic
1148705166 17:49623766-49623788 AATGATCACAAAACAGAGCAAGG - Intronic
1148885824 17:50771919-50771941 CAAAATCACAAAACAGTGCAGGG - Intergenic
1153701235 18:7695322-7695344 CATGAACACAATGCAGCGTATGG + Intronic
1154949865 18:21199301-21199323 CAGGATCAAAATATAGTGTGAGG - Intergenic
1155569146 18:27171069-27171091 CAAAATCACAACACAGTGTTAGG + Intronic
1158265986 18:55661251-55661273 AATGCTCACAATACAGTGTCTGG + Intronic
1165278353 19:34773918-34773940 CATCATCACAATACACTGCTAGG + Intergenic
926184057 2:10674488-10674510 CATGATTACATTACATTCTATGG + Intronic
927428937 2:23010033-23010055 CATCATCACAATACATGTTAAGG - Intergenic
927835993 2:26399752-26399774 CCTGATCACTATACATTATATGG - Intergenic
933001135 2:76925057-76925079 CATGATCATAATACATTGTATGG + Intronic
937186193 2:120045573-120045595 CATTATCTGAATACAGTCTAAGG - Intronic
937678660 2:124620032-124620054 CATGAGCAGAACACAGAGTAGGG - Intronic
939443404 2:142277703-142277725 CATGATAAAAATACCGTTTAAGG + Intergenic
942609086 2:177723454-177723476 CATGATCACATTAAAATTTATGG - Intronic
942764009 2:179432493-179432515 CATGAAGATAGTACAGTGTATGG - Intergenic
945976911 2:216278066-216278088 AATGATCACAGTTCATTGTAAGG + Intronic
1169561903 20:6810571-6810593 CATAACCACAATCCAGTGTTAGG - Intergenic
1171034332 20:21703967-21703989 CATGAACACAGTACAGTCTCTGG - Intergenic
1184427028 22:44416239-44416261 TATGATCAAAATTAAGTGTAAGG - Intergenic
952059326 3:29488590-29488612 AATGATCACAATGCATAGTATGG + Intronic
954277072 3:49549282-49549304 CATGATCACAATAGAGATTCTGG + Intergenic
955734829 3:62027345-62027367 CAGGATCAGAATAAAGTATAGGG - Intronic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
956634840 3:71353569-71353591 CATGATTAAAATATAGTTTAAGG - Intronic
957831422 3:85525989-85526011 AATGATAATGATACAGTGTAAGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
962500849 3:135990680-135990702 CATGATCACAAAACTGTGAGCGG - Intronic
963205360 3:142628992-142629014 CATGATCACTATTCAATCTAAGG - Intronic
963560339 3:146856674-146856696 CAGGATCACACCACTGTGTAGGG + Intergenic
965158389 3:165096320-165096342 CATTATCACAATTCAATGTGAGG - Intergenic
965316649 3:167199687-167199709 TATGGTCACAATACATTCTACGG + Intergenic
970786787 4:19806893-19806915 CATGGTCAGAATAAGGTGTAAGG + Intergenic
980639523 4:135558056-135558078 CATGATCAAAATAAACTCTATGG + Intergenic
980954953 4:139418629-139418651 ACTGATGACAATACAGTGGAAGG - Intronic
981621057 4:146699342-146699364 CATGGTCACATTACTGTCTAGGG + Intergenic
994149013 5:96426744-96426766 CATGATGACAATTCAGTGTGTGG + Intronic
996075264 5:119185406-119185428 CATGTTCAAGATACGGTGTATGG + Intronic
997134025 5:131306060-131306082 CATGATCTGAAAATAGTGTATGG + Intronic
998115872 5:139536854-139536876 CATGATAATAATACTGTGTATGG - Intronic
999929697 5:156417862-156417884 CAAGATCATAATACATTGTCTGG + Intronic
1001880488 5:175239831-175239853 CATGAACACAGTATAGTGTCAGG - Intergenic
1001895492 5:175376297-175376319 AATGTTCACAATACAGTGTTAGG - Intergenic
1004103962 6:12645878-12645900 CATGCTACCAATACAGAGTATGG + Intergenic
1004115826 6:12767036-12767058 CATGACCAAAATACAATGTGAGG - Intronic
1004969513 6:20893415-20893437 AATAATCACAATAAAGAGTAAGG + Intronic
1006083417 6:31580446-31580468 ATTCATCACAACACAGTGTATGG - Intergenic
1008579559 6:52894589-52894611 CATCATGTCAAAACAGTGTAGGG - Intronic
1009329351 6:62397007-62397029 TATGATCAAAAAACTGTGTATGG - Intergenic
1011801401 6:91020079-91020101 CATCATCAGAATATACTGTAAGG + Intergenic
1012785777 6:103623842-103623864 CATGATCACAATTCTGTAAATGG - Intergenic
1012858685 6:104533117-104533139 CATCATCACAAAGCAGTATATGG - Intergenic
1014943066 6:127465878-127465900 CAACATCAGAATACAGTGGAAGG - Intronic
1015809663 6:137148948-137148970 CACAATCACAATCCAGTGAATGG - Intronic
1016211584 6:141541713-141541735 CATTATCATGATACTGTGTAGGG + Intergenic
1016710837 6:147170112-147170134 CATGAATACATGACAGTGTAAGG - Intergenic
1023215494 7:37858522-37858544 CATGATTAAAATACAGTCTCTGG + Intronic
1024536340 7:50437601-50437623 CATTATAACAAGACTGTGTAAGG + Intergenic
1025605562 7:63037877-63037899 CAGCATCACAGTGCAGTGTATGG + Intergenic
1028408947 7:90507162-90507184 GGTGATCAAAATACAGTGTAGGG + Intronic
1033244650 7:139707688-139707710 CCTCAGCACAACACAGTGTATGG + Intronic
1034194186 7:149233427-149233449 AATGATCCCAATACAGTGAAAGG - Intergenic
1037993110 8:23334595-23334617 CATGTTAACAATACAGGCTAAGG - Intronic
1038341560 8:26690474-26690496 AATGATCACAAAACAGTATGAGG + Intergenic
1041223998 8:55680391-55680413 CATGATCATATTCCAGTGTGTGG - Intergenic
1041659637 8:60388843-60388865 CATGACCACAATTAACTGTATGG - Intergenic
1048027841 8:130602921-130602943 CATGATAACAATACACTACAAGG + Intergenic
1048473555 8:134723670-134723692 CATGGTCCCAGTACAGTGAAGGG - Intergenic
1052882624 9:33613192-33613214 AATGATCACAATATAGTCTGAGG + Intergenic
1188689533 X:33112637-33112659 TATGATCAAGATACACTGTAAGG - Intronic
1189505487 X:41609413-41609435 CATGATTGAAATACAGTATATGG - Intronic
1189814884 X:44814612-44814634 AATAATTACAATACAGTGAAAGG - Intergenic
1193515630 X:82458848-82458870 CATGAACACAATACACTGTCTGG + Intergenic
1193703413 X:84791149-84791171 CATGCTAGCAAAACAGTGTAGGG - Intergenic
1195334160 X:103832663-103832685 CATGATCACAACACATTGCTAGG + Intergenic
1196719657 X:118841336-118841358 CATCACCACAATACAGTTTTAGG + Intergenic
1197665457 X:129218333-129218355 CATTAACAAAATACAGAGTATGG - Intergenic
1197743107 X:129910943-129910965 CAAGATCTCAATATAATGTAGGG - Intronic
1198000863 X:132434026-132434048 CAGGATAACAATACATTGTCAGG - Intronic
1199736542 X:150691626-150691648 GATGTTCACAATCCAGTGAAGGG - Intergenic