ID: 1130303700

View in Genome Browser
Species Human (GRCh38)
Location 15:82699248-82699270
Sequence CCAGTGGACTGGAACTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130303700_1130303706 -9 Left 1130303700 15:82699248-82699270 CCACCTAAGTTCCAGTCCACTGG 0: 1
1: 0
2: 1
3: 16
4: 109
Right 1130303706 15:82699262-82699284 GTCCACTGGCAGGCAGTGGCTGG 0: 1
1: 0
2: 4
3: 90
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130303700 Original CRISPR CCAGTGGACTGGAACTTAGG TGG (reversed) Intronic
902289598 1:15427571-15427593 ACAGAGGACTGGGCCTTAGGAGG + Intronic
903248778 1:22036687-22036709 CCATTGCACTCCAACTTAGGTGG + Intergenic
905540671 1:38757996-38758018 CCAGTGGACTGGCAGTCAGGAGG - Intergenic
908558351 1:65280678-65280700 CCATTGGCCTGGAAGTTAGGAGG + Intronic
910288627 1:85579860-85579882 GCAGTGGGCTGGAACTAAAGTGG + Intergenic
911797815 1:102096258-102096280 CCAGAGGACAGGAATTTTGGAGG + Intergenic
915604904 1:156944328-156944350 CCAGGGGACTGGGACTGAGCAGG - Intronic
918756622 1:188345882-188345904 ACAGTGGACTGGGGGTTAGGGGG - Intergenic
919145266 1:193626244-193626266 CCAGTGGTGTGGGACTTAGAAGG + Intergenic
920825136 1:209417871-209417893 CCTGTGGCCTGGGAATTAGGAGG - Intergenic
1062935192 10:1380289-1380311 CCAGTGCCCTGGAACTTAGCAGG - Intronic
1063615888 10:7600257-7600279 CCAGTGGACAGGATGTTAGGGGG + Intronic
1066021212 10:31304430-31304452 CAAGTGGCCTGGAAATTAAGAGG + Intergenic
1068586747 10:58808753-58808775 CCACTGCACTGCAGCTTAGGGGG - Intronic
1068927642 10:62556675-62556697 CCATTTGACTGGAAGCTAGGAGG - Intronic
1070187404 10:74078375-74078397 CCAGTGGTCTGCAAGTAAGGGGG - Intronic
1072539644 10:96388641-96388663 CCAGTGGACTGGAAGTTGTAAGG - Intronic
1075941453 10:126393771-126393793 CCAGTGGAGTAGAGCTGAGGTGG + Intergenic
1077930165 11:6722655-6722677 CCATTGGCCTGGAAGTAAGGTGG - Intergenic
1081685869 11:45042620-45042642 CCAGAGGGCTGGAACCAAGGAGG + Intergenic
1082803227 11:57429699-57429721 CCAGTTGACTGGACCTCAGAAGG - Intergenic
1084208068 11:67607411-67607433 GCAGTGGACGGGAAATCAGGAGG - Intronic
1090119845 11:124014810-124014832 CCAGTGGGCAGGAATTTAGAGGG - Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1090828585 11:130405326-130405348 CCAGTGGACTGGACCTTGCTCGG - Exonic
1095671072 12:44860888-44860910 TCAGTGGGCTGGAAATTTGGGGG - Intronic
1100176837 12:92040417-92040439 CCAGTAGACTGTAAATTAAGTGG - Intronic
1103063569 12:117878291-117878313 CCAGTGGGAGGGAATTTAGGCGG - Intronic
1103741433 12:123094266-123094288 CCAGAGGAATGGAACTCAAGTGG + Intronic
1105901335 13:24756935-24756957 CAAGTGGCCTGGAAATTAAGAGG - Intergenic
1111365299 13:87235066-87235088 CCAGTGGACTGGAAGGATGGGGG - Intergenic
1111462698 13:88567137-88567159 CCTGAGCACTGGAACTTAGATGG + Intergenic
1117680547 14:58199118-58199140 CCAGTGGACAAGAATTTTGGGGG + Intronic
1118049487 14:62011358-62011380 CCACTGGATTGTAACCTAGGAGG - Intronic
1119887706 14:78157273-78157295 GCAGTGGACTTGCATTTAGGAGG + Intergenic
1120352731 14:83383630-83383652 ACAGTGGACTGGATCTGATGAGG - Intergenic
1121033016 14:90675358-90675380 ACAGCTGACAGGAACTTAGGTGG + Intronic
1121954530 14:98201873-98201895 CCACTTGACTAGAACTTTGGAGG - Intergenic
1122125226 14:99575159-99575181 CCTGTGTACGGGAACTCAGGTGG - Intronic
1125175675 15:36818730-36818752 ACAGTGGACAGGAAGTTAGGGGG - Intergenic
1126119957 15:45242584-45242606 CCAGGGGACTGGAGCATCGGAGG + Intergenic
1126343404 15:47668373-47668395 ACAGTGGAGTGGAAATTAGATGG - Intronic
1128381632 15:67117462-67117484 GCACTGGGCTGGAACTTGGGGGG - Intronic
1130303700 15:82699248-82699270 CCAGTGGACTGGAACTTAGGTGG - Intronic
1134509461 16:14834456-14834478 GCAGTGGATTAGAACTTCGGGGG - Intronic
1134697166 16:16233271-16233293 GCAGTGGATTAGAACTTCGGGGG - Intronic
1134974679 16:18561414-18561436 GCAGTGGATTAGAACTTCGGGGG + Intronic
1139020266 16:62740146-62740168 TCAGTTGACTGGAAATTTGGTGG + Intergenic
1140542632 16:75771969-75771991 CCAGTGAACTGTAAGGTAGGAGG + Intergenic
1140711848 16:77685986-77686008 CCGCTGGACTGTAAGTTAGGTGG + Intergenic
1144061524 17:11587034-11587056 CCACTGGACTTGAACCTAGGAGG - Intergenic
1146480500 17:33201347-33201369 CCAGTAGCCTGGGACTGAGGGGG + Intronic
1151247548 17:72806505-72806527 ATAGTGGGCTGGCACTTAGGGGG + Intronic
1151897491 17:76990156-76990178 CTAGTGGGTTGGAACTTAGGGGG - Intergenic
1153673872 18:7438470-7438492 CCAGGGGACCGGAACTCAGGTGG + Intergenic
1158530151 18:58253292-58253314 TCACTGGGCTGGGACTTAGGAGG - Intronic
1159801364 18:72904336-72904358 CCAGTGGACTGGAATTTTGCAGG - Intergenic
1160675026 19:385733-385755 CCGTTGGACTGGAATTTAGGTGG - Intergenic
1164507895 19:28874464-28874486 CCAGTGGACTGGATGCTGGGGGG + Intergenic
1167008043 19:46788067-46788089 CCTGGAGACTGGAACTTTGGAGG + Exonic
925780541 2:7377955-7377977 CCAGAGGACTGGAACTTGCGGGG + Intergenic
926085468 2:10017050-10017072 CGAGGGGACTGGAACTTGTGGGG + Intergenic
930009806 2:46928013-46928035 CCAGTGGTCAGCTACTTAGGAGG - Intronic
933066792 2:77808069-77808091 CCAGGGGACTGGAGCATGGGAGG - Intergenic
933794276 2:85907166-85907188 CCAGTGGAATGGAGTTGAGGAGG + Intergenic
935629862 2:105204516-105204538 TCAGTGGACTGGAGCATACGAGG - Intergenic
938216927 2:129525992-129526014 CCAGTGGACTGGAGGTTTGGAGG + Intergenic
938823665 2:134983317-134983339 CCATTGGACTTGAACCTGGGAGG + Intronic
938874924 2:135522350-135522372 CCAGGGGACTGGAGCATCGGAGG - Intronic
945037019 2:205712769-205712791 CCAGAAGACTGGAAGTTGGGGGG + Intronic
945491597 2:210462176-210462198 CCAGTGGATTTGATCTTAAGGGG + Intronic
1172060899 20:32186893-32186915 CCAGTGGGCTGAAACACAGGAGG + Intergenic
1172289469 20:33765768-33765790 CCAGTGGCCTGGCACATAGTAGG - Intronic
1179054936 21:37922653-37922675 CCAGTGGACTTGAAACTGGGTGG - Intergenic
1180592779 22:16955313-16955335 GCAGTGGACTGGGACAGAGGTGG + Intergenic
1182415149 22:30216710-30216732 CCAGGCCACTGGAACTCAGGGGG - Intergenic
1182969914 22:34564207-34564229 GCAGTGGATTGGAACTCAGAGGG + Intergenic
1185082078 22:48715115-48715137 CCAGTGGACATGAACTTTGGGGG + Intronic
1203304489 22_KI270736v1_random:99726-99748 GCAGTGGAGTGGAACGTAGTGGG + Intergenic
949576521 3:5343697-5343719 CAAGTGCACTTGAACTTGGGAGG - Intergenic
952487857 3:33833899-33833921 CCAGAGAAGTGGACCTTAGGAGG - Intronic
953007723 3:38993760-38993782 CCAGTGCTGTGGAACTTAGGTGG - Intergenic
958130225 3:89409822-89409844 CAAGGGGACAGGATCTTAGGAGG - Intronic
960634146 3:119767443-119767465 CCAGTGGCCTAGAACTGAGTAGG - Intergenic
962351510 3:134659850-134659872 CCAGTGGCCTGGATCCCAGGGGG + Intronic
962383758 3:134916547-134916569 CCAGTGGGCTGGCACTTCTGGGG + Intronic
964452136 3:156822864-156822886 CCAGTGGGCTGGCACTGCGGGGG + Intergenic
971170193 4:24225836-24225858 CCTGTTGACTGGAGCTTAGGTGG + Intergenic
973858352 4:55035730-55035752 CGGGGGGACTGGAACTGAGGAGG - Intergenic
974883957 4:67793259-67793281 CCAGTGGACTGAAAAATATGGGG + Intergenic
975344968 4:73282981-73283003 CCAGTGAACATGAACTTAAGAGG + Intergenic
978396456 4:108285688-108285710 CCAGTGGAGTGGAGCTGGGGAGG - Intergenic
979206070 4:118039819-118039841 CCACTTGCCTGGAACTTAGAAGG + Intronic
984510534 4:180673431-180673453 TCAGTGGACTTGAACTGAGGGGG - Intergenic
985033083 4:185811781-185811803 GCACTGGACTGGAACGCAGGCGG - Intronic
986161822 5:5237204-5237226 CCACTGGGCTGCAACTTAGAGGG - Intronic
986967600 5:13294117-13294139 ACAGAGGACAGGAATTTAGGGGG - Intergenic
988292360 5:29304752-29304774 CCATTGGACAGGGACTAAGGAGG - Intergenic
988588738 5:32530533-32530555 CCACTGGACTGCAGCCTAGGTGG + Intergenic
998053882 5:139057439-139057461 CCAGTTGACAGGAAATGAGGAGG + Intronic
1000633250 5:163615114-163615136 CAAGTGGAATGGAAATTAGAAGG - Intergenic
1002531795 5:179851278-179851300 CCAGTTGACTGGACCAGAGGTGG + Intronic
1004111030 6:12719215-12719237 CCAGTGGACTGGAATCCAGCAGG + Intronic
1004167838 6:13272566-13272588 CAAGTGGACTGCAACTCAGACGG - Intronic
1013536365 6:111066543-111066565 ACAGAGCACTGGGACTTAGGTGG - Intergenic
1015929897 6:138348821-138348843 CCACTGGCTTTGAACTTAGGAGG - Intergenic
1020449709 7:8307112-8307134 TTAGTGAACTGGAAGTTAGGCGG - Intergenic
1022254739 7:28644504-28644526 GCAGTGGAGTGGAACGTTGGGGG - Intronic
1024425472 7:49220780-49220802 TGAGAGGACTGGAATTTAGGGGG - Intergenic
1028160271 7:87476423-87476445 GCACTGGACTGGGACTCAGGAGG - Intronic
1033669090 7:143472624-143472646 CCAGGGGACTGGAGCGTTGGAGG - Intergenic
1034453193 7:151148942-151148964 CCTGGGGACTGGAGCTGAGGAGG - Exonic
1034934446 7:155189813-155189835 CCAGGTGACTGGAAGTTAGCTGG - Intergenic
1035322127 7:158038212-158038234 CCAGTGGAATAAAACTGAGGAGG + Intronic
1036066311 8:5384874-5384896 TCTGTTGACAGGAACTTAGGTGG + Intergenic
1036600564 8:10256798-10256820 CCACTGGGCTGAAACTCAGGGGG - Intronic
1044624522 8:94223771-94223793 CCAGTGGCCTGGGAGTGAGGGGG + Intergenic
1049228190 8:141467675-141467697 CCAGAGGAGTGGGGCTTAGGAGG - Intergenic
1051460489 9:17307625-17307647 CCAGTGGAGTGGAACTTTGGAGG + Intronic
1051511924 9:17887917-17887939 CCAGGGGACAGGAATTTGGGAGG - Intergenic
1052108902 9:24554882-24554904 CTGGTGGACAGGCACTTAGGGGG + Intergenic
1052999732 9:34571361-34571383 GCAGTGGCCTGGCACTGAGGCGG - Intronic
1055307222 9:74942391-74942413 CCACTGCACTCGAGCTTAGGTGG + Intergenic
1055569781 9:77604868-77604890 CCAGAGGACTGGAATGTTGGGGG - Intronic
1191867008 X:65712083-65712105 CCATTGGACTGGAATTTGAGGGG - Intronic
1202342955 Y:23888696-23888718 CCAGGGGTCTGGAGCATAGGAGG - Intergenic
1202527813 Y:25781389-25781411 CCAGGGGTCTGGAGCATAGGAGG + Intergenic