ID: 1130304095

View in Genome Browser
Species Human (GRCh38)
Location 15:82701193-82701215
Sequence AACTCTGCCCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130304095_1130304100 -4 Left 1130304095 15:82701193-82701215 CCCTCTTCCCTCTGGGCAGAGTT 0: 1
1: 0
2: 2
3: 29
4: 257
Right 1130304100 15:82701212-82701234 AGTTGGTCCTCCCTGCTCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130304095 Original CRISPR AACTCTGCCCAGAGGGAAGA GGG (reversed) Intronic
900703713 1:4063156-4063178 AGCTCTGCCCGGAGGAATGAAGG - Intergenic
901241301 1:7695297-7695319 AGCTCTGAGCAGAGAGAAGAGGG + Intronic
902942669 1:19811856-19811878 AACTTTGCCCAGGGGGACGGAGG + Intergenic
903429901 1:23287478-23287500 ATCTCTACCTAAAGGGAAGATGG - Intergenic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
903580497 1:24367060-24367082 TGCACTGCCCAGTGGGAAGACGG + Intronic
904967753 1:34391875-34391897 ACCACTGCCCAGAAGTAAGAAGG - Intergenic
905210959 1:36373961-36373983 GACTCAGCCCAGTGGGAAGTGGG + Intronic
905391313 1:37637280-37637302 AACTCTGTCCGCACGGAAGAAGG + Intergenic
905877080 1:41438842-41438864 GACTCAGCCCTGAGGCAAGATGG - Intergenic
906376164 1:45298609-45298631 AACTGTGACTAAAGGGAAGAGGG - Intronic
910668126 1:89746013-89746035 ATCTATGGCCAGAGGGAAGAGGG - Intronic
910806945 1:91197954-91197976 AACTCTGCCAAGGGGGCAGGGGG - Intergenic
910986880 1:93013914-93013936 AGTTCAGGCCAGAGGGAAGATGG - Intergenic
911432174 1:97804636-97804658 AACTCTCTCCAGAGAAAAGAGGG + Intronic
911510765 1:98805744-98805766 AAGTCTGCCCATAGTGAAGGAGG + Intergenic
912544637 1:110441829-110441851 TTCACTGCCCAGAGGGGAGATGG - Intergenic
913128669 1:115816919-115816941 ACCTGTGGCCAGAGGGAAGCAGG + Intergenic
914915877 1:151818915-151818937 AAGTCTGGCCTGAGGGATGATGG - Intronic
919559719 1:199101627-199101649 AACTCTGCCCAGAGTGCAGAGGG + Intergenic
920086909 1:203424046-203424068 AACTGAGCACAGAGGGAGGAAGG + Intergenic
921979581 1:221241244-221241266 AACTCAGCCCAGAGTCAAAATGG - Intergenic
922878532 1:228960825-228960847 GCCTCTGACCAGAGGGGAGAGGG + Intergenic
923268774 1:232336040-232336062 AACTCTACCCACAAGGCAGAGGG + Intergenic
924165130 1:241273199-241273221 AACTCAGCCTTGAGAGAAGAAGG - Intronic
924462795 1:244274388-244274410 AGCCCAGCCCGGAGGGAAGATGG - Intergenic
924617264 1:245622658-245622680 TACTCTGCACAGAAGGAAAATGG - Intronic
1065256045 10:23869237-23869259 GACTCTTTCCAGTGGGAAGATGG + Intronic
1070678244 10:78430243-78430265 GACTCTGCCTAGAGGAAGGAGGG + Intergenic
1070814970 10:79317275-79317297 GACTGTCCACAGAGGGAAGAAGG + Intergenic
1071593801 10:86902728-86902750 AACTCTGTTCAGGGAGAAGAAGG - Intronic
1073072871 10:100805896-100805918 AACTTCGCCCTGAGGGAGGAGGG - Intronic
1074500167 10:114016634-114016656 CAGTCTGCCCAGAGGTAAAATGG - Intergenic
1075403483 10:122177936-122177958 AAGTCTGCCAAGATCGAAGATGG + Intronic
1077107400 11:848160-848182 AGCTCTGCCCAGAGAGCAGATGG - Intronic
1077616171 11:3675700-3675722 AACTATCCACAGAAGGAAGAGGG - Exonic
1077735552 11:4786848-4786870 AACTGTGCTCAGAAGGAAGAAGG - Intronic
1078327190 11:10390173-10390195 AACTCTGGCCAAAGTGAAGAAGG + Intronic
1078383492 11:10865932-10865954 AACTCACCCCACAGGGAAAATGG - Intergenic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1080446925 11:32345984-32346006 CTCTCTGCCCACAGGGAAGGTGG - Intergenic
1080553590 11:33395868-33395890 TACTCAGCACAGAGGGCAGAAGG + Intergenic
1081613501 11:44577380-44577402 AAGTCTTCCCTGAGGGAAGAAGG - Intronic
1081818538 11:45968218-45968240 TTCTCTGCACAGAGGCAAGAAGG + Intronic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1081968603 11:47184121-47184143 GACCCTGCCCAGAGGCAGGAGGG - Intronic
1082108523 11:48245868-48245890 CACTCTGCCCATAGACAAGATGG + Exonic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083238649 11:61369280-61369302 TACTTGACCCAGAGGGAAGATGG + Exonic
1084417717 11:69043057-69043079 AACTGAGCCCAGAGGCAAGAAGG - Intergenic
1085565652 11:77511188-77511210 AGCTCTGCACACAGGGAAGGGGG + Intergenic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1087037059 11:93766353-93766375 CTCTCTTCCCAGAGGGAAAAGGG + Intronic
1087117169 11:94537831-94537853 AACTCTCTCCAGATGGAGGAAGG - Intergenic
1089932622 11:122329311-122329333 TACTTTGCAAAGAGGGAAGAGGG + Intergenic
1091322804 11:134663872-134663894 GCCTCTGCCCCTAGGGAAGAGGG - Intergenic
1091606549 12:1957999-1958021 AAGTCTGCCCAGAGCGACGTTGG - Intronic
1094396014 12:30006530-30006552 GACTCCACCCAGGGGGAAGACGG - Intergenic
1094441174 12:30478661-30478683 AATTCTCCCTAGAAGGAAGAGGG + Intergenic
1097973100 12:65656163-65656185 AACTCTGCCCAAAGGTTAGGAGG - Intergenic
1101316775 12:103635948-103635970 ATCTCAGCCTGGAGGGAAGAAGG + Intronic
1102113073 12:110380022-110380044 AACTCTGGCCCAAGGTAAGATGG + Intronic
1103500766 12:121400119-121400141 ATCACCGCCCAGAGGGAAGGAGG + Exonic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1104691446 12:130829462-130829484 CACTCTACCCTGGGGGAAGATGG + Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1106797459 13:33221510-33221532 AACCCAACTCAGAGGGAAGAGGG - Intronic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1108367839 13:49734679-49734701 AACTCTGCGCTGAGGTAACATGG - Intronic
1108701761 13:52949860-52949882 AGCCCTGCTCAGAGGGAGGAAGG + Intergenic
1109107656 13:58275904-58275926 AAATCTACCCAGAGGAAAGCAGG - Intergenic
1110539841 13:76695613-76695635 AACTCTGGATAGAGGGGAGAAGG + Intergenic
1110838825 13:80117441-80117463 AACCCTCACCAGAGGGAAAAGGG + Intergenic
1111549556 13:89788971-89788993 AGCTCTGCTCAGAGGGAAGTTGG + Intergenic
1113955506 13:114098268-114098290 AGCTCTGCCCCCAGGGTAGAGGG - Intronic
1115546250 14:34467055-34467077 CGCTCTGCCCAGAGAGGAGAAGG + Intergenic
1117199254 14:53371611-53371633 ATCTCCGCACAGAAGGAAGAAGG + Intergenic
1119537952 14:75418354-75418376 AACTCTGACCTGTGGGAAGAAGG + Intergenic
1119940520 14:78636305-78636327 AACTCTGCCCTTATGGAAGAAGG - Intronic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1121005376 14:90487323-90487345 GACCCTGCCCAGTGGGCAGAGGG + Intergenic
1121291215 14:92777140-92777162 CCTTCTGCCCAGAGGCAAGAAGG - Intergenic
1121330162 14:93044711-93044733 AACACGGCAGAGAGGGAAGAAGG + Intronic
1122697886 14:103566095-103566117 AACTCTAACCAGAAAGAAGATGG - Intronic
1202860178 14_GL000225v1_random:76781-76803 AGCTCTGCCCAGAGGGACATTGG + Intergenic
1124148257 15:27151714-27151736 AACTCAACCCAAATGGAAGAAGG + Intronic
1124438463 15:29670300-29670322 CACTCTGCCTAGAAGTAAGATGG + Intergenic
1127582777 15:60352803-60352825 AAATGTGCCCAAAGGGAGGAGGG - Intronic
1128498297 15:68210592-68210614 AACTGAGGCCAGAGGGAGGAGGG - Intronic
1128687442 15:69697214-69697236 ACCGCTGCCCAGAAGGATGAAGG + Intergenic
1129140260 15:73591541-73591563 AAATCTACCCAGTGGAAAGATGG + Intronic
1129711618 15:77823139-77823161 CACTCTGCCAAGAGTAAAGAGGG - Intergenic
1130304095 15:82701193-82701215 AACTCTGCCCAGAGGGAAGAGGG - Intronic
1131232140 15:90667067-90667089 AGCTCTGCACAGCGGGGAGAGGG - Intergenic
1131513772 15:93064244-93064266 AACTCTGCCCTGAGACAGGATGG - Intronic
1132107273 15:99072043-99072065 AACCCTGTCCAGAGGGGAGTTGG - Intergenic
1132293274 15:100717972-100717994 AGCTTTCCCCAGAGGGAAGAGGG + Intergenic
1134063439 16:11212381-11212403 CGCACTGCCCAGAGGGCAGAAGG + Intergenic
1134327759 16:13222420-13222442 AATTCTGGCCTGGGGGAAGAGGG + Intronic
1134847515 16:17452525-17452547 AACTGTGCCCAGAGGAAAACTGG - Intronic
1138077075 16:54053154-54053176 ATCTCTGCAGAGAGGAAAGATGG - Intronic
1138078882 16:54069756-54069778 ATCTCTGCCCCAAGGGAAGTGGG + Intronic
1138133108 16:54499105-54499127 GCCTTTGCCCAGAGGGAAGCTGG - Intergenic
1138423219 16:56913264-56913286 CACTTTGCCCATAGGGAGGAAGG + Exonic
1138556933 16:57776248-57776270 AACTCAGCCCAGAGGCCAGCGGG + Intronic
1139715736 16:68811591-68811613 AATTCTGCCCTGAGGGATAAAGG - Intronic
1142138952 16:88464106-88464128 ACCTCTGTCCACTGGGAAGAAGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142899737 17:3004538-3004560 ACCTCTGTGCAGAGGGAAGGCGG + Intronic
1143970138 17:10789481-10789503 TCCTGTGCCCAGAGAGAAGATGG + Intergenic
1146646929 17:34581960-34581982 AAATCAGACCAGAGGGAAGGAGG + Intronic
1146986145 17:37220356-37220378 ATCACTGCCCAAAGGGAAGCAGG + Intronic
1147445832 17:40474807-40474829 AGCTCAGCCCAGAGAGAAGGAGG + Intergenic
1148206499 17:45783452-45783474 AACGCTGCCCAGGGGAAAGCCGG - Intergenic
1148243089 17:46012781-46012803 CACCCAGGCCAGAGGGAAGAGGG + Intronic
1150439570 17:65180181-65180203 TAATCTGCCCTGAGAGAAGAGGG + Intronic
1150584519 17:66505317-66505339 ACCTCTGGCCACAGGGAAGAGGG + Intronic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1151179340 17:72314840-72314862 TACTCTGCCCACAAGGAAGCAGG - Intergenic
1152408584 17:80110892-80110914 GACTCTGCCCAGAGTGAGGAGGG - Intergenic
1153820640 18:8828657-8828679 CCATCTGCCCAGAGAGAAGAAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155760117 18:29554647-29554669 AACACTCCACAGAGGGAAAACGG - Intergenic
1157433139 18:47646571-47646593 AACTCTGCCCACTTGAAAGAAGG + Intergenic
1158187147 18:54783730-54783752 GCCTATGCCCAGAGGGAAGCAGG - Intronic
1160062355 18:75544105-75544127 AACTCTGCCCAGAGGCAGCACGG + Intergenic
1160863752 19:1248526-1248548 AACTCCACCCCGAGGGAAGGCGG + Intergenic
1161671403 19:5613183-5613205 AACTCTTCCCAGAGGTCTGACGG - Intronic
1163368062 19:16887416-16887438 CACTCTGCTCACAGAGAAGACGG + Intergenic
1164826668 19:31289353-31289375 AAGGCTGCCCAGAGTGAGGAGGG - Intronic
1165825755 19:38704915-38704937 ATCTCTGCACACAGGGAAGGGGG - Exonic
1166747994 19:45151068-45151090 GGCTCTGCCCAGAGGGAAAGTGG + Exonic
1166840132 19:45692296-45692318 AACGCGTCCCAGAGGGAAGAGGG - Exonic
1168297950 19:55386830-55386852 AAGTCGGCCGAGAGGGAAGCCGG - Intronic
926730259 2:16030882-16030904 GGCTCTTCCCCGAGGGAAGAAGG - Intergenic
926923066 2:17958563-17958585 AACTCTGCCAAGGAGGAAAATGG + Intronic
928342412 2:30456249-30456271 ACCTCCGCCCAGGGGTAAGAAGG - Intronic
928448432 2:31354130-31354152 ATCTCTGCCCAGAAGTAAGAAGG + Intronic
929031328 2:37652295-37652317 CGTTCTGCCCAGAAGGAAGAAGG + Intronic
930033495 2:47072048-47072070 AACACGGCCCACAGGGAGGAGGG - Intronic
930062395 2:47301002-47301024 AACCCTGCCCAAAGTGAACATGG - Intergenic
931135467 2:59394980-59395002 AACTCTGCCCAAGTGGAAAAAGG - Intergenic
931492219 2:62760605-62760627 AACTCTGCCCAGTTGTTAGACGG + Intronic
931721577 2:65070928-65070950 AACTCACCCCCGAGGGAAGCAGG - Intronic
932138365 2:69252014-69252036 AATTCTGCCCAGAGTGGGGAAGG - Intergenic
932221988 2:70006584-70006606 AGTCCAGCCCAGAGGGAAGAGGG + Intergenic
932368213 2:71166619-71166641 AACTGGGCCTAGAGGGAAGGGGG - Intergenic
932568827 2:72925997-72926019 AACACTGCCAGGAGGGAAAAGGG - Intronic
936075189 2:109397259-109397281 AGATCTGCCCAGAGGGCAGCTGG + Intronic
936870642 2:117131530-117131552 AAGTTTGCCCACAGTGAAGAAGG - Intergenic
937631425 2:124106412-124106434 ACCTCTGGGCAGAGGAAAGAGGG + Intronic
938728797 2:134130149-134130171 AGCCCTGCCCCGCGGGAAGATGG - Intronic
939171005 2:138695391-138695413 AACTCTGCCGAGAGGAACAAAGG + Intronic
944871217 2:203914070-203914092 AACTTTGGCCAGAGGGAGGGAGG - Intergenic
946869330 2:224071783-224071805 AAGGCTGCACAGTGGGAAGAAGG - Intergenic
948924238 2:241083642-241083664 AACTAAGCACAGCGGGAAGATGG - Intronic
949050164 2:241893495-241893517 CACACTGCCCAGAGGCCAGACGG - Intergenic
1168808643 20:688539-688561 AACCCAGCCCAGAGGGATCAGGG + Intergenic
1169912622 20:10659663-10659685 TCCTCTGCCCAGAAGGCAGATGG + Intronic
1173228676 20:41177326-41177348 AAGACTGCCCTGCGGGAAGATGG + Intronic
1173878498 20:46392556-46392578 AACTCTGTCCAGAAGGAAACTGG - Intronic
1173892766 20:46526168-46526190 AACTCAGCCCAATGGGTAGAAGG - Intergenic
1175367846 20:58467713-58467735 AGCCCAGCCCAGAGGGGAGAGGG - Intronic
1175642175 20:60639936-60639958 AACTTTGCCCAGAGAAAAGACGG - Intergenic
1175786203 20:61713116-61713138 ACATCTGCCCAGAGAGAGGAGGG - Intronic
1178279329 21:31267249-31267271 GTCTCTGCCCAGAGAGAAGATGG + Intronic
1178580868 21:33837050-33837072 ATCACTGCCCAGAGGGATGATGG + Intronic
1179899672 21:44382941-44382963 AACCCTGGCCAGAGGGCAGCTGG + Intronic
1180182047 21:46122424-46122446 AAAGCTGCCCAGAGGGAGGAAGG + Intronic
1181182100 22:21075576-21075598 AGCTCTGCCCAGATGGGAAATGG - Intergenic
1181545325 22:23599199-23599221 AACAGGGCCCAGAGGGAACAAGG - Intergenic
1182379346 22:29873544-29873566 ACCTCTTCCTAGAGGGATGATGG + Intergenic
1182678963 22:32063389-32063411 AACCCTGCCATGAGAGAAGACGG + Intronic
1184231982 22:43163267-43163289 ACCCCTGGCCACAGGGAAGAGGG + Intergenic
1184726504 22:46350375-46350397 TAATCCCCCCAGAGGGAAGATGG - Exonic
1185105189 22:48864956-48864978 ACCTGTCCCAAGAGGGAAGAAGG - Intergenic
1185274341 22:49943885-49943907 CACGCTACCCAGAAGGAAGAAGG + Intergenic
950634106 3:14303101-14303123 GACTCAGCCCAGAGGAGAGAGGG - Intergenic
951638768 3:24810698-24810720 AATTCTGCCCAGAGTGATAATGG - Intergenic
951777598 3:26326459-26326481 TAGTCTGCCCCTAGGGAAGAGGG + Intergenic
952235485 3:31474840-31474862 ATCTCTACCCAGAGGAAAGAGGG - Intergenic
952862754 3:37828299-37828321 AATGCTGCACAGAGGGATGATGG - Intergenic
955865825 3:63382790-63382812 AAAACAGCACAGAGGGAAGATGG - Intronic
956376281 3:68616716-68616738 AACTCTACACAAAGGGGAGATGG + Intergenic
958636156 3:96750137-96750159 AGCCCTGCCCAGAGGGATGGGGG - Intergenic
959598904 3:108157103-108157125 AGCTCTCCCCAGAGGTCAGAGGG - Intergenic
960993212 3:123325056-123325078 AGCTCTGCCAAGAGGGAGGGAGG + Intronic
961369730 3:126422123-126422145 CACTCAGCCAAGAGGGAACATGG + Intronic
962041771 3:131714798-131714820 ACCACTGCCCTGAGAGAAGATGG + Intronic
962652192 3:137507890-137507912 CACTCTGCCCAGAGGTGATAAGG - Intergenic
965862129 3:173160401-173160423 AAGGCTGCCCATAGTGAAGAAGG + Intergenic
966113201 3:176428613-176428635 GACACTGCCCAAAGAGAAGAGGG + Intergenic
966476650 3:180356438-180356460 AACTCTGGTCAAAGGGAAAAAGG - Intergenic
967109459 3:186280816-186280838 AATTAAGCCCAGTGGGAAGAGGG + Intronic
967268882 3:187716767-187716789 AGCTCTGTCCAGATGGAAGGAGG + Intronic
968481000 4:833008-833030 AACTCAGCTCAGAGAGAAGCGGG - Intergenic
969260547 4:6030613-6030635 AACTCTGCCCAGCGGGCTGCTGG + Intronic
969940193 4:10724362-10724384 AATTCTGAGCATAGGGAAGACGG - Intergenic
972214412 4:36879248-36879270 AAATCTGCCCGGAGGGAACAGGG + Intergenic
973339775 4:48992394-48992416 AGCTCTGACCAGGGGAAAGAAGG - Intronic
974207765 4:58728649-58728671 AAATCTTCCCAGTGGGAGGAAGG + Intergenic
974474828 4:62365343-62365365 AACCTTGGCCAGAAGGAAGATGG + Intergenic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
978305684 4:107325862-107325884 TACTTTGGACAGAGGGAAGAGGG + Intergenic
978317222 4:107451811-107451833 CACCCTGCCCAGTGGGAATATGG - Intergenic
980478679 4:133356372-133356394 TCATCAGCCCAGAGGGAAGATGG - Intergenic
980914597 4:139022369-139022391 AACAGTGCCCAGGGGAAAGAAGG + Intronic
982464967 4:155718816-155718838 AAGTCTGCCCAGAAGAGAGAGGG + Intronic
985341543 4:188959900-188959922 TACTCTGCCCAGAGGAAAGAGGG + Intergenic
986735438 5:10664404-10664426 ATCACTGCCCAGAGGGATGATGG - Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
988567360 5:32330040-32330062 AATTCAGCCCAAAGGGGAGAGGG - Intergenic
989401134 5:41008843-41008865 AAATCAGCCCAGAGAGAAGATGG - Intronic
992907330 5:81359155-81359177 ACCACTGCCAAGAGGGCAGAAGG - Intronic
993683498 5:90909074-90909096 AACACTGTCCAGAGAAAAGATGG - Intronic
994546374 5:101171860-101171882 AACTCTACCAAGATGGAACAAGG + Intergenic
996582520 5:125047605-125047627 CACTCTGCCCTCAGGGAAGGAGG + Intergenic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
998490506 5:142542363-142542385 AACTGTGACGAGAGGGAGGAAGG - Intergenic
1002025166 5:176391972-176391994 AACTCTGCTGAAGGGGAAGAAGG + Intronic
1002567425 5:180119731-180119753 AGCTGGGCCCAGAGGGAGGAGGG - Intronic
1003692121 6:8365148-8365170 ATCTCTGTGCAGAGGGAGGATGG - Intergenic
1005967170 6:30734943-30734965 TCATCTGCTCAGAGGGAAGAAGG + Intronic
1006914620 6:37586226-37586248 AACTTGGCCCAGAGGGGAGAGGG + Intergenic
1007189805 6:40003779-40003801 AACCATGCCCAGAAGGAAGATGG - Intergenic
1007273353 6:40655523-40655545 ACCTGTGTCCAGAGGGAAAAGGG + Intergenic
1007585640 6:42987466-42987488 AACACTGTGCTGAGGGAAGAGGG + Intronic
1007998774 6:46336775-46336797 AACTCTTGCCAGAGGCAATAGGG + Intronic
1008465840 6:51829662-51829684 AACTGTGCCCAGAGACACGAGGG - Intronic
1011958796 6:93059882-93059904 ATCTCTTCCCAGAAGGAATATGG - Intergenic
1013599291 6:111689457-111689479 AACACAGCCCAGAGAGATGAGGG + Intronic
1015740625 6:136449746-136449768 GGCTCTGCCCATAGGGACGAAGG + Intronic
1016383434 6:143508657-143508679 AACCCTGCCCAAAGGCAGGAAGG - Intronic
1016471574 6:144380365-144380387 ATCTCTGGGCAGAGGGAAAATGG + Intronic
1018091069 6:160347694-160347716 AACTTTCCCCAGAGGGCAGCCGG - Intergenic
1022096593 7:27145162-27145184 ATCTCTGGCCAGTGGAAAGAGGG - Intronic
1023362763 7:39432708-39432730 CACTCTTCCCAGGTGGAAGAGGG + Intronic
1024306634 7:47934818-47934840 AACTCTGCTCACAGCTAAGAAGG + Intronic
1024373953 7:48617513-48617535 ACATCTGCCCAGAGGGAGAACGG + Intronic
1024884285 7:54124190-54124212 AAATCTTCCCAGTGGGCAGAAGG - Intergenic
1025120445 7:56297208-56297230 AACTCTTCCAAGAACGAAGAAGG - Intergenic
1025784430 7:64631717-64631739 GGTTCTGCCCACAGGGAAGACGG + Intergenic
1026847492 7:73706077-73706099 GACTCTGCCCCGAGAGAAGCCGG + Intronic
1029490546 7:100867892-100867914 AACACTGCTCAGATGGAAGGGGG - Exonic
1031408039 7:121408564-121408586 AAGACTGCCCAGAGGTAAGGTGG - Intergenic
1032120223 7:129150029-129150051 GTCCCTGCCCAGAGGGAAGTGGG - Intronic
1033474902 7:141682522-141682544 ATTTCAGCCCATAGGGAAGAAGG - Intronic
1033596563 7:142863612-142863634 ACCTCTGCCCAGAAATAAGAGGG - Exonic
1035232074 7:157471279-157471301 ACCTCAGACCAGAGGGAAGCCGG + Intergenic
1036455002 8:8898819-8898841 AAATCTGTCAAGATGGAAGAAGG - Intergenic
1036508914 8:9382437-9382459 AACTCTACCAAGAGGTCAGAGGG + Intergenic
1038864986 8:31429938-31429960 AACCCTGCCCAAAGTGAACATGG + Intergenic
1039464619 8:37775614-37775636 AACTCTTCTCAGAAGGAAAAGGG + Intronic
1040946744 8:52892943-52892965 GAAGCTGCCCAGCGGGAAGATGG + Intergenic
1041118264 8:54561292-54561314 AACTCTGGCCAAAAAGAAGAAGG - Intergenic
1041360158 8:57044694-57044716 AACTCTGCCTTTAGGGAACATGG + Intergenic
1041570907 8:59336085-59336107 AACTCTAGCCAGAGGGTAAAGGG + Intergenic
1042049496 8:64688243-64688265 AGCTTTGCTCAGAGAGAAGATGG - Intronic
1042221282 8:66477314-66477336 GTCTCTGCCCTGTGGGAAGAAGG - Intronic
1047211719 8:122845968-122845990 ATCACTGCCCAGAGTGGAGAAGG + Intronic
1048510855 8:135060873-135060895 AACTCTGCCCTGAGACAAAATGG - Intergenic
1048518725 8:135134744-135134766 AAAACTGCCATGAGGGAAGAGGG - Intergenic
1050097577 9:2082929-2082951 AAATCTGTCAAGAGGGAACAGGG - Intronic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1050775684 9:9257224-9257246 AACTCTGAGCAGAAGGAAGGAGG + Intronic
1051740897 9:20251062-20251084 GACTCAGCCCATAGAGAAGAAGG + Intergenic
1052283464 9:26758354-26758376 AGCACAGCCCAGTGGGAAGAAGG + Intergenic
1052331319 9:27271758-27271780 AAGTCATCCAAGAGGGAAGAAGG + Intergenic
1052655405 9:31352745-31352767 AACTCTGTCAAGAAGAAAGAAGG - Intergenic
1055702292 9:78958414-78958436 AGCTCTGACCTGAGGGAAGGAGG - Intergenic
1057963775 9:99482698-99482720 AACTAGGTCCAGAGAGAAGAAGG + Intergenic
1059426376 9:114223334-114223356 AATTCTGCTCAGAGGGAGGCTGG + Intronic
1060094622 9:120776963-120776985 AACTCTGCCCAGGGGTATCAGGG + Intronic
1060398236 9:123331460-123331482 AACCCTGCTCAGAGGTCAGACGG + Intergenic
1060855735 9:126914297-126914319 AACTCTGCCCAGCTGTAAAATGG + Intergenic
1061013909 9:127971150-127971172 AACCCTGCCCAGAGAGGAGGTGG - Intronic
1061040380 9:128138242-128138264 AGCACAGCCCAGAGGGCAGAGGG + Intergenic
1061906680 9:133702713-133702735 ATCTCGGCACAGAGGGAGGAGGG + Intronic
1061973980 9:134059216-134059238 GAAGCTGCTCAGAGGGAAGAGGG + Intronic
1186474597 X:9847525-9847547 AACTCTAATCAGAGGGAAAAGGG + Intronic
1189408053 X:40743614-40743636 ACCTCTACCCAGATGGACGAAGG + Intergenic
1189993208 X:46613832-46613854 CACTCTACCCAGAGGGCAGGTGG + Intronic
1192093095 X:68181947-68181969 AACTCTGGCCAGAGGCTAGATGG + Intronic
1197719474 X:129735391-129735413 AATTCTGCCCTGAGGGCAGTGGG + Intergenic
1198229604 X:134676447-134676469 AACTGTCTCCTGAGGGAAGAGGG + Intronic
1198711514 X:139509161-139509183 AAATCTGGCCAGTGTGAAGAAGG + Intergenic
1199612914 X:149632746-149632768 AAATCTGCCCAAAGTGAAGATGG - Intergenic
1201863795 Y:18627816-18627838 AAGTATGCCCAGTGGGAAAAAGG + Intergenic
1201869527 Y:18692562-18692584 AAGTATGCCCAGTGGGAAAAAGG - Intergenic