ID: 1130311677

View in Genome Browser
Species Human (GRCh38)
Location 15:82761453-82761475
Sequence TTACTTAAAAAGATGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130311670_1130311677 15 Left 1130311670 15:82761415-82761437 CCAGAATTAGCCATAACTACTAA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1130311677 15:82761453-82761475 TTACTTAAAAAGATGGAACTGGG 0: 1
1: 0
2: 1
3: 22
4: 358
1130311672_1130311677 -9 Left 1130311672 15:82761439-82761461 CCTCTTGCCCACATTTACTTAAA 0: 1
1: 0
2: 2
3: 17
4: 242
Right 1130311677 15:82761453-82761475 TTACTTAAAAAGATGGAACTGGG 0: 1
1: 0
2: 1
3: 22
4: 358
1130311671_1130311677 5 Left 1130311671 15:82761425-82761447 CCATAACTACTAAGCCTCTTGCC 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1130311677 15:82761453-82761475 TTACTTAAAAAGATGGAACTGGG 0: 1
1: 0
2: 1
3: 22
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130311677 Original CRISPR TTACTTAAAAAGATGGAACT GGG Intronic
900942337 1:5807989-5808011 ATACTTAATAAAATGGAAGTTGG + Intergenic
901622467 1:10599764-10599786 TAACTTAAAAAAATAGAAGTGGG - Intronic
906321261 1:44818392-44818414 TTACTTAAAGCCATGGAAGTAGG + Intergenic
906995121 1:50784937-50784959 TTTCTTCAAAAAATGGTACTGGG + Intronic
907116513 1:51973143-51973165 TTACTTAAAGGGATGTAAGTTGG - Intronic
907790501 1:57658995-57659017 TTGCTTAAAGGGATGGGACTGGG - Intronic
908187404 1:61665695-61665717 TTATTTTAAAAGGTGGGACTGGG - Intergenic
908676284 1:66607740-66607762 CTACTTAAAAAGTTAGCACTTGG + Intronic
910344276 1:86217698-86217720 GTACTTCAAAAGATTGAACTAGG - Intergenic
911698736 1:100925680-100925702 TTACTAAAAGAGAGGGGACTGGG + Intronic
912545089 1:110445065-110445087 TTAATTAAAAAAATGGAGATAGG + Intergenic
913307269 1:117443761-117443783 TTACTTAAAAAGTTTTAAATAGG - Intronic
913613543 1:120532171-120532193 TTATTTAAAAAAATGGAAAATGG - Intergenic
914577529 1:148989080-148989102 TTATTTAAAAAAATGGAAAATGG + Intronic
915761783 1:158320711-158320733 TTTCTTGAAAAAATGGAAATGGG - Intergenic
916340423 1:163727618-163727640 TTACTTAAAGTGTTTGAACTGGG + Intergenic
917300924 1:173573495-173573517 GTAATGAAAAATATGGAACTGGG - Intronic
917874391 1:179272415-179272437 TTACTTGGTAAGATGGAAGTAGG + Intergenic
918216290 1:182394259-182394281 TTACTTAAAATGATGAAATTAGG + Intergenic
918530634 1:185517252-185517274 TTACTTCAAAATATGGATTTAGG + Intergenic
918732483 1:188015363-188015385 TTACTTAAAATAATTGAGCTTGG + Intergenic
918893274 1:190304532-190304554 TTTCTTCAAAAAATGGCACTGGG + Intronic
920330119 1:205201202-205201224 TTATTTAAAAATATACAACTGGG - Intronic
920332914 1:205224194-205224216 TTACTTAAACATATGGAATATGG + Intergenic
921339474 1:214120374-214120396 TTTCTTAAAATGAGGGAACTGGG - Intergenic
924061436 1:240178988-240179010 TAACTTAAAAGCATGGAGCTTGG + Intronic
1062765746 10:63556-63578 TTACTTAAAAAAATTGATCAAGG - Intergenic
1062847567 10:719328-719350 TTACTTAAAAAAATAGAATTGGG + Intergenic
1063940587 10:11124403-11124425 TTCCTAATAAAGATGGAAATGGG + Intronic
1064700011 10:18009062-18009084 TTAATTAAAAAAATGTAAATGGG + Intronic
1066083925 10:31958830-31958852 TTATTTAAAAAGAAGGATGTTGG - Intergenic
1066682123 10:37944501-37944523 TTACTGAACAACCTGGAACTTGG - Intergenic
1066750341 10:38649476-38649498 TTACTTAAAAAAATGTAAGGCGG + Intergenic
1068359286 10:55954660-55954682 TTACTTCAACAGAGGGAACAAGG - Intergenic
1068918533 10:62459636-62459658 TTACTTAAATGAATGGAACATGG + Intronic
1069402305 10:68062053-68062075 TTACTTAACAGGTTAGAACTGGG + Intronic
1071205882 10:83277043-83277065 TTCCTTAAAAAGAAGGAATTTGG + Intergenic
1071817241 10:89245583-89245605 TAACTTAAAAACATTGAAATGGG - Intronic
1074518015 10:114189361-114189383 TTACTTGAAAAGATGGACACTGG + Intronic
1074847505 10:117411159-117411181 TTACTTAAAAATAGGTAAATGGG + Intergenic
1075355731 10:121772646-121772668 TTACTGAAAGATATGGAGCTTGG - Intronic
1076249250 10:128972284-128972306 TTACATATAAAGAAGGATCTTGG - Intergenic
1078435067 11:11317904-11317926 TTACTGGCAAAGATGGGACTAGG - Intronic
1078621319 11:12911257-12911279 TTATTTAAAGAGAAGAAACTGGG + Intronic
1079247044 11:18760370-18760392 TTACTTTAAAAAGTGGCACTCGG + Intronic
1079951199 11:26807333-26807355 TTACATAAAAAAAGGAAACTTGG - Intergenic
1080913070 11:36625067-36625089 TTAGTTAAGAACATGGAAGTTGG + Intronic
1081142857 11:39524196-39524218 TTATTTAAAAATATAGAAATTGG - Intergenic
1085541058 11:77270146-77270168 TTACTTAAAAAGGAGGAAAAAGG + Intronic
1086648193 11:89251448-89251470 GTACTTAACAAGATGTATCTTGG - Intronic
1087461211 11:98450648-98450670 TGACTAAAAAAGATAAAACTGGG + Intergenic
1087883556 11:103448755-103448777 TTACTTAAAAACATGAACATGGG + Intronic
1087946584 11:104167306-104167328 TTAGTTAAAAAAATAGCACTGGG - Intergenic
1088091898 11:106050859-106050881 TTATTTAAAAAGAAAAAACTAGG + Intergenic
1088231731 11:107679923-107679945 TTAGTTAAAGAGCTGGAACTTGG + Intergenic
1088360627 11:108985398-108985420 TTAATTAAAAACAGGAAACTGGG - Intergenic
1088668434 11:112117984-112118006 TTTCCTAAAAAGATGGATGTGGG + Intronic
1089085562 11:115814283-115814305 TTGCTTGAAATGATGGAAGTTGG + Intergenic
1090157133 11:124451349-124451371 TAACCTACAAAGATTGAACTAGG + Intergenic
1091023420 11:132121472-132121494 TTACTTAAATAAATGGAGCTGGG - Intronic
1092550817 12:9497479-9497501 TTAATTAAAAAGGTTGAAATAGG - Intergenic
1092739910 12:11617932-11617954 TTAATTAAATAGATGTAAGTGGG + Intergenic
1092807531 12:12238894-12238916 TTACTTTAAAAAATTGAACATGG - Intronic
1092817746 12:12326087-12326109 TTACAGAACAAGATGGAAGTTGG + Exonic
1093314468 12:17631510-17631532 TAAGTTAAAAAGATGGTAATCGG + Intergenic
1093320919 12:17713827-17713849 TTCCTTTAAGATATGGAACTAGG - Intergenic
1093689609 12:22095111-22095133 TTACATAAAAAGAAGTAAATTGG + Intronic
1094113276 12:26883794-26883816 TAACTAAAAAAGATGGAAAGAGG + Intergenic
1094521002 12:31188894-31188916 TTAATTAAAAAGGTTGAAATAGG + Intergenic
1094758631 12:33501586-33501608 TTTCTTAAAAAAATGGTCCTGGG - Intergenic
1095265878 12:40156922-40156944 TTACTGAAAAAGATTCAACTGGG - Intergenic
1095503614 12:42868087-42868109 TAAATTAAAAACATGGAAATGGG + Intergenic
1095813032 12:46391397-46391419 CTACTTCAATAGCTGGAACTGGG + Intergenic
1096445101 12:51682596-51682618 TTAGGTAATGAGATGGAACTTGG + Intronic
1097633324 12:62091154-62091176 TTAGATGAAAAGCTGGAACTTGG - Intronic
1098123594 12:67267991-67268013 TTAATAAAACAGATGAAACTTGG - Intergenic
1098513613 12:71347944-71347966 CTACTTAAAAAAAAGAAACTAGG - Intronic
1098892907 12:76027861-76027883 TTGCTTAAAAAGATGCGCCTAGG - Exonic
1099028700 12:77497401-77497423 TTAGTAAAAAAGGTGGAAATAGG - Intergenic
1099166915 12:79318145-79318167 TTACTTAGAAAGATTGAAAAAGG + Intronic
1099199291 12:79656908-79656930 TGAATTGAAAAGATGGAAATGGG + Intronic
1099966389 12:89450505-89450527 TTAATTAAGAAGATTGACCTTGG - Intronic
1100425402 12:94480393-94480415 TTAATGAAAAAAATGGACCTAGG + Intergenic
1104225691 12:126830821-126830843 TTACACAAAAGGATAGAACTTGG - Intergenic
1105488660 13:20864244-20864266 TGATCTAAATAGATGGAACTGGG - Intronic
1105860320 13:24404380-24404402 TTCCCCAAAAAGATGGAATTTGG - Intergenic
1107343754 13:39437967-39437989 ATACCTAAAAATGTGGAACTGGG + Intronic
1107957233 13:45527325-45527347 TCACTAAGAAAGAAGGAACTGGG - Intronic
1108058929 13:46514030-46514052 TTACTTGAAAATTTGAAACTTGG - Intergenic
1108133552 13:47330424-47330446 TTGCTTAAAAACATGGATGTGGG + Intergenic
1108364943 13:49701237-49701259 TAACTTAAAAACAAGAAACTTGG - Exonic
1108443413 13:50479709-50479731 TTTCTTAAAAAAATAGAATTTGG - Intronic
1108629008 13:52262556-52262578 TTACCCATAAAGATGGAATTGGG + Intergenic
1108657047 13:52543920-52543942 TTACCCATAAAGATGGAATTGGG - Intergenic
1109094655 13:58097407-58097429 TTACTGAAACTGAGGGAACTAGG - Intergenic
1110639786 13:77809521-77809543 TCACTTAAAAATGTGGAAATGGG + Intergenic
1110917280 13:81037558-81037580 CTACTTATAAAGATTGAACCAGG + Intergenic
1111650416 13:91083618-91083640 TTAATTAAATAAATGGATCTTGG + Intergenic
1111805942 13:93040659-93040681 GTACTTTAACAGCTGGAACTGGG + Intergenic
1111922979 13:94431869-94431891 TCACTTAAAAACATGGAATATGG + Intergenic
1112639166 13:101253720-101253742 TTATTTACAAAAATGGATCTTGG - Intronic
1114442106 14:22757146-22757168 TTATTTAAAATGATGAAAATTGG - Intergenic
1115172161 14:30521085-30521107 TTACTGAAAATGATGGAAATAGG - Intergenic
1115175876 14:30560908-30560930 TTGATTAAAGACATGGAACTGGG + Intronic
1115732905 14:36290789-36290811 TTTCTTGAAAAGAAGCAACTGGG + Intergenic
1116170651 14:41397512-41397534 TTACTTATTAAGAAGGAACCTGG - Intergenic
1116174473 14:41450000-41450022 TTACTTAACCAGAGGGCACTTGG + Intergenic
1116932750 14:50705811-50705833 TGACTTATAAAGATGGAAAAAGG + Intergenic
1118431737 14:65726297-65726319 TCACTTAAAAATATGCAAGTTGG + Intronic
1120065555 14:80037167-80037189 TTTCTTTAAAAAATGGTACTGGG + Intergenic
1120232146 14:81851453-81851475 TTATTTTAAACCATGGAACTAGG + Intergenic
1121439247 14:93938538-93938560 TTACTTTAAAAGTCAGAACTTGG - Intronic
1121480459 14:94265700-94265722 TTACTGAAAATGATGGTAGTTGG + Intronic
1121488438 14:94340001-94340023 ATACTTCAAAAGATGCTACTAGG - Intergenic
1124232701 15:27959239-27959261 TTACTAAAATAAAAGGAACTTGG + Intronic
1125099796 15:35899143-35899165 TTTTTTAAAAAGATGCACCTTGG + Intergenic
1126548509 15:49900744-49900766 TTAATTAAAATAATGCAACTGGG - Intronic
1128016738 15:64355155-64355177 TTATTTAAAAAGAATGGACTGGG - Intronic
1128283304 15:66415223-66415245 TTGCTTAAAAAGATGACACAGGG - Intronic
1129335018 15:74846770-74846792 TTAATTAAAAAGGTAGCACTGGG + Intronic
1130311677 15:82761453-82761475 TTACTTAAAAAGATGGAACTGGG + Intronic
1130461493 15:84161146-84161168 TTACTAAAAAATATTAAACTCGG + Intergenic
1131700125 15:94926331-94926353 TTACTTACAAATATGGCATTTGG - Intergenic
1133145695 16:3784753-3784775 TTAGTTAAGTAGATGGCACTTGG - Intronic
1133632920 16:7638865-7638887 TTACTTAAAAGGACAGAACATGG + Intronic
1136732370 16:32427599-32427621 TTACTTAAAAAAATGTAAAGGGG - Intergenic
1137414357 16:48259948-48259970 TTATTTAAAAAGTAGGAATTAGG + Intronic
1137576807 16:49605306-49605328 TTATTGAATGAGATGGAACTTGG + Intronic
1138119895 16:54391618-54391640 TTGCTTAGAAAGAAGGAACAAGG + Intergenic
1138686061 16:58726851-58726873 TTTTTTAAAGAGATGGATCTCGG + Intronic
1138896546 16:61212432-61212454 TTACTGAAAAAGCAGTAACTAGG + Intergenic
1140313225 16:73868826-73868848 TGACATAAAAATATGGAGCTTGG - Intergenic
1203020711 16_KI270728v1_random:401985-402007 TTACTTAAAAAAATGTAAAGGGG + Intergenic
1203039046 16_KI270728v1_random:675143-675165 TTACTTAAAAAAATGTAAAGGGG + Intergenic
1143847476 17:9783668-9783690 TTACGTAAAAAGTGGGAGCTGGG + Intronic
1146116936 17:30149219-30149241 TTACTTAAAAAAATAGAGATGGG + Intronic
1146235782 17:31160570-31160592 TTACATAGGATGATGGAACTGGG + Intronic
1147013629 17:37472554-37472576 CTAATTAAAATGAAGGAACTGGG + Intronic
1149106062 17:52966873-52966895 TTATTTAAAAAAATGGTACTGGG - Intergenic
1149557280 17:57582893-57582915 TTGCTAAAAATGATGTAACTAGG - Intronic
1149729741 17:58933493-58933515 TTATTTAGAAAGATGGAAACAGG + Intronic
1149815929 17:59723912-59723934 TTATTTAAAAAAATGTAACAGGG + Intronic
1150736417 17:67744080-67744102 TTTTTTAAAAATATGTAACTGGG + Exonic
1150899352 17:69254009-69254031 TTATTTAAAATGATGTAAATTGG - Intronic
1151050715 17:70975790-70975812 TTATTGATAAAGATGGAACATGG + Intergenic
1152958546 18:62901-62923 TTACTTAAAAAAATTGATCAAGG - Intronic
1153395479 18:4615644-4615666 TTTCTTAAAAAGAGAGAGCTTGG - Intergenic
1155457728 18:26038109-26038131 TTAATTAAAATGATGAGACTTGG + Intronic
1155650132 18:28131787-28131809 TAATTTAGAAAGATGGAAATGGG - Intronic
1155835088 18:30571503-30571525 TTACTTAAAAATCTGAAAGTTGG - Intergenic
1156415288 18:36881445-36881467 TTACTTAAAAAGAAAGAAGAAGG + Intronic
1156734814 18:40242756-40242778 ATACTTAAATAGATGGAATGTGG + Intergenic
1157893505 18:51441713-51441735 TTCCTGAAAAAGATGGCATTTGG - Intergenic
1158188805 18:54802021-54802043 TTACTCAACAAGATGGACCAAGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158616058 18:58988087-58988109 TTACTTAAAAATATGGAAGTAGG + Intergenic
1162328799 19:10014230-10014252 TTACTTACAAAGAGGCGACTGGG + Intronic
1162793463 19:13074767-13074789 TTTTTTAAAAATATGGGACTAGG + Intronic
1165909544 19:39216688-39216710 TGCCTCAAAAAGATGGATCTAGG + Intergenic
1166962898 19:46509989-46510011 TTGTTTAAAAAGATGATACTGGG + Intronic
1167457463 19:49604739-49604761 TTATATAAAAAGATAAAACTTGG - Intronic
1167816245 19:51883520-51883542 TTACCTAAAAAAATTGAACATGG - Intronic
1167950630 19:53024408-53024430 TTACCTAAAAATAGTGAACTAGG - Intergenic
928071632 2:28223125-28223147 TTACTTAATAACAGGGAAGTGGG - Intronic
928816944 2:35308175-35308197 ATACTTAAAATGAAGGAAATGGG - Intergenic
930197217 2:48521920-48521942 TTCCTGAAGAAGATGGAAGTTGG - Intergenic
930366093 2:50441348-50441370 TTATTTAAAAAGAAGGATCTGGG + Intronic
930670513 2:54145147-54145169 TTACTTTAAAAGTTTTAACTGGG - Intronic
931073939 2:58687962-58687984 TTGCTTAAAAAGCTGTAACCTGG - Intergenic
931312202 2:61092831-61092853 TCTCTTAAAAAAATGAAACTAGG + Intronic
933035226 2:77387770-77387792 TTACTTAAAAAGCAGGAAAACGG + Intronic
934313339 2:91891657-91891679 TTACTTAAAAAAATGTAAGGGGG + Intergenic
935081525 2:99801853-99801875 TTACAGAAAATAATGGAACTTGG - Intronic
935321422 2:101893143-101893165 TTTTTCAAAAAGATGGAACCAGG - Intronic
935485848 2:103652596-103652618 ATACTTAAAAATATAGAAGTAGG - Intergenic
938728575 2:134128388-134128410 CTACTTAACAAGCTGGTACTAGG - Intronic
938852109 2:135271974-135271996 TCACATAACAAAATGGAACTTGG + Intronic
938917189 2:135954055-135954077 TTAGTTTAAAAAATAGAACTGGG - Intronic
939296435 2:140271133-140271155 TTATTTAAAAAAATGTAACATGG - Intronic
939463080 2:142522703-142522725 TTGCTTAACAAGATGGATCGTGG - Intergenic
942210253 2:173663043-173663065 TTACTTAGAAAGAAAGAAATAGG - Intergenic
942566835 2:177273578-177273600 TTACTGAATCAGATTGAACTCGG - Intronic
942963110 2:181856294-181856316 TAACTTCAAAATATGGCACTAGG - Intergenic
943588866 2:189773430-189773452 TTACTTAAAAATCTGGAATATGG + Intronic
944243608 2:197509432-197509454 TTACTTCCAAGGATGGGACTGGG - Intronic
944859981 2:203806492-203806514 TTAGTTGAGAAGATGGAGCTGGG - Intergenic
945272170 2:207952012-207952034 TTACTTTAAGAGATGGAAAGTGG - Intronic
945463874 2:210144648-210144670 TTATTTAAAAAAAGGTAACTAGG - Intronic
945598350 2:211824497-211824519 TAACTTAAAAAGAAGTAATTTGG - Intronic
945932427 2:215868279-215868301 TCACTTTAAAAAATGGTACTGGG - Intergenic
946792593 2:223316365-223316387 TTACTTAAAAAAATTGAAATTGG + Intergenic
946960051 2:224975520-224975542 ATACTGAAAAAGATGAAACTGGG + Intronic
947122223 2:226828573-226828595 ATAATAAAAAAGATGGAATTAGG - Intergenic
948552355 2:238782108-238782130 AAACTTAAAAAGAAGAAACTTGG + Intergenic
1168905029 20:1396281-1396303 TGACTCTAAGAGATGGAACTGGG + Intergenic
1170407991 20:16059679-16059701 TCAGATAAAAAGATGGAACGTGG - Intergenic
1170795881 20:19546399-19546421 TTACTTTAAAAGATGGGAGAAGG - Intronic
1171814774 20:29775928-29775950 TTACTATAAAAAATGGAACAGGG + Intergenic
1174031812 20:47634750-47634772 TTACTGAAAAATATGTTACTAGG + Intronic
1174093645 20:48069972-48069994 TTGCTTCAAAAGATGGAAATTGG + Intergenic
1175682159 20:60996859-60996881 TTAAATAATAAGAAGGAACTTGG + Intergenic
1177658190 21:24047270-24047292 GTGCTTAAAAAGGAGGAACTGGG - Intergenic
1178519035 21:33271808-33271830 TTAGTTTAAAAGAAGGAAATGGG + Intronic
1178700675 21:34831095-34831117 TTATTTCAAAAGATAGAACAGGG - Intronic
1179220836 21:39405492-39405514 TAACTTAAAAACATGGAAGCAGG - Intronic
1179586952 21:42379461-42379483 TGGCTTAAAACGATGGAAATTGG - Intronic
1180540082 22:16437532-16437554 TTACTTAAAAAAATGTAAGGGGG + Intergenic
1181881509 22:25984052-25984074 TTACTTAGAAAGAAGGAAATAGG + Intronic
1182680153 22:32073276-32073298 TTTCTTCAAAAAATGGTACTGGG - Intronic
949664624 3:6322888-6322910 TTACTTCAAAAGAAGGGACTGGG - Intergenic
950595509 3:13977439-13977461 TTTCTTAAAAATCTGTAACTAGG - Intronic
950916125 3:16647027-16647049 TTACTTTAACAGAGGGCACTTGG + Intronic
952346145 3:32487878-32487900 TTCCTTAGAAATATGGAATTTGG - Intronic
952450113 3:33423589-33423611 GTACTGGAAAAGATGGAAATAGG + Intronic
956364315 3:68483400-68483422 TTAATGAAAAAGATGTAAATGGG - Intronic
956877416 3:73477353-73477375 TGAGTTAAGAAGATGGATCTTGG - Intronic
957182588 3:76899763-76899785 TGACTTAAAAAAATGGTACAAGG - Intronic
957195580 3:77062942-77062964 TTATTAAAAAAAATGTAACTGGG - Intronic
957252110 3:77785896-77785918 TTAATTCAGAAGATGGAAGTTGG - Intergenic
957480195 3:80782850-80782872 TCTCATAAAAAGATGAAACTTGG - Intergenic
958155900 3:89755454-89755476 TTTCTTAAAAAAATTTAACTTGG + Intergenic
959683189 3:109118819-109118841 TTGCTCCAAAAGATAGAACTAGG + Intergenic
960872048 3:122259858-122259880 TTACTTAAAAATATTGGACATGG + Intronic
961635989 3:128333071-128333093 TTACTTAATAAAATGTAAATCGG - Intronic
962028210 3:131571394-131571416 GTACTTATAAATATGGACCTAGG - Intronic
962053450 3:131843645-131843667 ATTTTTAAAAAGCTGGAACTAGG - Intronic
962553391 3:136520413-136520435 CTACTAAAAAAGATGTAATTTGG + Intronic
963238405 3:142978053-142978075 TTACTTATAAAGATCAAAGTAGG - Intronic
963928401 3:150976361-150976383 TGACATAAGAAAATGGAACTAGG + Intergenic
965398378 3:168188207-168188229 ATGCTTAAAAAGATGAGACTTGG - Intergenic
965430408 3:168580253-168580275 ATGCTTAAAAATATGGAATTTGG - Intergenic
965474971 3:169146293-169146315 TTACTTGGCAAGGTGGAACTCGG + Exonic
965491073 3:169337463-169337485 TGAGTTAAAAAGATGGAGGTTGG - Intronic
965665171 3:171085896-171085918 TTACTTTAAAAAATGAATCTTGG + Intronic
966601636 3:181781284-181781306 TTTCTTAAATACATAGAACTTGG - Intergenic
967003486 3:185360189-185360211 TTACTTATAATGATGGGACTTGG + Intronic
970146633 4:13042968-13042990 TTTCTTAAAAAGGTGGATTTGGG - Intergenic
970300707 4:14678903-14678925 TTCTTTAAAGAGAGGGAACTGGG - Intergenic
970547881 4:17148155-17148177 TGACTTATAAAGAAAGAACTTGG + Intergenic
970781032 4:19737916-19737938 TAACTTAGAGAGATGGAACCAGG + Intergenic
970795119 4:19902860-19902882 TTTCTGAAAAAGATGGCATTAGG - Intergenic
970903434 4:21186933-21186955 TTAAATAAAAAGATTGAGCTGGG - Intronic
972740892 4:41885056-41885078 TTACTGAGGAAGATGGAACATGG - Intergenic
973016250 4:45142385-45142407 TGATTTAAAAAGATAGATCTGGG + Intergenic
973144502 4:46807755-46807777 TTCCTTTAAAAGATGGTGCTGGG - Intronic
974812485 4:66962769-66962791 TTACTTAAAAAACTGGAATTAGG + Intergenic
975191429 4:71467333-71467355 TTAGTTAAGAACATGAAACTGGG - Intronic
976148339 4:82066516-82066538 TGACTAAGACAGATGGAACTGGG + Intergenic
976872053 4:89806857-89806879 TTCCTTAAAATGTTGGAATTTGG - Intronic
977091474 4:92681953-92681975 TTATTTAAAGAGAGGAAACTTGG + Intronic
977945541 4:102909698-102909720 TTACTTAAAAAAATGTAAGGGGG + Intronic
978603129 4:110449365-110449387 TTAATTAAAAATATGTATCTAGG + Intronic
980417624 4:132512597-132512619 CTACTGAAAAAGTAGGAACTTGG + Intergenic
981542156 4:145856911-145856933 TTGTTTAAAATGATAGAACTAGG + Intronic
981672671 4:147305121-147305143 TTTCCTAAACAGATGGAAATGGG - Intergenic
984166495 4:176308498-176308520 TCACTTAAAGAGTTGCAACTTGG - Intergenic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
984389812 4:179114767-179114789 TTAATTAAAGTAATGGAACTAGG - Intergenic
984544290 4:181081687-181081709 TAACTGAAAAAGATGGAGTTTGG + Intergenic
985698157 5:1353851-1353873 TTACTTAAAAAAAAGAAAATAGG - Intergenic
985770445 5:1806752-1806774 TTCCTCAAAAAGTTGAAACTAGG + Intronic
986495351 5:8336026-8336048 TAACTTAAAAATATTGAACATGG + Intergenic
986677189 5:10196312-10196334 TAACTTACAAAGATGAAACAGGG + Intergenic
987824903 5:23018446-23018468 CTCCTTAATAAGATGCAACTGGG - Intergenic
988156616 5:27460361-27460383 TTAATTAAAAAGTTGTAACTTGG - Intergenic
989671872 5:43927327-43927349 TTACTGAAAAAGCTGCTACTGGG + Intergenic
990136210 5:52646455-52646477 TTATTTAAAAAAATAGACCTTGG + Intergenic
990858009 5:60293229-60293251 ATACTTAAAAAGATGTAACGCGG + Intronic
990885389 5:60585676-60585698 TTAGTTCGAAAGAAGGAACTAGG + Intergenic
990930137 5:61079827-61079849 TAAGTTAAGAAGATGGAGCTGGG - Intronic
990955790 5:61336978-61337000 TTACATAAAGAGATGCAAATAGG + Intronic
992567811 5:78018118-78018140 TTACTTAAAAATATTTAATTTGG - Intronic
993091206 5:83428735-83428757 TTACTTTACATGATGTAACTAGG + Intergenic
993265304 5:85719539-85719561 TTAATTAGAATGATGGAACATGG + Intergenic
993300892 5:86208749-86208771 TTTCTTTAAAATATGCAACTTGG + Intergenic
993317275 5:86426858-86426880 TTAGTTAAATAGATGGAAAAAGG - Intergenic
993666795 5:90708388-90708410 TTACTTAAAATTATAGAATTTGG + Intronic
995301165 5:110585103-110585125 CTACTTAAGAAGAAGGAGCTGGG - Intronic
996711173 5:126545127-126545149 TGTCTTAAAAAGTTGTAACTTGG - Intronic
997011804 5:129887289-129887311 TTAGTTAAAAAGAAAAAACTGGG - Intergenic
997463888 5:134073702-134073724 TCATTTAAAAAGAAGGAAGTAGG + Intergenic
997493440 5:134299170-134299192 TTGTTTAAAAGGATGGAAATTGG - Intronic
998196722 5:140079929-140079951 TTCCTTTAAAAGGTGGAGCTTGG + Intergenic
998358972 5:141567670-141567692 TCACTAATAAAGATGCAACTGGG + Intronic
1000680483 5:164177901-164177923 TGACTTCTAAAGATGGGACTCGG + Intergenic
1000876922 5:166651456-166651478 TGACTGAAAAAAAGGGAACTGGG - Intergenic
1001279702 5:170377941-170377963 TCACAGAAAAAGATGGAAGTGGG - Exonic
1001320840 5:170680150-170680172 TTATTTAAGAAGAGGAAACTGGG + Intronic
1002353010 5:178598019-178598041 TTTCTTAAAAAGTTGTACCTGGG - Intergenic
1003334411 6:5156937-5156959 TCTCTTAAAAAGGTGGAATTGGG - Intronic
1004418764 6:15448946-15448968 TTACATAAAAAAATAGAACAAGG - Intronic
1004598251 6:17122159-17122181 TTATTTAAAAATTTAGAACTCGG - Intronic
1004602064 6:17159855-17159877 TTAATAAAAAAGAAGGACCTTGG + Intergenic
1010331933 6:74633460-74633482 TTAAATAAAAAGAAGGAACATGG - Intergenic
1011204949 6:84881854-84881876 TCACTTAAGAACATGGAAGTTGG + Intergenic
1011381762 6:86749846-86749868 TTTCTTAAAAAGCTGGATCAGGG + Intergenic
1012000323 6:93646541-93646563 TTACTTAAAGCAATGTAACTTGG + Intergenic
1012063632 6:94518111-94518133 TTAGTTAAAAAGATGTATCAAGG - Intergenic
1012919230 6:105203954-105203976 CTACTAAAAAAGATGAAAATTGG - Intergenic
1013564731 6:111346642-111346664 TTTTTTAAAAATTTGGAACTGGG - Intronic
1013958486 6:115868905-115868927 TTCCTTAACAAGCTGGAAGTTGG + Intergenic
1014034687 6:116752656-116752678 ATCCTTAACAAGTTGGAACTTGG - Exonic
1014737045 6:125105725-125105747 TGAAGTAAAAGGATGGAACTAGG + Intergenic
1016873061 6:148837980-148838002 TTCCATAAGAAGAGGGAACTTGG - Intronic
1016976712 6:149815876-149815898 TCAGTTAAAAAGATGAAGCTGGG - Intergenic
1017073597 6:150598711-150598733 TTACCTAAAACTATGGGACTGGG - Intergenic
1017528178 6:155261466-155261488 TTCCTTAAACAGATGAAAATGGG + Intronic
1018524554 6:164694265-164694287 TAACTTAGAAAGATGCAGCTGGG - Intergenic
1019932133 7:4230603-4230625 TTACTTAGGAAGATGGATCATGG + Intronic
1020612746 7:10421205-10421227 ATACTTAGAATCATGGAACTAGG + Intergenic
1021092313 7:16498120-16498142 TTAACTAAAAAGATCAAACTTGG - Intronic
1022770698 7:33469496-33469518 TTACTAAATAAGATGGAAAATGG + Intronic
1022904082 7:34838969-34838991 TTAATTAAAAACATGGAATTTGG - Intronic
1023232006 7:38042593-38042615 TTTAATAAAAAGAGGGAACTAGG + Intergenic
1023468899 7:40491534-40491556 ATACTTAGAAAAAGGGAACTAGG + Intronic
1024111991 7:46156518-46156540 TTCCTTAGAAAGATGGAAAATGG + Intergenic
1024120028 7:46227278-46227300 ATACTTAAAAAGATAGTACAGGG - Intergenic
1025927276 7:65970135-65970157 TTACTTAAAAAGATAGAGACAGG - Intronic
1026686771 7:72516942-72516964 TTACATTAAAAGATGAAATTTGG - Intergenic
1027531263 7:79336384-79336406 TTACTTATAAAAATAAAACTAGG + Intronic
1027850215 7:83442239-83442261 TTAATTAAAGAAATGGAAATAGG - Intronic
1028184988 7:87772888-87772910 TGACATAAAAAGTTGAAACTAGG + Intronic
1028294576 7:89112560-89112582 TTACATAAAAAGAAGAAAGTTGG - Intronic
1030459262 7:109810072-109810094 TCAATTAAAAAGCTGGGACTTGG - Intergenic
1030846576 7:114421603-114421625 TTACTTAAAATTATGTCACTTGG + Intronic
1030911633 7:115257325-115257347 TCAGTTAAAAAGAAGGAACGAGG + Intergenic
1031798974 7:126218565-126218587 TTTCTTAAAAAGAAGGTACATGG + Intergenic
1032598759 7:133270583-133270605 TTACAGAAAAAGATGAGACTAGG + Intronic
1033182549 7:139195195-139195217 TATCTTCAAATGATGGAACTGGG + Intergenic
1033988731 7:147257800-147257822 TTCATGAAAAATATGGAACTTGG + Intronic
1035919421 8:3661093-3661115 TTGCTTTAACAGATGGAACCCGG - Intronic
1038923026 8:32106748-32106770 TTTTTAAAAAAAATGGAACTGGG + Intronic
1038977250 8:32713678-32713700 TTTATTTAAAAGTTGGAACTAGG - Intronic
1039381483 8:37089672-37089694 TCGCTAAAAAAGATGTAACTTGG - Intergenic
1040707043 8:50141189-50141211 TTACTTAAATATATGGGAATAGG + Intronic
1041789702 8:61679612-61679634 TTTCTAAAAATGAGGGAACTTGG + Intronic
1042179614 8:66073365-66073387 TTCGTTAAAAAGATTGAAATAGG + Intronic
1043620686 8:82188661-82188683 TTATATAAAAATATAGAACTTGG - Intergenic
1044310454 8:90686507-90686529 TTACTTTAAAACATGGAAAAAGG - Intronic
1044513874 8:93116096-93116118 TCAGTTAAAGAGATGGAGCTGGG - Intergenic
1044685036 8:94818589-94818611 TTACTTAAAAAGTTGAATGTTGG + Intronic
1044867442 8:96586191-96586213 TTTTTTAAAAAGCTGGAATTCGG - Intronic
1046745596 8:117872553-117872575 TTACCTAAAAATATGGAATGTGG + Intronic
1046948055 8:119993048-119993070 TTACTTAAAAGGGGGGAAATTGG - Intronic
1046985601 8:120384497-120384519 TTACGGGAAAAGATGGAATTGGG + Intronic
1047180316 8:122581638-122581660 TTTCTTCAAAAGATGGTCCTTGG + Intergenic
1047182005 8:122597506-122597528 TTATTTAAAAATATGGGGCTGGG + Intergenic
1047922853 8:129653346-129653368 TTATTTCAAAAGCTGGATCTGGG - Intergenic
1048527684 8:135218340-135218362 TTAGTTAAAATGAGGAAACTAGG - Intergenic
1050623150 9:7475567-7475589 TTTTTTAAAAAAATGTAACTGGG + Intergenic
1051651857 9:19334426-19334448 TTACTCAAACAAATGGAACATGG + Intronic
1052050363 9:23840576-23840598 ATACTGAAAAAGATTTAACTAGG + Intergenic
1054829923 9:69612801-69612823 TTACTTCAAAATATGGATTTAGG + Intronic
1055443189 9:76356635-76356657 TTACTTTAGAAGAAGAAACTCGG + Intronic
1056779139 9:89536364-89536386 TTACATGAAAATATGGAAGTTGG + Intergenic
1057056750 9:91968286-91968308 TTAAATAAAAAGATGCAAATAGG + Intergenic
1059213091 9:112533142-112533164 TTACTTAAAATGGTGGAAAGTGG - Intronic
1059468627 9:114486206-114486228 TTTCTTAAAAAGAAGAAAGTTGG - Intronic
1061967861 9:134026023-134026045 TGACTGAAAAAGCTGGCACTGGG + Intergenic
1062739501 9:138160713-138160735 TTACTTAAAAAAATTGATCAAGG + Intergenic
1186189211 X:7052704-7052726 TTACTTTCACAGAGGGAACTTGG + Intronic
1186328371 X:8505282-8505304 TAACTTAAAAATATGGACATTGG - Intergenic
1186605600 X:11087065-11087087 TTAAATATAAAGATGGAAATAGG - Intergenic
1186735521 X:12459204-12459226 TTACTTAAAAAAAAGGATCCTGG - Intronic
1187355491 X:18566455-18566477 TTACTTAAAAAGAAAGTAATGGG - Intronic
1187416559 X:19098179-19098201 TTACTTCTAGAGATGGGACTAGG + Intronic
1188698028 X:33221122-33221144 TCATTTAAAACAATGGAACTGGG + Intronic
1189161544 X:38814134-38814156 GTCCTTTAAAAGATGGAAGTAGG + Intergenic
1189164169 X:38843553-38843575 TTACTTAAAAACAGAGAACTAGG - Intergenic
1190975410 X:55395476-55395498 TGAATAAAAAAGATGGAAGTAGG + Intergenic
1193721011 X:84987721-84987743 TAACTTAAAAAGCTGGGGCTGGG + Intergenic
1194554890 X:95344645-95344667 TTACATCAAAAGATGGCATTAGG - Intergenic
1194668175 X:96698440-96698462 CTAATTAAAAAGATAGCACTTGG - Intronic
1196325749 X:114400245-114400267 TTTCTTAAAAATTTTGAACTGGG + Intergenic
1197992160 X:132329896-132329918 TTCCTCAAAATGATGGCACTAGG - Intergenic
1198001001 X:132435719-132435741 TTCCTTAAAAAATGGGAACTGGG - Intronic
1198501615 X:137255117-137255139 TTACTGAAAAAGATAAAAGTTGG - Intergenic
1198635546 X:138695417-138695439 TTACTTAAAAAATTGGAATATGG + Intronic
1199667946 X:150116745-150116767 TTTTTTAAAAATATGTAACTGGG + Intergenic
1200375140 X:155772198-155772220 TTACTTGAAAAGATTTAATTTGG - Intronic
1200422609 Y:2987573-2987595 TTATTTAAAAATAAGGGACTGGG - Intergenic
1201067126 Y:10107699-10107721 TTACTTAAAAGAATTGAACAAGG + Intergenic