ID: 1130314399

View in Genome Browser
Species Human (GRCh38)
Location 15:82782639-82782661
Sequence CAGTGGAATCAAATGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130314391_1130314399 2 Left 1130314391 15:82782614-82782636 CCACAGCCTCCCCATCACGATCA 0: 1
1: 0
2: 4
3: 27
4: 355
Right 1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 185
1130314390_1130314399 20 Left 1130314390 15:82782596-82782618 CCATGCAGAGAGATTGGGCCACA 0: 1
1: 0
2: 1
3: 24
4: 196
Right 1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 185
1130314392_1130314399 -4 Left 1130314392 15:82782620-82782642 CCTCCCCATCACGATCATCCAGT 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 185
1130314396_1130314399 -9 Left 1130314396 15:82782625-82782647 CCATCACGATCATCCAGTGGAAT 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 185
1130314394_1130314399 -7 Left 1130314394 15:82782623-82782645 CCCCATCACGATCATCCAGTGGA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 185
1130314395_1130314399 -8 Left 1130314395 15:82782624-82782646 CCCATCACGATCATCCAGTGGAA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130314399 Original CRISPR CAGTGGAATCAAATGGATGC TGG Intronic
900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG + Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903189120 1:21646711-21646733 AAGTGTATTCAAATGGATGGTGG - Intronic
905521228 1:38602083-38602105 CAGTGGAATTACATGGCAGCAGG + Intergenic
905959611 1:42032756-42032778 CAGTGGCATGAAATGGGTCCAGG - Intronic
907749839 1:57252366-57252388 CAATGGAATCAAATAGACTCAGG - Intronic
908441594 1:64160655-64160677 TAGTGAAAGCAAATGGATGGGGG + Intronic
910212651 1:84809403-84809425 CACTGGAATCACATGCAGGCAGG - Intergenic
911061425 1:93751346-93751368 CAGGGGAACCAAATAGATGAGGG - Intronic
911259781 1:95671871-95671893 CAGTGGTCTCAAATGGATGCTGG - Intergenic
913690238 1:121272683-121272705 CATTAGAAACAAATGGATGGGGG + Intronic
914147302 1:145007276-145007298 CATTAGAAACAAATGGATGGGGG - Intronic
916205777 1:162315109-162315131 CCTTGGAATCACATGGATGATGG + Intronic
917021502 1:170593424-170593446 CAGTGTAATAAAATGCATTCAGG - Intergenic
918153238 1:181817311-181817333 CAGTGGAATCAAAGTGTGGCAGG + Intergenic
920119690 1:203647083-203647105 CAGTGGAATCCAATGATAGCAGG + Intronic
920477558 1:206291170-206291192 CATTAGAAACAAATGGATGGGGG + Intronic
924771300 1:247082239-247082261 CAGTGAGAACACATGGATGCAGG - Intergenic
1063254564 10:4312036-4312058 CAGGGGAATCCAGTGGCTGCTGG - Intergenic
1063999287 10:11649886-11649908 CAGTGGCATCAAAAGGACACAGG + Intergenic
1065865884 10:29915081-29915103 CAGTGGAATCAAAGGACAGCTGG - Intergenic
1066713990 10:38266781-38266803 CAGTGAGAACACATGGATGCAGG + Intergenic
1068616958 10:59129485-59129507 GAGTGCAATCACATGGAAGCAGG + Intergenic
1070819926 10:79348587-79348609 CCCTGGAACCAAATGGAAGCAGG - Intronic
1071175564 10:82922944-82922966 CATTGGAATCAACTGGATTTGGG - Intronic
1077269034 11:1666451-1666473 CAGTGGACTCATCAGGATGCCGG - Intergenic
1077271514 11:1684264-1684286 CAGTGGACTCATCAGGATGCCGG + Intergenic
1083518880 11:63288138-63288160 CAGTGAGAACACATGGATGCAGG + Intronic
1087219869 11:95535273-95535295 CAGTGGAAGGAAATGGGTGAAGG + Intergenic
1088569585 11:111209583-111209605 AAGTGGAATTAAATAAATGCTGG - Intergenic
1089213599 11:116822318-116822340 CAGTGGAATCAAGGGGAGGGAGG - Intronic
1091659503 12:2372893-2372915 CAATGGTAGCAGATGGATGCGGG + Intronic
1094371036 12:29737700-29737722 TGGTGGAATCAGATGGATGTGGG + Intronic
1098571557 12:71993222-71993244 CAGTTGAAGCAAATGAATGATGG - Intronic
1101038014 12:100724224-100724246 AAGTGGAATCAAAGGGACGCCGG + Intronic
1101265837 12:103086164-103086186 CAGTTGTCTCAAATGGATGTTGG - Intergenic
1106744554 13:32686149-32686171 CACTGTAATCAAAAGGAAGCTGG - Intronic
1107018586 13:35729126-35729148 CTGTGGAATCAGAAAGATGCAGG + Intergenic
1107818971 13:44269235-44269257 CAGAGGAATCCAATTGGTGCTGG + Intergenic
1108250046 13:48556192-48556214 CAGTTCAAACAACTGGATGCTGG - Intergenic
1109266968 13:60212453-60212475 CAGTGGTATCAACTGCATGTGGG - Intergenic
1110306332 13:73991673-73991695 AAGTGGAATCAAAAAGAGGCAGG - Intronic
1110373998 13:74771388-74771410 CAGTGTAATAAAATGAATTCAGG - Intergenic
1111665150 13:91257707-91257729 CAGGGGAATCAATTGAATCCAGG + Intergenic
1114485812 14:23061096-23061118 CAGTGGGAGCCAATAGATGCAGG + Exonic
1118074656 14:62284690-62284712 CAGTGGGAACACATGGATACAGG - Intergenic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1119924070 14:78474852-78474874 CACTGGACTAAAATGTATGCAGG - Intronic
1120697686 14:87662289-87662311 CAGTGGAAACAAATAAAAGCAGG + Intergenic
1120728436 14:87973807-87973829 CACTGGAATCCGATGGATGGAGG - Intronic
1121541925 14:94734144-94734166 CAGTGGATTCATCAGGATGCAGG - Intergenic
1124341687 15:28894091-28894113 TAGTGGAAACAAAGGGGTGCGGG + Intronic
1124965486 15:34429876-34429898 TAGTGGAAACAAAGGGGTGCGGG - Intronic
1124982111 15:34576083-34576105 TAGTGGAAACAAAGGGGTGCGGG - Intronic
1126498858 15:49322547-49322569 CAGGGGAATTAAGTTGATGCAGG + Intronic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1133740563 16:8648002-8648024 CTGTGGCATCACGTGGATGCTGG + Exonic
1138071791 16:53999623-53999645 CCATGGAAGCAGATGGATGCTGG + Intronic
1138875480 16:60943409-60943431 CAGAGGAAAAAAATGGAGGCGGG + Intergenic
1140110778 16:72002786-72002808 CAATGGAATCATCTGGATGTGGG + Intergenic
1141129489 16:81425860-81425882 CAGTGTAATCAAATTCATGGAGG + Intergenic
1141372096 16:83497458-83497480 CAGTGAAATCACATGGACACAGG + Intronic
1142697608 17:1642378-1642400 CAATGGAATCACATGGACACAGG - Intronic
1143115765 17:4581169-4581191 CAGTGGAACCGATAGGATGCTGG - Intergenic
1143544335 17:7587690-7587712 TAGTGGAAACAAATGGTTGATGG + Exonic
1143756495 17:9071688-9071710 CAGCAGCATCAAATGGAGGCTGG + Intronic
1146457755 17:33020596-33020618 CAGTGGCATCTGATGGATACAGG - Intronic
1148281487 17:46351307-46351329 CAGTTGTATCAAATGTATCCTGG - Intronic
1148303712 17:46569246-46569268 CAGTTGTATCAAATGTATCCTGG - Intronic
1148758077 17:49985059-49985081 CAGGAGAAGCAATTGGATGCTGG + Intergenic
1148763446 17:50021734-50021756 CAGTGGAATGAAGAGGATGGGGG - Intergenic
1148994050 17:51692903-51692925 CAGTGGAAACAAGTTGAAGCTGG - Intronic
1149427216 17:56566670-56566692 CAGTGTAATCAACCTGATGCTGG - Intergenic
1149586233 17:57789401-57789423 CAGTGGAATGAAATAAATTCTGG - Intergenic
1153242186 18:3041150-3041172 CAGTAGAATCACTTGAATGCAGG + Intergenic
1153269650 18:3307569-3307591 CAGTGGATTCAGATGAAAGCTGG - Intergenic
1153584514 18:6607494-6607516 TAGTGGAAACAAATGGTCGCTGG - Intergenic
1157076565 18:44473593-44473615 CAGTGAAATAAAATGCATGTGGG + Intergenic
1158245835 18:55431252-55431274 AGGTGGAATCAAAGGGATGTAGG - Intronic
1160479053 18:79221334-79221356 CTGTGGAAGCAGATGGCTGCAGG - Intronic
1161619932 19:5292641-5292663 GAGCGGAAACAAATGGATGGAGG + Intronic
926103386 2:10135204-10135226 CAATAGAATCAAAAGGAAGCTGG + Intergenic
928052127 2:28009891-28009913 CTGTGGTATCATATGAATGCTGG - Intronic
930282073 2:49381248-49381270 CAGTGGAATCAAACGGAGATAGG - Intergenic
930841846 2:55856021-55856043 AAGTGGGCTCAGATGGATGCAGG - Intergenic
941838168 2:170049087-170049109 CAGTGGATTCAACTGCATGGTGG - Intronic
942458781 2:176155580-176155602 CTGTGGGCCCAAATGGATGCTGG - Intronic
942903961 2:181158543-181158565 TAGAGGAAGCAAATGGATTCAGG + Intergenic
943115098 2:183659184-183659206 CAGTGAAATCCAATGGATATTGG + Intergenic
943997361 2:194787140-194787162 CAGTGAGAACACATGGATGCAGG - Intergenic
947112751 2:226737136-226737158 CAATGAGATCACATGGATGCAGG - Intronic
1169466802 20:5848794-5848816 CGGAGGAATAAAATGAATGCCGG - Intronic
1172288700 20:33759375-33759397 CAGTGGAATCACATGAACCCAGG - Intronic
1172309777 20:33908570-33908592 CAGTGGGATCAGATTGAGGCTGG + Intergenic
1178158727 21:29886116-29886138 CACAAGAGTCAAATGGATGCTGG + Intronic
1181944351 22:26504380-26504402 CAGTGGAACTAAATGGAAGGGGG - Intronic
1183370894 22:37431611-37431633 CAGTGGGATCATTTGGATGTGGG - Intergenic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950914343 3:16628577-16628599 CAGTGGAAGAAAATTGATACTGG + Intronic
950925635 3:16738384-16738406 GAGTGGAATCACATGAAAGCTGG - Intergenic
952195725 3:31073698-31073720 CAGCCAAATCAAATGGAAGCTGG - Intergenic
952294883 3:32052750-32052772 CAATGAGATCACATGGATGCAGG + Intronic
953469438 3:43154592-43154614 CTGTGGAAGGAAAGGGATGCAGG - Intergenic
955771615 3:62390345-62390367 CAGTGGAATACAATGGAGCCAGG - Intergenic
958565769 3:95807845-95807867 CAGTGAAATCAAGTGAATGCAGG + Intergenic
959667833 3:108941516-108941538 CAGGGGAATGAAATGGAGGAGGG - Intronic
960983933 3:123259283-123259305 GAGTGGAATGAAATTGATGGGGG + Intronic
962760891 3:138512795-138512817 CAGTGGAATAAGATCCATGCTGG + Intronic
963382899 3:144554172-144554194 CAGCATAATCAAATAGATGCAGG + Intergenic
967897062 3:194405419-194405441 CATTGGAATCAAATGAAAACAGG + Exonic
968229035 3:196993757-196993779 CAGTGGAATGCAATGGATGATGG - Intronic
969403545 4:6973345-6973367 CAGTGGAAGTAATTGGCTGCTGG + Intronic
970686314 4:18571699-18571721 CTGTGTAATTAAATGGTTGCAGG + Intergenic
970758700 4:19456559-19456581 CAGTGGAAGCTAATTAATGCAGG - Intergenic
975304460 4:72833260-72833282 CAGTGAGAACACATGGATGCTGG + Intergenic
975443964 4:74441567-74441589 CAGGGGAATCACTTGAATGCGGG - Intergenic
976197027 4:82542778-82542800 CAGTGTCATTAAATGGATCCAGG + Intronic
976337291 4:83905062-83905084 CAGTGGGATCAAAATGAAGCAGG - Intergenic
977241224 4:94572252-94572274 GAGTGGAATCAAATTGCTACTGG + Intronic
980250033 4:130303118-130303140 AAGTGGAAAAAAATGGGTGCTGG + Intergenic
983123722 4:163922162-163922184 CAATGGGAACACATGGATGCGGG + Intronic
984950896 4:185006942-185006964 CAATGGTATCAAATAAATGCAGG + Intergenic
989439271 5:41451074-41451096 CAGAGGAAATAAATGGATTCTGG + Intronic
990193598 5:53288964-53288986 CAGTGGGATCGGATGGATCCTGG - Intergenic
993018717 5:82564837-82564859 CAGTGCAATCAACAGGATGGGGG - Intergenic
994043320 5:95283440-95283462 CATTGGAAGCAAATGGCTGGCGG - Intronic
994440335 5:99795136-99795158 CAGTGGAATAAAATTGTTACAGG + Intergenic
994581692 5:101650702-101650724 CAGTGGAATTATATGGAAGAAGG - Intergenic
997018660 5:129969125-129969147 CAATGGAAGTAAATTGATGCTGG + Intronic
997326231 5:133024242-133024264 CAGAGGAGTTAAATGAATGCAGG - Intronic
997704499 5:135934356-135934378 AAGTGAAATCAAATGGAGGTTGG + Intronic
998984075 5:147735869-147735891 CAGTGGACTAGAATGAATGCTGG + Intronic
999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG + Intronic
999794331 5:154974691-154974713 AAGTGGCATTAAGTGGATGCTGG + Intergenic
1000769206 5:165330716-165330738 CTGTGGATCCATATGGATGCTGG + Intergenic
1000838466 5:166185803-166185825 CAGTGGAATAACTAGGATGCTGG + Intergenic
1003311814 6:4975343-4975365 CAGTGGAACCACCTGGATGGCGG - Intergenic
1003988758 6:11464719-11464741 CAGTGTTATCAAATAGCTGCTGG - Intergenic
1011278939 6:85657541-85657563 CAGTGGATACAAATGAAAGCTGG + Intergenic
1011959316 6:93068163-93068185 TAGTAGAATCATATGGATGAGGG + Intergenic
1012990873 6:105924594-105924616 CAATGGCAACAAATGGATGCTGG - Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013811029 6:114044723-114044745 CAGTGGACTCAAAGAGAAGCAGG - Intergenic
1014170765 6:118276868-118276890 CACTGGAATCAAAGTAATGCTGG + Intronic
1014230590 6:118897801-118897823 CAGAGGAATTAAATGAAAGCTGG + Intronic
1015757218 6:136619868-136619890 GAGAGGAATCAAATGAATCCTGG + Intronic
1016372474 6:143389783-143389805 CAGTAGAATCACATGGCTTCAGG + Intergenic
1018442458 6:163825611-163825633 CAGTGGCATCAAATAGAAGATGG + Intergenic
1019722162 7:2579151-2579173 AAGTTGAATGAAATGGAAGCAGG + Intronic
1020603153 7:10302373-10302395 CAGTGGAAACCAATGGATCCTGG - Intergenic
1022082222 7:27034072-27034094 TAGTGCAAGCAAATGGATGTGGG - Intergenic
1023058115 7:36305703-36305725 CAGTGGATTCAGATGGAAACTGG + Intergenic
1024762124 7:52611351-52611373 AAATGGAATGAAATGGAGGCAGG - Intergenic
1026430466 7:70342017-70342039 CATTAGAATCAAATGCATTCGGG + Intronic
1028209518 7:88056078-88056100 CAATGAAATTAAATGGAAGCAGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029470433 7:100751111-100751133 CAGTGGAATCACAGAGTTGCTGG + Intronic
1033825398 7:145183790-145183812 CAGAGAAATTCAATGGATGCAGG + Intergenic
1034126056 7:148672455-148672477 AAGTAGAATAAAATGGAAGCAGG - Intergenic
1034283455 7:149869136-149869158 CAGTGGAATCAAAAGGACTCAGG + Intergenic
1034825239 7:154256395-154256417 CTGTGGAACCAAATGGAAACTGG + Intronic
1037282459 8:17257438-17257460 CAGTGAAAACACATGGATACAGG + Intronic
1038315733 8:26482892-26482914 CAGTGGATTCTAATGTGTGCTGG + Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1042173667 8:66017710-66017732 CACTGAAATCAAATTAATGCAGG + Intergenic
1042283198 8:67077799-67077821 CAGTGGATACAAGGGGATGCCGG + Intronic
1043338283 8:79204330-79204352 CAGTGGGATCAAAATGAAGCAGG + Intergenic
1051492909 9:17686736-17686758 CAGTGAAATCACATGGACACAGG + Intronic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1052373235 9:27689554-27689576 CAGTTGAATCAAAAGCATCCTGG - Intergenic
1056801204 9:89693256-89693278 TAGAGGAATGAAATGGATGGTGG + Intergenic
1058505360 9:105660930-105660952 CAGTGGAACCATATGCATGGTGG - Intergenic
1060148998 9:121275378-121275400 CAGTGCAATCATGTGGATGCTGG + Intronic
1060852996 9:126892881-126892903 CAGTGGAATCACTTGAATCCGGG - Intergenic
1060997362 9:127882774-127882796 CGCAGGAAACAAATGGATGCAGG + Intergenic
1061775752 9:132962584-132962606 CAGTGGAATCAGATGAAAACTGG + Intronic
1062174781 9:135155264-135155286 CAGAGGAACAATATGGATGCAGG + Intergenic
1203387331 Un_KI270438v1:67615-67637 GAGTGGTATCAAATGGATTGCGG + Intergenic
1203344901 Un_KI270442v1:27001-27023 AAGTGGAATCAAATGGAATACGG + Intergenic
1187293823 X:17979919-17979941 CAATGAAAACACATGGATGCAGG - Intergenic
1190384542 X:49872230-49872252 CATTGGAATCACATGGGTGCAGG + Intergenic
1194008642 X:88530750-88530772 CAGGGGAAAAAAATGGAGGCGGG - Intergenic
1195660441 X:107372644-107372666 CAGATGAAACAAATGGTTGCAGG - Intergenic
1195993155 X:110703215-110703237 CAGGGGATTCTGATGGATGCAGG + Intronic
1196849933 X:119927639-119927661 CAGTGGAATAAAATTCAGGCCGG - Intronic
1197270099 X:124415819-124415841 CACTGGCATCACATTGATGCAGG - Intronic
1199791033 X:151155466-151155488 CAGTGGAGTCATATGGACTCAGG - Intergenic
1200510654 Y:4074808-4074830 CAGTGAGAACACATGGATGCAGG - Intergenic
1201120715 Y:10870699-10870721 AAGTGGAATGAAATGGAGTCGGG - Intergenic
1201127342 Y:10927060-10927082 CAGTGGAATGAAATGGAGTAGGG - Intergenic
1201528908 Y:14969935-14969957 CAGTGGAAGCAAATTCATACAGG + Intergenic
1202605845 Y:26639121-26639143 AAATGGAATCAAATGGAAGGTGG + Intergenic
1202605972 Y:26640028-26640050 GAATGGAATCAAATGGAAGGTGG + Intergenic
1202606068 Y:26640706-26640728 AAATGGAATCAAATGGAAGGCGG + Intergenic