ID: 1130321455

View in Genome Browser
Species Human (GRCh38)
Location 15:82846017-82846039
Sequence GACTGTGCACAGAGGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130321455_1130321464 29 Left 1130321455 15:82846017-82846039 CCAACTGCCCTCTGTGCACAGTC 0: 1
1: 0
2: 5
3: 28
4: 244
Right 1130321464 15:82846069-82846091 GCTGCTCCCACCACTGAGCAAGG 0: 1
1: 0
2: 1
3: 36
4: 246
1130321455_1130321460 -4 Left 1130321455 15:82846017-82846039 CCAACTGCCCTCTGTGCACAGTC 0: 1
1: 0
2: 5
3: 28
4: 244
Right 1130321460 15:82846036-82846058 AGTCTTCCTGGGTGTTGATCAGG 0: 1
1: 0
2: 1
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130321455 Original CRISPR GACTGTGCACAGAGGGCAGT TGG (reversed) Intronic
900583252 1:3419602-3419624 GTCTGTTCACAGAGGCCATTGGG + Intronic
900747125 1:4368035-4368057 GCAGGTGCACAGAGGTCAGTGGG + Intergenic
900760456 1:4466977-4466999 CACTGTGTCCAGGGGGCAGTGGG - Intergenic
900760465 1:4467010-4467032 CACTGTGTACATGGGGCAGTGGG - Intergenic
901430118 1:9209032-9209054 GACAGTGCCCAGAATGCAGTCGG + Intergenic
902771204 1:18646600-18646622 GACTGTGCCGAGAGGGCGGCGGG - Intronic
903069722 1:20721182-20721204 GAAGGTGCAGAGAGGGCAGGAGG - Intronic
903611048 1:24613043-24613065 GGCTGGGGAGAGAGGGCAGTGGG - Intergenic
904282682 1:29432449-29432471 GGATATGCACAGAGGGCTGTGGG - Intergenic
904600245 1:31668928-31668950 GAGTGGGAACAGAAGGCAGTGGG - Intronic
904773141 1:32892236-32892258 AACTTGGTACAGAGGGCAGTGGG + Intronic
905804525 1:40866138-40866160 GAGTGTGGACAGAGTGCAGTGGG + Intergenic
908112595 1:60912052-60912074 GACTTTCCACGGATGGCAGTGGG - Intronic
908393996 1:63708316-63708338 GACTGGGCACAGAGTGAAGCTGG - Intergenic
908979803 1:69942117-69942139 GAGTGGGCACAGTGGGCAGTAGG + Intronic
909071188 1:70995356-70995378 GGCTTTGTACAGTGGGCAGTGGG + Intronic
909504069 1:76368067-76368089 GCTAGAGCACAGAGGGCAGTTGG - Intronic
912758197 1:112342437-112342459 GGCTGTGGCCAGAGGTCAGTGGG - Intergenic
913215187 1:116614116-116614138 GACTCTGCACAGAGTGGAGCAGG - Exonic
913272722 1:117109859-117109881 GACTATGCAGAGGGTGCAGTTGG + Intergenic
914874166 1:151500325-151500347 GACTGTGCACAGATGACTGTTGG - Intergenic
915105594 1:153533475-153533497 GGCTGTGCAGAGAGGGAATTCGG + Intergenic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916400294 1:164440349-164440371 TGCTGGGCACAGAGGGTAGTTGG - Intergenic
916498027 1:165362656-165362678 GACAATGCACAGGGAGCAGTTGG + Intergenic
917990022 1:180365227-180365249 GCCTGTCAACAGAGGGCAGTAGG + Intronic
920837609 1:209526209-209526231 GAATGTGCACAGGGGGCTGCAGG - Intergenic
921100486 1:211924502-211924524 GACAGGGCACAGAGGGCAACTGG + Intergenic
921594929 1:217044336-217044358 GAGTGTGTACAGATGGCAGGAGG - Intronic
923501700 1:234570669-234570691 GACTGTGCAAAGCCAGCAGTTGG - Intergenic
924434048 1:244023029-244023051 GATTGTGTACATAGGACAGTGGG + Intergenic
1063074890 10:2705093-2705115 GAGTGTGCTCAGAGGCCACTTGG - Intergenic
1063112081 10:3046380-3046402 GACTTTGCAGTGAGGTCAGTGGG - Intergenic
1064937530 10:20694930-20694952 AACCCTGCACAGAGGCCAGTTGG - Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1070814970 10:79317275-79317297 GACTGTCCACAGAGGGAAGAAGG + Intergenic
1070889230 10:79929823-79929845 TGCTGTGCACTGAGGGCTGTCGG - Intergenic
1071785685 10:88897199-88897221 GACTGTGCCCAGAGGGGATGTGG - Intronic
1072019191 10:91381660-91381682 GCCTGACCCCAGAGGGCAGTTGG + Intergenic
1072611349 10:97019384-97019406 CACTGTGCACAGTGGCCATTAGG + Intronic
1072630087 10:97139799-97139821 CAGTGTGCACACAGGGCACTGGG + Intronic
1073466794 10:103698951-103698973 GACTGGGCAGTGAGGGTAGTGGG + Intronic
1073902397 10:108238258-108238280 TAATGTTCACAGAGGGTAGTAGG + Intergenic
1074778805 10:116785707-116785729 GCCAGTGCTCAGAGGGCAGGTGG - Intergenic
1075728928 10:124624929-124624951 AGCTGCGCACAGAGGGCAGGGGG + Intronic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1076801810 10:132834441-132834463 GACCGTGGGCAGTGGGCAGTGGG + Intronic
1077147785 11:1053639-1053661 GCCTGGGCCCAGAGGGGAGTTGG + Intergenic
1077464064 11:2725186-2725208 GTCTGAGCACAGATGGCCGTCGG - Intronic
1078337288 11:10474344-10474366 GACAGACCACACAGGGCAGTGGG + Intronic
1079244410 11:18742443-18742465 GCCTGTCCTCAGGGGGCAGTGGG + Exonic
1079372177 11:19861014-19861036 GACGGTGGAAAGAGGGCAGAGGG + Intronic
1080368964 11:31611856-31611878 AAGTGGGCAGAGAGGGCAGTGGG + Intronic
1080553590 11:33395868-33395890 TACTCAGCACAGAGGGCAGAAGG + Intergenic
1084463428 11:69308824-69308846 CACTGTGCACCTAAGGCAGTGGG - Intronic
1084681979 11:70671730-70671752 GTCTCTGCACACAGGGCTGTGGG + Intronic
1085099417 11:73788034-73788056 GACGGTGCAGAGAGGGGAGATGG + Intronic
1086748334 11:90457719-90457741 GACTGGGGAGAGAGGGAAGTGGG + Intergenic
1086879630 11:92138209-92138231 GCTTGTGGACATAGGGCAGTTGG - Intergenic
1087645154 11:100800331-100800353 CACTGGGAACAGAGGGGAGTTGG + Intronic
1090208607 11:124899489-124899511 AGCTGAGGACAGAGGGCAGTGGG + Intergenic
1096534205 12:52260534-52260556 GCTTGGGCACAGAGGGAAGTAGG - Intronic
1097054334 12:56240792-56240814 GACAGTGCGCTGAGGGCAGCAGG + Exonic
1097181910 12:57176483-57176505 CACTGTACACACTGGGCAGTGGG + Intronic
1098186293 12:67900337-67900359 GACTGTGGGCACAGGTCAGTGGG + Intergenic
1099620523 12:84997368-84997390 GAAAGTGCACACAAGGCAGTTGG - Intergenic
1100510076 12:95261957-95261979 GATTGTGCACAGAGTGCACATGG - Intronic
1102001541 12:109560912-109560934 GCCTCTGCACAGCGGGCAGGAGG - Intronic
1102089783 12:110176187-110176209 GACTGGGGACACAGGGTAGTAGG - Intronic
1104122061 12:125809100-125809122 GACTGTGCACAGTGAGCAAGAGG + Intergenic
1104323532 12:127774240-127774262 GACTGTGCACAGTGAGCAAGAGG - Intergenic
1105218920 13:18307605-18307627 GACTCTGCACAGAGTGGAGCAGG - Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1109312269 13:60709881-60709903 GACAGTGGACACAGGTCAGTGGG + Intergenic
1109442420 13:62393315-62393337 TACTGTGCACAGAAGGCTGAAGG + Intergenic
1110735265 13:78928766-78928788 GACAGGGGACAGAGGGCAGGGGG - Intergenic
1111593795 13:90385679-90385701 AACAGTACACAGATGGCAGTGGG - Intergenic
1112146489 13:96705817-96705839 GCCTGTGCCCAGAGGCCAGTGGG - Intronic
1112649950 13:101385140-101385162 GGCTGTGCACAGGAGGCAGCTGG - Intronic
1113606278 13:111609846-111609868 CACTGGGCACAGAGGGCAGCAGG - Intronic
1116042636 14:39703591-39703613 GACAGTGGACACAGGACAGTGGG - Intergenic
1119776552 14:77252774-77252796 GGCTGGGCGGAGAGGGCAGTGGG - Intronic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG + Intronic
1121632755 14:95432959-95432981 GACGGTGCACACAGGGCCCTCGG + Intronic
1122028728 14:98896975-98896997 GACTGGGGACAGAGGGGAGTGGG - Intergenic
1124464585 15:29925366-29925388 GACTGAGGACAGAGGGCATCAGG + Intronic
1124687209 15:31792735-31792757 GACTGTGCTCAGAAGCCAGTGGG - Intronic
1124911743 15:33927923-33927945 GAGTTGGCACAGTGGGCAGTGGG - Intronic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1126802370 15:52310634-52310656 GACTGTGCACTGAAGGCAGGTGG - Exonic
1127303430 15:57679826-57679848 GAGTGTGCCCAGAAGGCTGTGGG - Intronic
1127353026 15:58171473-58171495 GAGGGGGCACACAGGGCAGTGGG - Intronic
1128381286 15:67114863-67114885 GACTGTGCAGAGAGTGCTTTTGG - Intronic
1128801110 15:70497725-70497747 GATTGTCCACAGAGTGCACTTGG - Intergenic
1129167920 15:73789430-73789452 GACTTTGCCTAGAGGGCAATAGG + Intergenic
1130321455 15:82846017-82846039 GACTGTGCACAGAGGGCAGTTGG - Intronic
1132679198 16:1132834-1132856 GGCCGTGCACATGGGGCAGTGGG - Intergenic
1132726480 16:1341108-1341130 GCCTGTGGACAGAGGGGCGTGGG - Exonic
1132728242 16:1348075-1348097 AACTGCGGACAGAGGCCAGTCGG - Exonic
1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG + Intergenic
1136683895 16:31983162-31983184 GTCTCTGCCAAGAGGGCAGTGGG + Intergenic
1136784524 16:32926714-32926736 GTCTCTGCCAAGAGGGCAGTGGG + Intergenic
1136885259 16:33927092-33927114 GTCTCTGCCAAGAGGGCAGTGGG - Intergenic
1137672939 16:50290153-50290175 GGCTGTGCACAGAGCACCGTGGG + Intronic
1137720727 16:50625909-50625931 GACTGTGGAGAGAGGGAAGCAGG - Intronic
1138553925 16:57761473-57761495 GGCTGTGCCCAGACGGCAGTGGG - Exonic
1139582246 16:67880560-67880582 GACAGTGCAGAGGTGGCAGTAGG - Exonic
1141155016 16:81591379-81591401 GACAGTGCACAGAAGGTACTGGG + Intronic
1141307065 16:82874881-82874903 GACTGAACTTAGAGGGCAGTTGG + Intronic
1141693328 16:85608376-85608398 GACTGTGCATACAGGGGAGCTGG + Intergenic
1142329475 16:89442094-89442116 GTCTGTGCACAGTGAGCAGTTGG + Intronic
1203087183 16_KI270728v1_random:1190720-1190742 GTCTCTGCCAAGAGGGCAGTGGG + Intergenic
1143375729 17:6466000-6466022 GACTCTACGCAGAGGGCAGTGGG - Intronic
1145065615 17:19759515-19759537 GACTGTGTTCTGGGGGCAGTAGG + Intergenic
1146752468 17:35394067-35394089 GACTGTGGGCACAGGTCAGTGGG + Intergenic
1147144822 17:38478865-38478887 GTCTCTGCCAAGAGGGCAGTGGG + Intronic
1147887935 17:43697170-43697192 CACTGTGCTCAGTGGGCACTGGG + Intergenic
1148159410 17:45441571-45441593 GACTGTGGTCAGAGGACAGATGG - Intronic
1148201028 17:45750145-45750167 GACTGTGCAGAGAGAGCAGGTGG + Intergenic
1148905666 17:50910257-50910279 GACTGGGCACAGAGGCCAGCTGG + Intergenic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1150390745 17:64788656-64788678 GACTGTGGTCAGAGGACAGATGG - Intergenic
1150578835 17:66454169-66454191 GACTGCCCAGAGAGGGCAGTGGG - Intronic
1153255465 18:3165988-3166010 TCCTGGGCACAGTGGGCAGTGGG - Intronic
1155348841 18:24886045-24886067 GACTATGCCTAGCGGGCAGTAGG + Intergenic
1155794615 18:30020527-30020549 GACTGGGCAAAGAGTGCAATGGG - Intergenic
1157221586 18:45832071-45832093 GAGTGTGAACAGAGGGTGGTGGG - Intronic
1158515152 18:58124456-58124478 GACAGAGCACAGAAGGCACTTGG - Intronic
1160089977 18:75817890-75817912 GAGGGTGCACAGCGGGCACTGGG + Intergenic
1160343541 18:78110471-78110493 GAGTGTGCACGGAGGTCAGAGGG - Intergenic
1160875068 19:1293107-1293129 AACTGAGGCCAGAGGGCAGTGGG + Intronic
1161164723 19:2780231-2780253 GAGTGTTCACAGAAGGTAGTGGG - Intronic
1162057043 19:8071083-8071105 GGCTGTGAACAGAGAGCACTTGG + Intronic
1163374704 19:16923017-16923039 GCCTGGGGACAGAGGGCTGTGGG - Intronic
1163646470 19:18492298-18492320 GTCCTTGCACATAGGGCAGTGGG - Intronic
1163753439 19:19092331-19092353 GACAGAGCACTGAGGGCAGCTGG - Intronic
1165149916 19:33754109-33754131 GATGGTACACAGAGGGTAGTGGG - Intronic
1165330834 19:35140435-35140457 GACAGTGCAGAGGGGGCAGCTGG + Intronic
1166082932 19:40456194-40456216 GTCTGTGAACAGAGGACGGTAGG + Intronic
925935509 2:8755142-8755164 GCCTTTTCACAGATGGCAGTGGG - Intronic
926451848 2:13013502-13013524 GTCAGTGCACAGAAGGCTGTGGG - Intergenic
927967907 2:27283109-27283131 GCCTGTGCATAGACGGCAGCTGG + Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
929764027 2:44829424-44829446 GCCTCTGCAGAGAAGGCAGTTGG - Intergenic
932188104 2:69715750-69715772 GCCTATGCACAGAGGGCAGTGGG + Intronic
933632941 2:84677097-84677119 GACTGTGCTCTGAGGGCATTGGG - Exonic
934295398 2:91739029-91739051 GACTCTGCACAGAGTGGAGCAGG + Intergenic
934554069 2:95278242-95278264 GTCTGAGCCCAGAGGGCAGGCGG + Intronic
934772609 2:96916893-96916915 GTCTGGGCACAGAGCCCAGTGGG + Intronic
937639606 2:124196643-124196665 GACTGTTTACAGTGGGAAGTGGG - Intronic
938701360 2:133883029-133883051 GACTGTGCACAGAGCTAAATGGG - Intergenic
939041278 2:137191744-137191766 GCCTGTGCACAGGCTGCAGTGGG - Intronic
941594723 2:167461465-167461487 TACTGTGCACAGAGGTGAGAGGG - Intergenic
943266275 2:185737317-185737339 CACTTTGCGCTGAGGGCAGTTGG + Intergenic
946170531 2:217892764-217892786 GCCTGTGGACAGAGGGCGGGAGG - Intronic
947517285 2:230816949-230816971 GAGTGTGCAGAGCCGGCAGTGGG - Intronic
948082248 2:235215901-235215923 GTCTGTGCTCAGAGGTAAGTGGG + Intergenic
948179281 2:235966811-235966833 GACTGTGCAGAGAGGGGCGAGGG + Intronic
948246972 2:236494894-236494916 GCCTGAGGAGAGAGGGCAGTAGG + Intronic
948671474 2:239571354-239571376 GGCTGTGCTCAGAGGCCAGCAGG - Intergenic
948906487 2:240982067-240982089 GGCTGTGCACAGAGGGCAGCAGG + Intronic
1172523185 20:35582396-35582418 CACTGGGCACTGAGGGCTGTAGG + Intergenic
1173649793 20:44655902-44655924 GACTGTGCACCGAGGGAAAGGGG - Intergenic
1175697694 20:61114882-61114904 CACTGTGGGCAGTGGGCAGTGGG + Intergenic
1175920980 20:62450589-62450611 GACTGTGCCCAGGGGGCAGGCGG + Intergenic
1179502036 21:41816007-41816029 GACTGTGCCCAGAGGCCGGGAGG + Intronic
1179724456 21:43334026-43334048 GGCTGTGCACTCAGGGCAGGAGG + Intergenic
1180885713 22:19241789-19241811 GACTGTGCCCAGGAGCCAGTGGG - Intronic
1181688168 22:24543428-24543450 CCCTGTGCCCGGAGGGCAGTAGG + Intronic
1182097943 22:27638536-27638558 GACTCTGCCCAAGGGGCAGTCGG + Intergenic
1182683982 22:32106526-32106548 GCCTGTGAACTGAGGGCAGATGG + Intronic
1182715690 22:32354688-32354710 CACTGCCCACAGAGGGGAGTGGG - Intergenic
1183427516 22:37747394-37747416 GTGTGTGCACAGGCGGCAGTAGG + Intronic
1183725064 22:39584032-39584054 GACTTTGGAAAGAAGGCAGTGGG + Intronic
1184103184 22:42352357-42352379 GACTTTGTTCAGAGAGCAGTAGG - Intergenic
1184537279 22:45095720-45095742 GCCAGCGCTCAGAGGGCAGTGGG - Intergenic
949771789 3:7587242-7587264 TACTGTGCAAATAGGCCAGTTGG - Intronic
950068666 3:10134700-10134722 GCTTGGGCACAGAGGGAAGTAGG + Intergenic
950707033 3:14789229-14789251 GACCCTGCACTGAGGGCTGTCGG + Intergenic
950908008 3:16556633-16556655 GACTGTGCACCGAGGCCAGGTGG - Intergenic
953105893 3:39878348-39878370 GACAGTGGGCACAGGGCAGTGGG - Intronic
953449523 3:42994569-42994591 GACTGGGCTGAGAGGGCATTCGG + Intronic
953906974 3:46873293-46873315 GAATGGGAACACAGGGCAGTGGG + Intronic
954462718 3:50636893-50636915 TACTCTGCAGAGAGGCCAGTGGG + Intronic
954627288 3:52029417-52029439 AGCTGTGCACAGAGGGCCTTAGG - Intergenic
954800606 3:53184993-53185015 GACCCTGGACACAGGGCAGTGGG + Intronic
955216614 3:56989516-56989538 GTCTGTGCCCAGGGGGCAGGGGG + Intronic
957034908 3:75284991-75285013 GCCTGTGCAAGGAGGGCAGTGGG - Intergenic
959076437 3:101753906-101753928 GACGGTGGGCAGAGGACAGTGGG - Intronic
960351719 3:116602004-116602026 AACTGTGCACAGTGGTCATTAGG + Intronic
961304684 3:125949864-125949886 ACCTGTGCAAGGAGGGCAGTGGG + Intergenic
966417290 3:179702373-179702395 GCCTGGCCACAGATGGCAGTGGG + Intronic
966440570 3:179940182-179940204 GACTTTGCAGACAGGGAAGTGGG + Intronic
969125036 4:4940915-4940937 GAGTGTTTACAGAGGCCAGTGGG - Intergenic
970672305 4:18410918-18410940 AGCTGTGACCAGAGGGCAGTTGG + Intergenic
972608092 4:40632229-40632251 TACTGTGAACAGCAGGCAGTGGG + Intergenic
976576347 4:86676851-86676873 GACTGGGCAGAGAGGGTAGAGGG + Intronic
978147684 4:105395320-105395342 GACTGTGCTCAGAGAGCACAGGG + Intronic
980706659 4:136505336-136505358 GAAAGTGCACAGAAGGCAGATGG + Intergenic
981677290 4:147357217-147357239 GACTGTGGAAAGAGGGGAGAGGG - Intergenic
983848426 4:172547827-172547849 GACTTAGCACAGTGGGCAGCTGG - Intronic
985912047 5:2892420-2892442 GAATGGGCACAGAAGGCAGCTGG - Intergenic
985975429 5:3416179-3416201 GACTTTGCACAGAGGCCGGAAGG - Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
990265738 5:54073154-54073176 GTCAGTGCACATATGGCAGTCGG + Intronic
992509540 5:77419383-77419405 GTGTTTGCACAGAGTGCAGTGGG + Intronic
995827184 5:116313819-116313841 GATTTTGAACAGGGGGCAGTGGG - Intronic
998632182 5:143911495-143911517 GACTGTGGACAGACGGGAGATGG - Intergenic
1000388819 5:160701709-160701731 GACTGTTCCCAGAAGGCATTGGG - Intronic
1000988690 5:167889305-167889327 CACTGTGGACGGAGGGCTGTGGG + Intronic
1001254864 5:170175777-170175799 GACTGTGCTCAGGGGGCCCTTGG + Intergenic
1001527273 5:172437775-172437797 CCCTGTGGACAGAGTGCAGTAGG - Intronic
1001756461 5:174174018-174174040 GACCATGGACTGAGGGCAGTGGG - Intronic
1002029495 5:176417170-176417192 GCCTGTTCACAGAGGGCAGCGGG - Intergenic
1002549198 5:179974460-179974482 TACTGTGGACAGATGGCAGTTGG - Intronic
1003383475 6:5646399-5646421 ACCTGTGCAGTGAGGGCAGTGGG + Intronic
1004117196 6:12781172-12781194 GTCTGTGCACAGAACACAGTGGG - Intronic
1004558871 6:16728259-16728281 AGCTGTGCGCACAGGGCAGTGGG + Intronic
1006361419 6:33589389-33589411 ATCTGTGCAGAGAGGGCAGGAGG + Intergenic
1007392366 6:41557074-41557096 TACTGAGCACAGTGGGCACTGGG - Intronic
1009338628 6:62526086-62526108 CACTGTGCACAGAGGGGTGGTGG - Intergenic
1010760760 6:79719776-79719798 GAGTCAGCACAGAGGGCAGTGGG - Intergenic
1011161778 6:84398953-84398975 GACTGGGGACAGAGGGTGGTGGG + Intergenic
1013036764 6:106392512-106392534 GACAGTGCTAAGAGGGGAGTGGG + Intergenic
1013589165 6:111605799-111605821 GACTGGGCCCGGAGGGTAGTCGG + Exonic
1014314676 6:119848662-119848684 GACTGTATACAAAGGGCAATGGG + Intergenic
1016358050 6:143239118-143239140 GGGTGTGCACAGAGTACAGTTGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018632780 6:165835068-165835090 GGCAGTGCACAGAGGGCAGTTGG + Intronic
1019702483 7:2480646-2480668 GACTGTGGAGAGAAGGCACTCGG - Intergenic
1020042424 7:5014164-5014186 GCCTATGCACAGAGGGCAGTGGG + Intronic
1020901817 7:14012993-14013015 GCCTGAGCTCAGATGGCAGTGGG + Intergenic
1021531883 7:21655898-21655920 GTTTCTGCACACAGGGCAGTTGG + Exonic
1027235580 7:76295710-76295732 GACAGTTCAGAGAGGGCTGTGGG - Intergenic
1030539222 7:110808543-110808565 GGCTGTGCACAGGGGGCATTTGG + Intronic
1031489607 7:122370619-122370641 AAGTGGGCACAGAGGGCATTGGG + Intronic
1034907441 7:154963122-154963144 CACCGTGCACAGAGAGCAGCTGG + Intronic
1035371529 7:158382209-158382231 GGCTGTTCACGGAGGGGAGTTGG - Intronic
1035769842 8:2138343-2138365 GACTGTGGACTGAGAGCAGCTGG + Intronic
1037599145 8:20379257-20379279 GCATGTGGACATAGGGCAGTGGG - Intergenic
1038447400 8:27613431-27613453 GACTGTGAACAGGGAGCCGTGGG + Intronic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039611502 8:38922939-38922961 GGCTGAGCACAGAGGTCAGTGGG - Intronic
1041163134 8:55065161-55065183 GAAGGTGCACAGAGAGCAGCTGG - Intergenic
1042389143 8:68213052-68213074 GACTGTGTACAATGGGCAGTAGG + Intronic
1043130594 8:76456080-76456102 GACTGTGTGCGGAGGGCAGGGGG - Intergenic
1044402382 8:91787927-91787949 GACTGTGGGCACAGGACAGTGGG + Intergenic
1047403666 8:124567388-124567410 ACCTGTGCACAGGGGACAGTGGG + Intronic
1048284102 8:133128212-133128234 GACAGTGCACAGCAGGCATTCGG + Intronic
1049707012 8:144047683-144047705 CACAGTGCACTGAGGGCAGATGG + Intergenic
1049726708 8:144149870-144149892 GACTGTGAGCAGTGGGCTGTGGG + Intronic
1049786090 8:144451527-144451549 GACTGTGCCCAGCGGGATGTGGG - Intronic
1052735242 9:32335091-32335113 GCCTGTGCACAGATGACAGAGGG - Intergenic
1053597861 9:39581963-39581985 GACTGTGAACAGATGCCAATGGG - Intergenic
1053855882 9:42338967-42338989 GACTGTGATCAGATGCCAGTGGG - Intergenic
1054151645 9:61610673-61610695 GACTTTGGACAGTGGGCATTTGG - Intergenic
1055326608 9:75136903-75136925 GTATGTGCACACTGGGCAGTGGG + Intronic
1056124478 9:83521698-83521720 GACTGTGCAGACAGTGGAGTGGG - Intronic
1056268674 9:84925125-84925147 GAAGGTGCAGAGAGGGCAGTGGG - Intronic
1059404964 9:114093835-114093857 GCCTCTGGACAGAGGGCAGCTGG - Intronic
1060118599 9:120966768-120966790 GACTGGCCACAGAAGGAAGTAGG + Intronic
1060401186 9:123350440-123350462 GACTGTGTCCTGAGGGCACTGGG - Intergenic
1060517481 9:124275106-124275128 GACTGTGCACAGCACACAGTGGG + Intronic
1061396117 9:130343992-130344014 GACTCTGCACAGTGGGGAGGGGG + Intronic
1062480126 9:136747267-136747289 GGCTCTGCACAGAGCCCAGTGGG + Intronic
1185466533 X:358361-358383 GACTGTGGGCAGAGGCCAGCAGG - Intronic
1185519427 X:727838-727860 GACTGAGCATTGAGGACAGTGGG + Intergenic
1187178902 X:16924108-16924130 GACTCTGCAGTGAGAGCAGTAGG - Intergenic
1187271827 X:17787241-17787263 GACAGTGGACACAGGTCAGTGGG - Intergenic
1189404550 X:40708580-40708602 GACTGTGCACTGTGGGCACAAGG + Intronic
1189569372 X:42279014-42279036 TTCTGTGCACAGACAGCAGTGGG - Intergenic
1191104070 X:56761424-56761446 GCATGTGCACAGAGGCCTGTTGG - Intergenic
1191784825 X:64906073-64906095 GACAATAGACAGAGGGCAGTAGG - Intergenic
1198189287 X:134286693-134286715 GACGGTGCAAAGAGGGGAGAGGG + Intergenic
1199743922 X:150760051-150760073 CACTGTGCTCGGAGGGTAGTAGG + Intronic
1200747701 Y:6916985-6917007 TCCTGTGCACACAGGGCACTGGG - Intronic