ID: 1130323905

View in Genome Browser
Species Human (GRCh38)
Location 15:82863295-82863317
Sequence TGGATTTCACCTGAGAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130323905 Original CRISPR TGGATTTCACCTGAGAGGGT TGG (reversed) Intronic
900533708 1:3167076-3167098 TGGATTGCACCTGGCAGGGAAGG + Intronic
903370958 1:22835864-22835886 TGGCTTTCTCCTGAGATGTTGGG + Intronic
904671981 1:32172855-32172877 TGGATTTCACCTGAGCCAGAAGG - Exonic
905095981 1:35471201-35471223 AGGATTGGCCCTGAGAGGGTCGG - Intronic
907314974 1:53562561-53562583 TGGGACTCAGCTGAGAGGGTGGG - Intronic
912336927 1:108871897-108871919 TAGATTTCACATGAGAGATTAGG + Intronic
912836141 1:112998119-112998141 TGGAATCCACCTCAGTGGGTAGG + Intergenic
912931685 1:113969124-113969146 TTGCTTTTACCTGAGAAGGTAGG + Intronic
914920093 1:151840417-151840439 TGGACTTCACCTGTGAGGGCTGG - Exonic
919850153 1:201667012-201667034 CAGAATTCACCTGAGAGTGTGGG + Intronic
921163634 1:212490645-212490667 TGTATGTCACCTCACAGGGTAGG + Intergenic
923363042 1:233231612-233231634 TAGATTTTACCTGAAAGGGCAGG + Intronic
1064275043 10:13897991-13898013 TGGAGTTCAGTTAAGAGGGTTGG + Intronic
1064780778 10:18835913-18835935 TAGATTTAACCTGAGAAGGAAGG - Intergenic
1065271911 10:24041853-24041875 TGTATTGTACCTGAGTGGGTGGG + Intronic
1067425058 10:46203132-46203154 TGGGTTTTATCTGGGAGGGTGGG - Intergenic
1067546570 10:47196454-47196476 TGGCTGTCAGGTGAGAGGGTTGG - Intergenic
1067834890 10:49632455-49632477 AGGGCTTCAGCTGAGAGGGTTGG - Intronic
1073745905 10:106467775-106467797 TAGATTCCACCTGTGGGGGTAGG + Intergenic
1075706873 10:124507145-124507167 AGGATTTCAGGTGGGAGGGTAGG + Intronic
1075961186 10:126568807-126568829 AGGAGTTCACCTGAGAAGGCAGG + Intronic
1078413818 11:11149084-11149106 TGGATTTCAGGAGCGAGGGTGGG + Intergenic
1078925096 11:15867586-15867608 TGGATCTCAGTTGAGATGGTTGG + Intergenic
1080354556 11:31427326-31427348 AGGATTTCACTTGAGGGGTTGGG - Intronic
1084792395 11:71482801-71482823 TGGAAGTCACCTGAGTGTGTGGG - Intronic
1084986240 11:72875447-72875469 TGGATTTCTCCTGAGCAGTTGGG + Intronic
1089144012 11:116311232-116311254 TAGATTTCACCTGGGAGAGCTGG + Intergenic
1090941131 11:131389257-131389279 AGGATGCCACCTCAGAGGGTGGG + Intronic
1095785227 12:46102146-46102168 TGGAGTTTAGCTGAGGGGGTTGG + Intergenic
1098408404 12:70152069-70152091 TGCATTTCAGCTGGGAGGGGCGG - Intergenic
1099064784 12:77962296-77962318 TGGAGTTCAATTGAGAGGTTGGG - Intronic
1100370405 12:93964429-93964451 TGGATTCCATCTGGGAGGCTGGG - Intergenic
1102214714 12:111152497-111152519 TAAATTTCACATGAGAGGCTGGG + Intronic
1105065223 12:133191517-133191539 TGGATTTTACCTGGGAGGAGTGG + Exonic
1105507838 13:21025442-21025464 TGGTTGGCACCTGAGGGGGTCGG + Intronic
1106929775 13:34651822-34651844 TGAATTTCACCTGAGAAAATGGG - Intergenic
1108271925 13:48770156-48770178 TGGATATCTCCTGACAGGGAAGG - Intergenic
1108593867 13:51934165-51934187 TGCCTGTCACCTGGGAGGGTGGG - Exonic
1109447955 13:62470096-62470118 TGTATTGAACCTGAGATGGTAGG - Intergenic
1111039024 13:82720294-82720316 TGGGTTTCCTCTGAGAGGATTGG - Intergenic
1112228705 13:97566570-97566592 TGGATTTCAGCTGAGATGCTGGG - Intergenic
1114500886 14:23167502-23167524 TGGTTTTCTCCTGAGAGGTGAGG + Intronic
1118743890 14:68760320-68760342 TGGAATTCACCTGAGAGCACTGG - Intergenic
1119008408 14:70956749-70956771 TGGAGTTCACGTGGGAGGGGAGG - Intronic
1120328354 14:83056487-83056509 TGGATTCCACATGAGAAGTTGGG + Intergenic
1121425274 14:93846256-93846278 TTGGTTTCACCTGAAAAGGTGGG + Intergenic
1122386948 14:101355383-101355405 TGGATTTCTCATGAGAGGTGAGG + Intergenic
1123945403 15:25236553-25236575 TGAATTTCACCCGGGAGGGAAGG + Intergenic
1128730647 15:70018647-70018669 AGGGTTTCACCAGAGACGGTTGG + Intergenic
1129196373 15:73969620-73969642 TGGATTCCAGATGAGGGGGTTGG + Intergenic
1129217382 15:74108013-74108035 TGGCTTTCTCCTAAGAGGGCAGG - Intronic
1130323905 15:82863295-82863317 TGGATTTCACCTGAGAGGGTTGG - Intronic
1130541384 15:84822893-84822915 TGGAAATCCCCTGAGAGGCTAGG - Intronic
1132290244 15:100695216-100695238 TGAATTTTAACTCAGAGGGTGGG + Intergenic
1136069309 16:27778492-27778514 TGGATTTCACTGGGGAGTGTGGG + Intronic
1140042295 16:71416111-71416133 TGGATTTCACCTGAGCCTGCTGG - Intergenic
1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG + Intergenic
1141058535 16:80841885-80841907 AGGATCTCACCTTAGAGAGTGGG + Intergenic
1141369248 16:83472128-83472150 TGGTTTTCACCTGATGGGGTTGG - Intronic
1141797815 16:86286693-86286715 TGGCTCTCCCCTGCGAGGGTCGG - Intergenic
1144256482 17:13473465-13473487 TGGATTTTGGCTTAGAGGGTGGG + Intergenic
1144762240 17:17713882-17713904 TGGCTTTCACTTGGGAGGTTGGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1148910405 17:50939546-50939568 TGGAGTTCAGGGGAGAGGGTGGG + Intergenic
1150473978 17:65460392-65460414 TGGAAATCACCTGAGATGGAAGG - Intergenic
1151543720 17:74778961-74778983 AAGACTTCACCTGAGAGGCTGGG - Intronic
1155021072 18:21897514-21897536 TTCATTTCACCTGTGAGGATAGG + Intergenic
1160118046 18:76100338-76100360 TGCCTTTCTCCTGACAGGGTGGG - Intergenic
1161592986 19:5137079-5137101 TGGATTGAAGCTCAGAGGGTGGG + Intronic
1162534143 19:11253299-11253321 TGACTTTCGCCTGAGAGGGGTGG - Intronic
1166448839 19:42880759-42880781 TTGCTCTCACCTGAGAGGGCGGG + Intronic
1166695753 19:44850768-44850790 TGGATTTCCGCTGTGGGGGTTGG + Intronic
1166870372 19:45866993-45867015 CGGATCTCCCCTGACAGGGTGGG - Intronic
1167586252 19:50377330-50377352 TGGATTGGACCTGAGGGGGCGGG + Intronic
1167817533 19:51896928-51896950 TGGACTTCACCTGGGAGGAGTGG - Exonic
1167828970 19:52002231-52002253 TGGACTTCACCTGGGAGGAGTGG - Exonic
1167832950 19:52041556-52041578 TGGAGTTCACCTGGGAGGAGTGG - Exonic
929023416 2:37576200-37576222 TGGAGTCTACCTGAGAGGGGAGG - Intergenic
934774515 2:96928642-96928664 TGGGTTTCACCAGAGAGTGGGGG + Intronic
935598656 2:104899896-104899918 TGTATTTCACCTGCGTGGTTGGG - Intergenic
937056498 2:118941732-118941754 TGGATTTGATCTGATGGGGTGGG + Intergenic
938736581 2:134191590-134191612 TGGGTTTCTCATGGGAGGGTGGG + Intronic
940459423 2:153944417-153944439 TGGAGTTCACCTGTGTGGCTTGG + Exonic
942403372 2:175627211-175627233 GGCATTTCACCTAAGAGTGTTGG + Intergenic
942461304 2:176170731-176170753 TGGATTTCTCCTGGGAGGGAGGG - Intronic
942516089 2:176754886-176754908 TAGAATTCACCTGTGAGGGCAGG - Intergenic
945030862 2:205662561-205662583 TGGCTTTCCCCTGGGAGCGTTGG + Intergenic
1169602272 20:7275219-7275241 AGGGTTTCACATAAGAGGGTAGG + Intergenic
1170882641 20:20310736-20310758 TGGATTTTGCCAGAGAGGATTGG - Intronic
1175753743 20:61516257-61516279 TGGATTGCTCCTGTTAGGGTGGG - Intronic
1175952845 20:62592581-62592603 TGGGTTTCATCAGAGAGGATGGG + Intergenic
1178769445 21:35489396-35489418 TGGAGTTTAGCTGAGAGGGTAGG + Intronic
1180956775 22:19744791-19744813 AGGATGCCACCTGAGAGGCTGGG + Intergenic
1185088338 22:48752662-48752684 TGGGTTTCTCCTGGGAGGGAGGG + Intronic
949612153 3:5714084-5714106 TGGATTTCTCATGAGTGGCTTGG + Intergenic
950683362 3:14600682-14600704 TGGGTCTCACATGAGAGGTTTGG - Intergenic
950815275 3:15694871-15694893 TGGATTTGAACTGGGTGGGTGGG - Intronic
950913449 3:16618325-16618347 TTGATTTCACCTTAGAGGTAAGG + Intronic
951108418 3:18772313-18772335 TGAATTTCATCTGATGGGGTTGG + Intergenic
952234867 3:31468641-31468663 CTGATTTGACCTGGGAGGGTGGG + Intergenic
952605954 3:35146606-35146628 TGAATTTCTCCTGAGAAAGTGGG + Intergenic
952613333 3:35238097-35238119 TGGATTTCTCATGAGTTGGTAGG - Intergenic
958799120 3:98735641-98735663 TTCATTTCAACTGTGAGGGTGGG - Intronic
961295058 3:125877844-125877866 CAGATTACACCTGAGAGGGAAGG + Intergenic
962461820 3:135621276-135621298 TGGAATTCACCTGATGGTGTGGG + Intergenic
963281131 3:143385759-143385781 TGGATGTCACCTAAGGAGGTTGG - Intronic
966903716 3:184506794-184506816 TGGACTTCCCCTCAGAAGGTAGG - Intronic
971790917 4:31168829-31168851 TGAATTTCAAATGAGAGTGTAGG - Intergenic
974068172 4:57099704-57099726 TGGATTGCAACTGAAAGGTTGGG + Intronic
979407681 4:120333364-120333386 TGGATTATACCTTACAGGGTTGG + Intergenic
980218649 4:129884446-129884468 TGGATTACAACTGAGAGAGCTGG + Intergenic
981688683 4:147482021-147482043 TGGCTTTCCCCTGATAGAGTTGG + Intronic
982258564 4:153473425-153473447 TGGGTTTCCCGTGAGTGGGTAGG + Intronic
984616449 4:181903976-181903998 TGGAGTTCAAGGGAGAGGGTGGG - Intergenic
987459472 5:18190903-18190925 TGGATTTCTCATTAAAGGGTTGG - Intergenic
988015597 5:25554290-25554312 TGGATTTCTCAGGAGAGGCTTGG - Intergenic
988485063 5:31661913-31661935 TGGACTACAGCTGAGAGTGTTGG - Intronic
991639121 5:68736248-68736270 TGGAGTTGACCTGAGAGAGGTGG + Intergenic
995109375 5:108411937-108411959 TGGTTTTGACCTGAAAGGGCAGG + Intergenic
996622272 5:125521607-125521629 TGGATTTCAACTGAGATCCTGGG + Intergenic
998511493 5:142718054-142718076 TGGAAATCACCTGGGAGGGGAGG - Intergenic
1001435242 5:171694805-171694827 TGGATTTTACCTGAGAGTAATGG + Intergenic
1001960520 5:175877971-175877993 TGAATTTCACGTGGGAGTGTTGG - Intronic
1003816939 6:9851766-9851788 TGGTTTTCAGCTCAGAAGGTAGG - Intronic
1008164497 6:48119580-48119602 TGGTTTTGAACTGACAGGGTAGG + Intergenic
1008813224 6:55531212-55531234 TGGATTTCACTTAAGTGGCTTGG + Intronic
1012683166 6:102209258-102209280 TGGATTTCTCCTCAGAAAGTGGG - Intergenic
1013086578 6:106862884-106862906 TGAATTTCACCTGAGAAAATGGG - Intergenic
1013739104 6:113262706-113262728 TGGAAATTACCAGAGAGGGTAGG + Intergenic
1015443578 6:133276653-133276675 TGGGTTCAAGCTGAGAGGGTAGG - Intronic
1016110572 6:140218737-140218759 TGCATTGCATCTCAGAGGGTGGG + Intergenic
1016236885 6:141878674-141878696 TGGAGTTAACCTGAGAAGGCTGG - Intergenic
1016363097 6:143288843-143288865 TTGATTTGACCTGAAAAGGTAGG + Intronic
1017451773 6:154560827-154560849 TGCATTTCATCTTAGAGGCTTGG + Intergenic
1018501829 6:164419515-164419537 TTGATTACACCTGAAAGGATTGG + Intergenic
1019271960 7:154679-154701 TGTATTTGACCAGGGAGGGTAGG - Intergenic
1022727235 7:32992270-32992292 TGGGTTTCCTCTGAGGGGGTGGG - Intronic
1023677738 7:42648258-42648280 TGGATTTCATCTGATAGGCTGGG - Intergenic
1023942143 7:44776040-44776062 AGGATGTCTCCTTAGAGGGTGGG + Intergenic
1025046352 7:55695379-55695401 TGGGTTTCCTCTGAGGGGGTGGG + Intergenic
1025073586 7:55923190-55923212 TGGACTTCACCAGAGAGGAGTGG + Exonic
1026845067 7:73694132-73694154 TGCATGTGACCTGAGAGGCTTGG - Intronic
1027268117 7:76505036-76505058 TGGATTCCACCAGGGAGGGTGGG + Intronic
1037303241 8:17476568-17476590 TGGATTTCTCCTGAGAAAGTGGG - Intergenic
1037370384 8:18170933-18170955 TGGATTTCACTTAAGAGGCCAGG + Intronic
1039110050 8:34031906-34031928 TGGATTTCAGAGGAGAGGATTGG + Intergenic
1040094792 8:43433213-43433235 TGAATTTCTCCTGAGAAAGTGGG - Intergenic
1040971342 8:53140187-53140209 TGAATTACAACTGAGAAGGTGGG + Intergenic
1042246503 8:66713153-66713175 TGCAGGTCACCTGCGAGGGTCGG + Intronic
1042834974 8:73071349-73071371 TGGATTTCAGCTGAGCGTGAAGG + Intronic
1044386584 8:91596403-91596425 TGGATTAAAGATGAGAGGGTAGG - Intergenic
1046632075 8:116631224-116631246 TGGATTCCTGCTGAGATGGTTGG - Intergenic
1046675861 8:117107731-117107753 TGGTTTTTACCTGAGAGATTTGG - Intronic
1047067837 8:121306391-121306413 TAGATTTCTCCTGAGAAGCTGGG - Intergenic
1047941497 8:129831134-129831156 TGAATTTCACCTCAGAAGATGGG + Intergenic
1055839160 9:80482003-80482025 TGGACTGCAGCTGAGAGAGTTGG + Intergenic
1058956447 9:109953310-109953332 GACATTTCACCTGATAGGGTAGG + Intronic
1060033003 9:120231801-120231823 TGGATTCCACATGAGGGGGGAGG - Intergenic
1061041702 9:128144532-128144554 TTTATTTCAGCTGAGGGGGTGGG - Intergenic
1061735936 9:132659073-132659095 TGAAGCTCATCTGAGAGGGTAGG - Intronic
1186182954 X:6990653-6990675 TGGATCTCGCCTCAGAAGGTGGG + Intergenic
1186219837 X:7338247-7338269 TGGAATTGATCTTAGAGGGTAGG + Intronic
1187678202 X:21739055-21739077 TGCCTCTCACCAGAGAGGGTGGG + Intronic
1187796252 X:23006988-23007010 TGAATTTCTCCTCAGAGAGTGGG + Intergenic
1190087727 X:47410304-47410326 TGGATTTCACCCGACAGGAGTGG + Exonic
1195310530 X:103628556-103628578 TGGATTAAAACTGAGAGTGTTGG + Intronic
1196000220 X:110775351-110775373 TGAATTTCACCTGCAATGGTTGG + Intronic
1196643216 X:118088041-118088063 TGGATTTCACCTGCAAGAGCAGG + Intronic