ID: 1130330154

View in Genome Browser
Species Human (GRCh38)
Location 15:82916134-82916156
Sequence CAGAGGAAACAAAATAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 640}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130330148_1130330154 15 Left 1130330148 15:82916096-82916118 CCTTGAAGGACTTGAGTGTCACT 0: 1
1: 1
2: 0
3: 13
4: 133
Right 1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG 0: 1
1: 0
2: 2
3: 51
4: 640
1130330147_1130330154 20 Left 1130330147 15:82916091-82916113 CCAGACCTTGAAGGACTTGAGTG 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG 0: 1
1: 0
2: 2
3: 51
4: 640

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130330154 Original CRISPR CAGAGGAAACAAAATAATGG GGG Intronic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
903407310 1:23108606-23108628 AAAAGGAAAGAAAATAATGCAGG + Intronic
904074894 1:27832795-27832817 CAAAGGAGACAAACTAATTGAGG + Exonic
904561373 1:31399775-31399797 CTAAGGAAAAAAAATAATAGAGG + Intergenic
906187928 1:43875682-43875704 CTCAGGAAACACAATCATGGCGG - Intronic
906260860 1:44388666-44388688 CAGATGGAACAAAAAGATGGAGG - Intergenic
906788702 1:48639586-48639608 CAAAGAAAACAAAATATTCGAGG + Intronic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
907154885 1:52324503-52324525 CAGAGGAAACAGCATAAGTGAGG - Intronic
907590204 1:55659458-55659480 CAGAGAAAACAAAAAAAAGTAGG - Intergenic
908016199 1:59839342-59839364 AAGAGGACACAAACAAATGGAGG - Intronic
908049180 1:60209110-60209132 AAGAGGATACAAACAAATGGAGG + Intergenic
908049821 1:60217112-60217134 AAGAGGATACAAACAAATGGAGG - Intergenic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
908470134 1:64436232-64436254 CACAGGAAAAAAAATAGGGGTGG + Intergenic
909227996 1:73050120-73050142 CAGAGCAAACAAAATCAGAGTGG + Intergenic
909697000 1:78479057-78479079 AAGAGGATACAAACAAATGGAGG - Intronic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
909914776 1:81303276-81303298 CAGAGGAAAGAAAGTAAAGAAGG - Intergenic
910203038 1:84719535-84719557 CAGAGGAAAGGAACTGATGGGGG + Intergenic
910462153 1:87459106-87459128 CAGAGGAAAGAGAAAAATTGAGG + Intergenic
910554970 1:88521438-88521460 AAGAGGAATTAAAATAATTGAGG - Intergenic
910606600 1:89092104-89092126 CAGAGGAAAAAGAAAATTGGAGG + Intergenic
911081879 1:93941177-93941199 AAGAGGACACAAACAAATGGAGG + Intergenic
911163796 1:94708168-94708190 AAGAAGAAACAAAACAAGGGAGG + Intergenic
911413906 1:97546611-97546633 CTGAGGAAAAACAAGAATGGTGG + Intronic
911539172 1:99137873-99137895 CAGAGGAAACAAAGAAAAGAGGG - Intergenic
911772336 1:101761892-101761914 CAGATGAGAAAAAATAATGTTGG - Intergenic
911851901 1:102830992-102831014 AAGAGGATACAAACAAATGGAGG + Intergenic
911929549 1:103884570-103884592 AAGAGGATACAAACAAATGGAGG - Intergenic
911946320 1:104114023-104114045 AAGAGGATACAAACAAATGGAGG + Intergenic
911979301 1:104545983-104546005 CACAGGAAAGGAAATAATGATGG + Intergenic
912034325 1:105292296-105292318 AAGAGGACACAAATAAATGGAGG - Intergenic
912054473 1:105577768-105577790 AAGAGGATACAAACAAATGGAGG + Intergenic
912073438 1:105842294-105842316 CAGAAGAAACCAGATAGTGGGGG - Intergenic
912723633 1:112040730-112040752 CAGAGGGAACAGAATAGTGATGG - Intergenic
913366032 1:118039860-118039882 CTAAGGAAATAAAGTAATGGTGG + Intronic
915869461 1:159542588-159542610 AAGAGGATACAAACAAATGGAGG + Intergenic
916761437 1:167821073-167821095 GATAGGAAATAAAATAATAGGGG + Intronic
916846982 1:168661209-168661231 AAGAGGATACAAACAAATGGAGG - Intergenic
916899735 1:169207830-169207852 TAAAGAAAACAAAATAATGAAGG + Intronic
916941222 1:169680691-169680713 CAGAGGAAATATAACAAAGGAGG + Intronic
917382636 1:174430407-174430429 CAGAAAAAACAAAATCATGAGGG - Intronic
917651297 1:177080227-177080249 TATAGGAAAAAAAAAAATGGAGG - Intronic
917734607 1:177908984-177909006 CAGAGGAGGAAAAATACTGGAGG + Intergenic
918248369 1:182680379-182680401 CAGAGGAAATGAAATAAAGGAGG - Intronic
918752582 1:188290884-188290906 CACAGGAAACCTAATCATGGTGG + Intergenic
918760224 1:188394970-188394992 AAGAGGAAAGAAAAGAATAGTGG - Intergenic
919083071 1:192889783-192889805 CAAAGGAAAAATTATAATGGTGG - Intergenic
919170586 1:193948984-193949006 CAGAGAAACAGAAATAATGGCGG + Intergenic
919242856 1:194936824-194936846 GAGAGGGATCAAAATCATGGGGG - Intergenic
919413641 1:197278516-197278538 CAGAGGGAAAAAGGTAATGGAGG + Intronic
919578872 1:199346346-199346368 CAGAGGAAAAAAAAAGATAGAGG - Intergenic
920335944 1:205245202-205245224 CAGAGGGCACAAAATGAGGGAGG + Intronic
921590025 1:216992016-216992038 CAGAGGCCAAAAAATAATAGGGG + Intronic
921888584 1:220331021-220331043 GAGATGAAAAAAAATAATGAAGG + Intergenic
922667511 1:227485326-227485348 CATAGAAAATAAAATAGTGGGGG + Intergenic
923260070 1:232259772-232259794 CAAAGGAAAAAAAATGATTGGGG + Intergenic
923410004 1:233698715-233698737 CTCAGGAAACACAATCATGGTGG + Intergenic
1063234422 10:4097953-4097975 AAGAGGAAAATAAATAAAGGTGG - Intergenic
1063797528 10:9529405-9529427 CAGATGGAACATAATAATGAAGG - Intergenic
1064627955 10:17280880-17280902 CTCAGGAAACACAATCATGGTGG + Intergenic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1066083077 10:31951382-31951404 CACAGGAAAAAAAATATTAGTGG + Intergenic
1066224680 10:33370600-33370622 CAGAGGAAACAAGAGAGGGGAGG - Intergenic
1066582325 10:36894602-36894624 AAGAGGATACAAACAAATGGAGG - Intergenic
1066626142 10:37407672-37407694 AAGAGGACACAAACAAATGGAGG + Intergenic
1066664601 10:37770120-37770142 AAGAGGATACAAACAAATGGAGG + Intergenic
1067743202 10:48912672-48912694 TAGGAGAAACGAAATAATGGTGG - Intronic
1068599355 10:58939514-58939536 AAATGGAAACAAAATAATGCAGG + Intergenic
1068874167 10:61979226-61979248 CAGAGGAAACTCACTAATGTAGG - Intronic
1069056854 10:63853333-63853355 AAGAGGACACAAACAAATGGAGG - Intergenic
1070186564 10:74068775-74068797 CAGAGGAAATACAACATTGGAGG + Intronic
1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG + Intronic
1070674797 10:78405147-78405169 AAGAGCAAATGAAATAATGGAGG - Intergenic
1070945403 10:80387104-80387126 CAGAGGAAAAAAAAAAAGTGTGG + Intergenic
1071160473 10:82740101-82740123 TAAAGGAGACAAAATAATGAAGG - Intronic
1071197492 10:83178025-83178047 CTCAGGAAACACAATCATGGAGG + Intergenic
1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG + Intronic
1072364961 10:94699974-94699996 AAGAGGACACAAACAAATGGAGG + Intronic
1072384561 10:94911143-94911165 AAGAGGATACAAACAAATGGAGG + Intergenic
1072641825 10:97216730-97216752 CTCAGGAAACACAATTATGGTGG - Intronic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073512005 10:104048399-104048421 CAGAGGAGACAAGAACATGGAGG - Intronic
1074621671 10:115131764-115131786 CAAAGGATAAAATATAATGGAGG - Intronic
1074638286 10:115346181-115346203 AAGAGGAATGAAAATGATGGTGG - Intronic
1075297643 10:121292203-121292225 CAAAGAAAACAAAAAAAAGGGGG - Intergenic
1075513484 10:123091250-123091272 CAGTGGAAGCAAACTCATGGAGG - Intergenic
1076029750 10:127147392-127147414 CAAAGAAAACAAGATAATCGTGG - Intronic
1076034283 10:127186116-127186138 CAGAGGGAAAAAAACAATAGAGG + Intronic
1076089221 10:127666345-127666367 CAGAGGAAACACACTAAAAGTGG + Intergenic
1076498496 10:130915455-130915477 CAAAGAAAACAAAATTATTGGGG + Intergenic
1077622057 11:3734507-3734529 CAGAAGAAACAAATTTAGGGAGG + Intronic
1077834427 11:5912318-5912340 ATTTGGAAACAAAATAATGGAGG - Intronic
1077857020 11:6137707-6137729 AAGGGGAAATAAAATAAAGGGGG - Intergenic
1077932164 11:6744886-6744908 AACAGGAAGCAAAATTATGGGGG - Intergenic
1078742711 11:14082077-14082099 CAGAGGAAATAAAATGTTAGGGG + Intronic
1079477511 11:20846811-20846833 CATAGGAAACAAAATAGTTTTGG + Intronic
1080285982 11:30612738-30612760 AAGAGGAAACAAAAGAAAGAAGG - Intergenic
1080524665 11:33102804-33102826 CAGATGAACCCAAATAATAGAGG + Intronic
1081092808 11:38894090-38894112 CAGAGGACACAAAAACATAGAGG - Intergenic
1081280069 11:41198620-41198642 GAGAGGAAAAAAAAGTATGGAGG + Intronic
1081480438 11:43482147-43482169 AAGAGAAAACAAAAAGATGGTGG - Intronic
1082892450 11:58154454-58154476 AAGATGCAACAAAATAATGTTGG - Intronic
1085426389 11:76408579-76408601 CAGAGGAAATAAAATTATCTGGG + Intronic
1085711624 11:78834331-78834353 CAAAGGAAACAAAATAATATAGG - Intronic
1085941032 11:81207310-81207332 AAGATGAAACAAATTGATGGAGG - Intergenic
1085982457 11:81741544-81741566 CAGTGCACACAAAATAATGGGGG - Intergenic
1086562647 11:88186083-88186105 CAGAGGTAATTGAATAATGGGGG + Intergenic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1089708887 11:120300763-120300785 CTGAAAAAAAAAAATAATGGAGG + Intronic
1090506660 11:127322020-127322042 GAGAGGTAACTAAATCATGGGGG - Intergenic
1091012982 11:132023289-132023311 GAGAGGAGCCAAAATAATGTTGG + Intronic
1091565196 12:1642899-1642921 GAGAGGATAAAAAATAAAGGGGG - Intronic
1092417595 12:8302711-8302733 AAGAGGACACAAACAAATGGAGG - Intergenic
1092702228 12:11244848-11244870 CAGCAGAAAGAAAATGATGGAGG + Intergenic
1092711862 12:11346848-11346870 CAGCAGAAAGAAAATGATGGAGG + Intergenic
1092973706 12:13723885-13723907 CAGAGGAAAAAAACTAATAGTGG + Intronic
1093110169 12:15142447-15142469 CAGAGAGAACAAAATAAATGAGG - Intronic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1093819049 12:23589396-23589418 CACAGTAAACAAACTCATGGAGG + Intronic
1093884746 12:24446859-24446881 AGAGGGAAACAAAATAATGGAGG + Intergenic
1093900049 12:24621471-24621493 AAGAGGACACAAACAAATGGAGG - Intergenic
1093930163 12:24948408-24948430 CACAAGAAACAAAATAAGAGGGG + Intronic
1094069781 12:26400631-26400653 TAGAAGAAACAAAATATTTGAGG - Intronic
1094238665 12:28197334-28197356 CAGTGGAAACAAAATAGTATAGG - Intronic
1095242075 12:39872770-39872792 CAAAGAAAACAAAATACTGCTGG + Intronic
1095600042 12:44003198-44003220 CAGAGGGAACAAGGTAATGAAGG + Intronic
1095657080 12:44683063-44683085 AAGAGGATACAAACAAATGGAGG - Intronic
1096107928 12:49008992-49009014 CAGAGGGAAGGAAATAATTGAGG - Intronic
1096464593 12:51841221-51841243 CAGAGGGAAAAAGATACTGGGGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097739467 12:63222604-63222626 CAGCGGAACCAAAATAAAGAAGG + Intergenic
1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG + Intronic
1098178431 12:67819068-67819090 CAGAGGAAACGAGATGATGTAGG + Intergenic
1098194053 12:67980833-67980855 AAGAGGCACCAGAATAATGGTGG + Intergenic
1098198355 12:68026628-68026650 CTGAGGAAACAGAATCACGGTGG - Intergenic
1098295352 12:68998603-68998625 AAAAGGAAAATAAATAATGGTGG - Intergenic
1098395472 12:70012309-70012331 CAGTGGAGACAAAATAAAGAAGG + Intergenic
1098478353 12:70932910-70932932 CAGAGGAAACACAAAAAGAGAGG - Intergenic
1098604442 12:72373034-72373056 AAGAGGATACAAACAAATGGAGG - Intronic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1099778513 12:87165169-87165191 TGGAGGCAACTAAATAATGGGGG - Intergenic
1100085915 12:90910475-90910497 CACAGCAAACAAAATAACAGAGG + Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101371543 12:104136268-104136290 CAAAGGAAACAATTAAATGGGGG + Intronic
1101807312 12:108075711-108075733 GACAGGAAACAAAATAACAGTGG - Intergenic
1101814972 12:108139158-108139180 CTTAGGAAAGAAAATAATGAAGG + Intronic
1103508576 12:121457866-121457888 CAGAGGAACTCAAATATTGGTGG - Intronic
1103976896 12:124708532-124708554 CACAGAACCCAAAATAATGGTGG - Intergenic
1104352901 12:128060097-128060119 CAGAGAAAACAAAACAGAGGAGG - Intergenic
1106278163 13:28235274-28235296 AAGAGGATGGAAAATAATGGTGG - Intronic
1106316191 13:28596223-28596245 CATAGGAGACAAAGTCATGGCGG + Intergenic
1106982896 13:35311286-35311308 CAGTTGAAACAAAATAATTGTGG - Intronic
1107156533 13:37173663-37173685 CAGAAAAAAAAAAAAAATGGTGG - Intergenic
1107165123 13:37274694-37274716 CAGAGAAAATAAATTGATGGTGG + Intergenic
1107275888 13:38678746-38678768 CAGAGCAAACAAAATTATGAGGG + Intergenic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1108230571 13:48335913-48335935 CTGAGGAAAAAAGAGAATGGTGG + Intronic
1108328375 13:49358362-49358384 GAAAGGAAATAGAATAATGGTGG + Intronic
1108408976 13:50129259-50129281 CAGAGAAAAAAAAAAAAAGGTGG - Intronic
1108453073 13:50586665-50586687 AAAAGGAAACACAATAGTGGTGG - Intronic
1109178303 13:59182448-59182470 CAGAGGAAAAAAAAGCATGAAGG - Intergenic
1109297003 13:60545935-60545957 CATAGAAAACAAAATAAAAGAGG - Intronic
1109356893 13:61242333-61242355 CAGAGGAAATGAAATATTGAAGG - Intergenic
1109804839 13:67425644-67425666 CTCAGGAAACACAATCATGGTGG + Intergenic
1109905067 13:68829906-68829928 CAGAGGTAATTGAATAATGGGGG + Intergenic
1110338136 13:74356544-74356566 CACAGGATACAAAAGAATGCAGG - Intergenic
1110504667 13:76271794-76271816 CAGGGGATAGAAAAAAATGGAGG + Intergenic
1110715456 13:78698128-78698150 ATGAGGAAACCAAATTATGGTGG - Intergenic
1111328021 13:86724699-86724721 CTGAGGAAGAAAAACAATGGAGG + Intergenic
1111406069 13:87808956-87808978 CAAAGGAATAAAAATAATTGAGG - Intergenic
1111483878 13:88869251-88869273 CTCAGGAAATAAAATCATGGTGG - Intergenic
1111967479 13:94875574-94875596 AAGAGGACACAAACAAATGGAGG + Intergenic
1112126514 13:96474157-96474179 CAGAGGAAAAAAATTGAAGGAGG - Intronic
1112266924 13:97932788-97932810 GAGAGGAAAATAAATAATTGTGG - Intergenic
1112699810 13:101993761-101993783 CAGAGAAGGCAAAAAAATGGAGG + Intronic
1112853780 13:103739428-103739450 TAGAAGAAACAAAATATTGATGG - Intergenic
1112884311 13:104149578-104149600 CAAAGAAAACAAAGAAATGGAGG + Intergenic
1113010003 13:105753518-105753540 AAGAGGATACAAACAAATGGAGG - Intergenic
1113062648 13:106339966-106339988 CAGAGGATACAAACGAAGGGAGG + Intergenic
1113544285 13:111135444-111135466 AAGAGGACACAAACAAATGGAGG - Intronic
1113802314 13:113093017-113093039 CAGTGGGAACAAAAAAAGGGGGG - Intronic
1114352300 14:21866451-21866473 CAGAGGAAACAATACGAAGGAGG - Intergenic
1114748049 14:25171550-25171572 AAGAGGACACAAACAAATGGAGG + Intergenic
1114780576 14:25534008-25534030 CTCAGGAAACACAATCATGGTGG + Intergenic
1114887418 14:26871008-26871030 AACAGGAAACAAAGTGATGGAGG - Intergenic
1114999951 14:28410094-28410116 CAGAAGAAAAAAAAGAAAGGAGG + Intergenic
1115150235 14:30276344-30276366 AAGAGGAAAGGAATTAATGGAGG - Intergenic
1115505140 14:34086616-34086638 CTCAGGAAACACAATCATGGAGG + Intronic
1115710558 14:36046268-36046290 CAGAGGAAACGTAAAAATGCAGG + Intergenic
1116029336 14:39551848-39551870 AAGAGGATACAAACAAATGGAGG - Intergenic
1116096170 14:40371825-40371847 AAGAGTAAAGAAAATGATGGAGG - Intergenic
1116752887 14:48909118-48909140 CAGAGGGAACAAAATCCTGAAGG - Intergenic
1117263618 14:54062700-54062722 CAGAGGAAACAAAACATTATGGG + Intergenic
1117595586 14:57324151-57324173 CAGAGGAAAAAAAAAAAAGTAGG - Intergenic
1117895628 14:60483091-60483113 CAGTGGGAAAAAACTAATGGGGG + Intronic
1118262307 14:64259155-64259177 CAGAGAAAATAAAATAATTCTGG + Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118457498 14:65958132-65958154 CAGTGGAGACAAATTAATCGGGG - Intronic
1120317227 14:82910958-82910980 AAGAGAAAAAAAAGTAATGGAGG + Intergenic
1120406944 14:84102344-84102366 CTCAGGAAACAGAATTATGGTGG - Intergenic
1120549571 14:85853166-85853188 CAGTGGTACAAAAATAATGGTGG - Intergenic
1120633671 14:86924474-86924496 CAGAGGAAAAAAATTAAAAGAGG - Intergenic
1120715121 14:87833201-87833223 CAGAGGAAACAAAGTAATTTAGG - Intergenic
1120993738 14:90399066-90399088 CAGTGGAGACCAAATAATGCAGG + Intronic
1121762801 14:96460348-96460370 AAGAGGAGAGAAAATAAAGGTGG - Intronic
1124725234 15:32150680-32150702 CAAAGGAACTAAAATATTGGAGG + Intronic
1124891085 15:33733634-33733656 CAGTGGAAACAGTATAATGATGG + Intronic
1124897012 15:33786630-33786652 CAGAGGACACAAAATATTTGTGG - Intronic
1124908270 15:33892867-33892889 AAGAGGACACAAACAAATGGAGG - Intronic
1124969792 15:34476096-34476118 CAAAGGAAAAAAAATCATGTAGG - Intergenic
1125245237 15:37629074-37629096 CTTAGGAAACAAAATAATTAAGG + Intergenic
1125422369 15:39517600-39517622 CAGAGGAACCAACATCCTGGAGG + Intergenic
1125701139 15:41685414-41685436 CAGGACAACCAAAATAATGGGGG - Intronic
1126288076 15:47039006-47039028 AGGAGTAAACAAAATAATGAAGG + Intergenic
1128891527 15:71336071-71336093 AAGAGGAAATAAAGTGATGGAGG + Intronic
1130322461 15:82852665-82852687 GAGATGAAACAGAATAATGCAGG - Intronic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1131030957 15:89185606-89185628 CAGGGGAAAAAAAAAAATGCAGG + Intronic
1131080380 15:89529521-89529543 AGGAGGAAACAAAATTATAGTGG + Intergenic
1131642559 15:94308067-94308089 CAGAGGAAACCAAATAGATGTGG - Intronic
1132035084 15:98476099-98476121 CTCAGGAAAAAAAATAATGGTGG + Intronic
1132110707 15:99100125-99100147 CAGAGGCAAGAAAATATTGAAGG - Intronic
1132930710 16:2457807-2457829 CAGGTGAACCTAAATAATGGTGG - Exonic
1133497932 16:6337497-6337519 GAGTGGAAATAAATTAATGGGGG + Intronic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134283802 16:12842478-12842500 CAGAGGAAACAAATTGAAGTAGG - Intergenic
1134388675 16:13797892-13797914 AAGAGGAAAGAAAGTAATGAGGG + Intergenic
1134898370 16:17910892-17910914 AAGAGGACACAAACAAATGGAGG + Intergenic
1135107277 16:19661264-19661286 CGGAGGAAAAAAAATAGAGGGGG - Intronic
1135387826 16:22059725-22059747 TAGAGGAAACTGAATCATGGGGG - Intronic
1136560611 16:31037060-31037082 CAAAGGAAAAAAAAAAAAGGGGG - Intronic
1137247746 16:46719376-46719398 CGGAGGAAACAGAATCCTGGAGG + Intronic
1137335310 16:47542644-47542666 AAGAGGACACAAATAAATGGAGG - Intronic
1137549084 16:49424550-49424572 CAAAGGAAAGAAAATCATGGAGG + Intergenic
1137706592 16:50539794-50539816 CAGAAGAAACAAAATGATGTGGG + Intergenic
1138720787 16:59076737-59076759 AAGAGGATACAAACAAATGGAGG + Intergenic
1140532774 16:75681138-75681160 CAGAAAAAACAAAATAATCTTGG + Intronic
1140543601 16:75784288-75784310 CACAGCAAAGAAAACAATGGAGG - Intergenic
1140818009 16:78638424-78638446 CAGAGGAAACAAAAAAAAAATGG - Intronic
1143427340 17:6850498-6850520 CTCAGGAAACAAAATCATGATGG + Intergenic
1143757463 17:9077367-9077389 CAGAGGCAACAGGATATTGGAGG + Intronic
1144040281 17:11404456-11404478 CAGAGGAAAGAAAATATCTGTGG + Intronic
1144666293 17:17104649-17104671 CAGCGGAAAGAAAACAATTGGGG - Intronic
1145396376 17:22498598-22498620 AAGAGGACACAAACAAATGGAGG - Intergenic
1146135671 17:30318809-30318831 TAGAAGAAAGAAAATAATGAAGG - Exonic
1146369758 17:32258263-32258285 CAGATGGAAAAAAAAAATGGAGG + Intergenic
1147557120 17:41486572-41486594 CTGAGGAAACAAAATCATGCAGG + Intronic
1147971788 17:44222110-44222132 GAGAGGAAAAAAATTAAAGGGGG - Intergenic
1148720399 17:49748482-49748504 CTGAGGAATCAAGAGAATGGTGG + Intronic
1148906669 17:50916846-50916868 CAGAGGAAATAAAGAAAGGGCGG - Intergenic
1148950721 17:51309433-51309455 AAGAGGACACAAACAAATGGAGG + Intergenic
1149080203 17:52647077-52647099 TAGAGAAGACAAAATAAGGGAGG - Intergenic
1149240542 17:54643694-54643716 AAGAGGACACAAACAAATGGAGG + Intergenic
1149474898 17:56952437-56952459 CAGTGGAAAAAAAATTATGCTGG + Intronic
1150177672 17:63078427-63078449 CAGAAGAAAGAAAATAATAAAGG - Intronic
1150864502 17:68835333-68835355 CAGAGGAAGCAAAATGATACAGG - Intergenic
1151921524 17:77159738-77159760 CAGATGGAATAAAATAGTGGTGG - Intronic
1152163157 17:78682219-78682241 CACTGGAACCAAAATTATGGAGG + Intronic
1152165821 17:78704915-78704937 CTTAGGAAACAAAGTCATGGGGG + Intronic
1152326930 17:79647022-79647044 CAGAGGAAATAAAATCAAGGAGG - Intergenic
1152504239 17:80737112-80737134 CAAAGGAAAAAAAATTATGCTGG - Intronic
1153026261 18:675689-675711 CAGAGGAACCCAAATAATTCTGG - Intronic
1154049094 18:10936443-10936465 CTTAGGAAACCAAAGAATGGAGG + Intronic
1154364465 18:13694222-13694244 AAGAGGACACAAACAAATGGAGG + Intronic
1155471065 18:26193549-26193571 CAGAGGAATGAAAATAGTAGGGG + Intergenic
1155596078 18:27489136-27489158 AAGAGAACTCAAAATAATGGTGG + Intergenic
1156971297 18:43160201-43160223 CAGAGGAATAAAAATAATGATGG + Intergenic
1158437701 18:57445166-57445188 CAAATGAACCAAAATAATTGTGG - Intronic
1158447545 18:57534180-57534202 CCCAGAAAACAAAAGAATGGAGG + Intergenic
1158552323 18:58446507-58446529 CTGAGGAAACAGAATAATCATGG - Intergenic
1158663654 18:59412821-59412843 CCTAGGAACCAAAATAAAGGAGG - Intergenic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1159110988 18:64056498-64056520 CACAGGAAACAAAATAATATAGG + Intergenic
1159609539 18:70510514-70510536 CAGATAAAACAAAATAATGAAGG - Intergenic
1162864995 19:13538982-13539004 GTGAGAAAACAAAATAATCGTGG + Intronic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
925258448 2:2509368-2509390 CAGATGAAACAAAACAACAGAGG - Intergenic
926512988 2:13805595-13805617 CAGAAGACAGAAAATAATAGCGG - Intergenic
926582428 2:14645709-14645731 CAAAGGAAACAAAATCATTGTGG - Intronic
927098777 2:19770638-19770660 CTCAGGAAACACAATCATGGTGG + Intergenic
927658606 2:24972416-24972438 CAAGGGGAACAAAATATTGGAGG - Intergenic
928696532 2:33855209-33855231 GGTAGGAAACAAAATAATTGAGG - Intergenic
928899390 2:36301180-36301202 CTCAGGAAACACAATCATGGTGG + Intergenic
930284140 2:49406892-49406914 CAAAGGAAACAATAGAATGAAGG - Intergenic
930326140 2:49921322-49921344 GAGAGGAAAAAAAAGTATGGAGG - Exonic
930341061 2:50115327-50115349 CAGAAGAAACAAATTTCTGGGGG + Intronic
930596581 2:53397030-53397052 CAGTGGAAAAAACATAATGGTGG + Intergenic
930662860 2:54072546-54072568 AAGAAGAAAGAAAATAATGAAGG - Intronic
930673509 2:54176288-54176310 AAGGGGAAAGAAAATAGTGGAGG - Intronic
931156581 2:59638738-59638760 AAGAGGATACAAACAAATGGAGG - Intergenic
931819273 2:65935217-65935239 AAGATGAGACAAAATAGTGGAGG + Intergenic
932848134 2:75155653-75155675 CACAAGAAATATAATAATGGAGG - Intronic
933089323 2:78100758-78100780 CAAAAGAAAGACAATAATGGAGG + Intergenic
933150977 2:78914925-78914947 TAGAGGAAACAAAATCAGAGAGG - Intergenic
933949619 2:87317370-87317392 CTCAGGAAACACAATTATGGTGG + Intergenic
934314637 2:91905825-91905847 AAGAGGATACAAACAAATGGAGG + Intergenic
935170687 2:100609293-100609315 CAGAAGACACTAATTAATGGAGG - Intergenic
935546588 2:104406031-104406053 CACAGGAAAAAAAAAAAGGGGGG - Intergenic
935695278 2:105766116-105766138 TAAAGGAAACAAAAGAATGAGGG + Intronic
935822315 2:106906545-106906567 CAGAGAAACAAAAATCATGGAGG - Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936330574 2:111544227-111544249 CTCAGGAAACACAATTATGGTGG - Intergenic
936484099 2:112911844-112911866 CAAAGGACACAAAAAATTGGAGG - Intergenic
936550255 2:113432010-113432032 CAAAGGAAACAACATACTAGTGG - Intergenic
937186363 2:120047305-120047327 AAGAGGACACAAACAAATGGAGG - Intronic
937585180 2:123538283-123538305 CAGAGGAAATATAAAAATTGAGG - Intergenic
938164750 2:129016982-129017004 CAGAGGAAAAAAAATGCTAGTGG - Intergenic
938388446 2:130884751-130884773 CCCTGGAAACAAAATAATGAGGG - Intronic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
939510179 2:143095269-143095291 CAGAGCAAAGAAAATAATTCAGG + Intronic
940517859 2:154703583-154703605 CAGATGCAATAAAAAAATGGTGG + Intronic
941181579 2:162265772-162265794 AAGAAGAAACAAAATGTTGGAGG - Intergenic
941259845 2:163284009-163284031 AAGAGGACACAAACAAATGGAGG + Intergenic
942022335 2:171878645-171878667 CAGTTGGAACAAAGTAATGGAGG - Intronic
942355112 2:175102756-175102778 AAGAGGAAAAAAAAAAAAGGAGG + Intronic
942710008 2:178823168-178823190 CAGAGAAAAAATAATCATGGTGG - Intronic
944046699 2:195419951-195419973 CAGAGGAGACAGGATAATGATGG - Intergenic
944183268 2:196919689-196919711 CAGAGGAAACACATTTATGTTGG - Intronic
944690647 2:202155655-202155677 CAGAAGAAACCAAATACTTGCGG + Intronic
944803483 2:203259021-203259043 CAGAGAAGACAAAATAATTAAGG - Intronic
945137747 2:206646824-206646846 CAAAAGAAAAAAAATATTGGAGG - Intergenic
945300166 2:208208541-208208563 CAGAGGACACAAGGCAATGGTGG - Intergenic
945314492 2:208357173-208357195 CAGAGGTAAAAAAATAAATGTGG + Exonic
946084265 2:217155295-217155317 CAGAAGGAACAAAGTCATGGAGG - Intergenic
946650397 2:221887039-221887061 CAGAGGGAAAAAAAAAAGGGAGG - Intergenic
946651602 2:221897488-221897510 CACAGAATAAAAAATAATGGAGG - Intergenic
946957938 2:224952505-224952527 GAAAGGAAGAAAAATAATGGTGG + Intronic
947084527 2:226436327-226436349 CAGAGGTCACATAATCATGGCGG + Intergenic
947820878 2:233068698-233068720 CAGAGGAGAGAAGAGAATGGGGG + Intronic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
948734000 2:239987053-239987075 CAGAGGAAACAATTCAATGCAGG + Intronic
1168918845 20:1514193-1514215 CAAAGGAAAAAAATAAATGGAGG - Intergenic
1169240979 20:3980626-3980648 CAGAGTATACAAAAAAATGATGG + Intronic
1169768569 20:9176163-9176185 TAGAGGAAACAATAGCATGGAGG - Intronic
1169939634 20:10923324-10923346 CAGAGTAACCCAACTAATGGGGG + Intergenic
1169988201 20:11470306-11470328 CTGAGGAAATAGAATAATGTTGG - Intergenic
1170031601 20:11949749-11949771 AAGAGGAAACAAAATAACTAGGG - Intergenic
1170296941 20:14837741-14837763 CATAGGAAACAAAATACTAATGG + Intronic
1170542830 20:17406427-17406449 CAAAGGCAACAAAATAATTGGGG + Intronic
1170622140 20:18005162-18005184 CAGAGGAAACATAAAATGGGAGG - Intronic
1170819148 20:19741354-19741376 GAGAGAAAACAAAATAAAAGAGG + Intergenic
1171786269 20:29467787-29467809 AAGAGGATACAAACAAATGGAGG - Intergenic
1172259752 20:33552848-33552870 CAGAGGGAACAGAATAATATAGG - Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173049715 20:39547479-39547501 AACAGAAAACAAAATAATGAGGG - Intergenic
1174541461 20:51292987-51293009 CTCAGGAAACACAATCATGGCGG + Intergenic
1174772100 20:53309866-53309888 CCGAGGAAACAAAAGCAAGGAGG + Intronic
1176918132 21:14650660-14650682 TAGAAGAAACAAAATAATAAAGG + Intronic
1177182755 21:17760658-17760680 CAGAAGAACCAAAATAACAGTGG - Intergenic
1177288735 21:19083014-19083036 CAGAGGTAACTAAATCATGAGGG - Intergenic
1177332315 21:19680105-19680127 CAAAGGAGAAAAAATAGTGGAGG + Intergenic
1177523281 21:22259197-22259219 CAGAAGCAACCAAATCATGGAGG + Intergenic
1177566074 21:22822130-22822152 CAGAAGCAATAAAATAATAGTGG + Intergenic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1178145877 21:29739300-29739322 GAGAGGAAACGGAATAAGGGAGG + Intronic
1178266605 21:31148279-31148301 GAGAGGTAACTGAATAATGGAGG + Intronic
1178435056 21:32550902-32550924 CAGTGGAAATAAAATAGGGGAGG - Intergenic
1178760685 21:35399524-35399546 AAGAGGCAACAAAACAATGCAGG + Intronic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1181555296 22:23667468-23667490 AAGAGGATACAAACAAATGGAGG + Intergenic
1182786516 22:32912318-32912340 CAGAGGAAACAGAATACGTGGGG + Intronic
1184635146 22:45822087-45822109 GACAGGAAACAAAAGAATGCAGG - Intronic
1184956412 22:47889772-47889794 CTCAGGAAACACAATTATGGTGG - Intergenic
1185226677 22:49657442-49657464 CTCAGGAAACACAATCATGGCGG + Intronic
949725768 3:7042515-7042537 CAGAGAAAAAGAAAGAATGGGGG - Intronic
949904742 3:8849751-8849773 CAAAGGAAAAAAAAAAATGCTGG - Intronic
950099232 3:10346949-10346971 GAGAGGAAACAAAGTGATGCTGG - Intronic
950841406 3:15971707-15971729 CAAAGCAAACAAAATAAAGTGGG + Intergenic
951034849 3:17921632-17921654 CTCAGGAAACACAATCATGGTGG - Intronic
951436811 3:22675108-22675130 CAGAGGACACAAAATAAAAAAGG - Intergenic
952014938 3:28945309-28945331 CTCAGAAAACAAAATGATGGGGG - Intergenic
952134851 3:30406886-30406908 CAGAGGAGATAAAATAATTTTGG + Intergenic
952539203 3:34349203-34349225 CCAAGGAAACAAAATTAGGGAGG + Intergenic
953778818 3:45847345-45847367 CAGCGGAGACAACATCATGGAGG - Intronic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
955255686 3:57329058-57329080 AAGAGGATACAAACAAATGGAGG + Intronic
956182002 3:66526220-66526242 CAGAGTAAAAAAAAAAATTGGGG - Intergenic
956504054 3:69918796-69918818 CAGAGAAAAGAAAATAAGAGAGG - Intronic
957784636 3:84866335-84866357 CTCAGGAAACACAATCATGGTGG - Intergenic
957883191 3:86248601-86248623 CAGAAGAAAAAAAAAAAGGGGGG + Intergenic
958054047 3:88386514-88386536 GAGAGACAACAAAATAATTGAGG + Intergenic
958090838 3:88874195-88874217 AAGAGGATACAAACAAATGGAGG + Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
959044674 3:101460311-101460333 TAGAGTAATCAAAATAATGTTGG + Intronic
959134005 3:102393877-102393899 TAGAGAAAACAACATAATGCAGG + Intronic
959351398 3:105269146-105269168 CTCAGGAAACAAAATCCTGGTGG - Intergenic
959432820 3:106275872-106275894 TAGAGGAAATTAAATTATGGGGG - Intergenic
959474511 3:106792258-106792280 CAGAGGAAACAAAAGAATAAAGG + Intergenic
959563404 3:107808945-107808967 CTGGAGAAACAAAATAATGATGG + Intronic
960125840 3:113997578-113997600 CAAAAAACACAAAATAATGGGGG + Intronic
960208913 3:114936119-114936141 TGGAGGAAACACAATAATGGAGG + Intronic
960297547 3:115962248-115962270 CACATGAAAGAAAAAAATGGTGG - Intronic
960337039 3:116430230-116430252 CAGTGGGAAGAAAATAATAGAGG + Intronic
960374786 3:116886213-116886235 CAGAGTAAATGAAATAATGAAGG - Intronic
960831176 3:121850473-121850495 TAGAGGTAGGAAAATAATGGAGG - Intronic
961702079 3:128752517-128752539 ATGAGGAAACAACATAATTGTGG + Intronic
962224394 3:133593475-133593497 GAGTGCAAACAAATTAATGGAGG + Intergenic
963277486 3:143347403-143347425 CAAAGGAAACAGATAAATGGAGG + Intronic
964259692 3:154821636-154821658 AAGAGGATACAAACAAATGGAGG - Intergenic
964472871 3:157072731-157072753 CAGATGAAACAACATACTTGTGG + Intergenic
964639431 3:158893019-158893041 CAGAGGAAATATTATAAAGGTGG - Intergenic
964681698 3:159347013-159347035 CTGCGGAAAAAAAATAAGGGAGG - Intronic
964708111 3:159642675-159642697 CTGAGGATATAAAATATTGGGGG + Intronic
965050576 3:163642011-163642033 AAGAGGACACAAACAAATGGAGG + Intergenic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
966414635 3:179676170-179676192 CTCAGGAAACAAAATCATGGCGG - Intronic
967423651 3:189301565-189301587 CAGAAGAAGAAAAAAAATGGAGG - Intronic
967480788 3:189970982-189971004 CAAAGGAAACTTACTAATGGAGG - Intronic
967580010 3:191141374-191141396 CATAGAAAACAAAATAATCTGGG + Intergenic
968276317 3:197443083-197443105 CTGATGAAAAAAATTAATGGAGG + Intergenic
969103496 4:4787691-4787713 CTCAGGAAACACAATCATGGCGG - Intergenic
970806667 4:20044204-20044226 CAGAGGAAAAAAACAAATTGGGG - Intergenic
970917864 4:21356663-21356685 AAGAGGACACAAACAAATGGAGG + Intronic
971214341 4:24649541-24649563 CAGAGGGGACAAAATAAATGTGG + Intergenic
971551338 4:27960643-27960665 CAGAGCAGAGAAAAGAATGGTGG + Intergenic
971969335 4:33601384-33601406 AGGAGGTAACTAAATAATGGGGG + Intergenic
971977022 4:33703383-33703405 CAGAGGCAACTGAATCATGGGGG + Intergenic
972002808 4:34059665-34059687 CAGAGGTAATTGAATAATGGGGG - Intergenic
972439578 4:39073979-39074001 CATAAGCAAAAAAATAATGGTGG - Intronic
973860513 4:55060120-55060142 AAGAGGATACAAACAAATGGAGG + Intergenic
974084896 4:57249371-57249393 CAGTGGAGACAATAAAATGGAGG - Intergenic
974315656 4:60277255-60277277 CAGAAGAAAGAAAATAATAAAGG - Intergenic
975123552 4:70756248-70756270 CAGAGGAAAATAAATAATAAAGG - Intronic
975190876 4:71460647-71460669 CAGGGGAAATAAAAAAATGAGGG + Intronic
975267624 4:72389350-72389372 GAGAGGAAATAAATTAGTGGTGG + Intronic
975928572 4:79490711-79490733 AAGAGGCAACACAATAATAGTGG - Intergenic
976926591 4:90505363-90505385 CAGAGGAACCAAAATCAAAGCGG + Intronic
976974509 4:91150123-91150145 AAGAGGATACAAACAAATGGAGG - Intronic
977138726 4:93339789-93339811 CTCAGGAAACACAATCATGGTGG + Intronic
977211400 4:94222448-94222470 CAGAGGAAATAGTATAATGTTGG - Intronic
978758000 4:112324957-112324979 CTGAGGAACCAAAAAAAAGGGGG + Intronic
979013732 4:115404299-115404321 CAGATGAACCTAAATAATGGTGG + Intergenic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
979901525 4:126225268-126225290 GAGAGGACACACAATCATGGTGG - Intergenic
980547421 4:134285707-134285729 CAGAGGAAAAAAAATATTGATGG + Intergenic
980726506 4:136768654-136768676 AAGAGGAAAACAAATAATAGGGG - Intergenic
980862341 4:138514516-138514538 TAGAGGATAAAAAATAATGAGGG - Intergenic
981436293 4:144726886-144726908 CACACAAAACAAAATAATGATGG - Intronic
981513085 4:145578829-145578851 AAGAGGACACAAACAAATGGAGG + Intergenic
981999137 4:151005986-151006008 CATAGGAAACAAAATAATAAAGG + Intronic
982238399 4:153273776-153273798 TACAGGAAACAATATAATAGAGG + Intronic
982258640 4:153473884-153473906 CAGAGGTAAGGAAAAAATGGGGG + Exonic
982933480 4:161439244-161439266 CAGAACAAACAAACAAATGGTGG + Intronic
983336973 4:166408562-166408584 CAGAGGAAAAGAAACACTGGAGG + Intergenic
983585431 4:169349116-169349138 TTGACAAAACAAAATAATGGAGG - Intergenic
983909249 4:173218456-173218478 CAAAGGAAACAAAATATTGAGGG - Intronic
984193273 4:176629491-176629513 CAGAGGAACCATAAAATTGGAGG + Intergenic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
984459273 4:180012434-180012456 CAGAGGAAACAAATTTATGTGGG - Intergenic
984533027 4:180940842-180940864 ATGATGAAACAAAATTATGGAGG + Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984715651 4:182922350-182922372 AGGAGCAAACAAAATAAGGGAGG + Intergenic
985092505 4:186378528-186378550 CAGAGAAAAGAACATCATGGTGG - Intergenic
985182791 4:187283001-187283023 GAGAGGCTACAAAATCATGGGGG - Intergenic
985851855 5:2394271-2394293 TAGAGAAAAAAAAATAAAGGAGG + Intergenic
987157202 5:15101134-15101156 AAGAGGACACAAACAAATGGAGG + Intergenic
987360470 5:17101915-17101937 CAGAGGAAAAAATATTGTGGAGG + Intronic
987445496 5:18013402-18013424 CATCGGAAAAAAAATAATGATGG + Intergenic
988053885 5:26066802-26066824 TAGAGGAAAAGAAATGATGGGGG - Intergenic
988083679 5:26445299-26445321 CAGAGGACCCAAAATTTTGGGGG - Intergenic
988119455 5:26942114-26942136 CTCAGGAAACACAATCATGGTGG + Intronic
988389931 5:30615250-30615272 CAAAAGAAACAAAACAATGGTGG - Intergenic
988434876 5:31162680-31162702 TAGAGGAAACAATAGAATTGGGG - Intergenic
989144749 5:38237687-38237709 CAGAGGAATAAAAACAATGAAGG + Intergenic
989197162 5:38726884-38726906 CTCAGGAAACACAATCATGGCGG + Intergenic
989364805 5:40643723-40643745 AAGAGGATACAAACAAATGGAGG - Intergenic
990199335 5:53353568-53353590 CAGAGGAAGCACTATAGTGGGGG + Intergenic
990884025 5:60571600-60571622 AAGAGGATACAAACAAATGGAGG - Intergenic
990888303 5:60619636-60619658 AAGAGGATACAAACAAATGGAGG + Intronic
990906298 5:60806941-60806963 CAGAGGCAACCAAATAAGGAAGG + Intronic
990977171 5:61570269-61570291 AAGAAGAAAGAAAATGATGGGGG + Intergenic
991111509 5:62905270-62905292 CTTAGGAAACATAATCATGGTGG + Intergenic
991529533 5:67599973-67599995 AAGAGGACACAAACAAATGGAGG - Intergenic
992576882 5:78122693-78122715 AAGAGGATACAAACAAATGGAGG + Intronic
992632324 5:78693933-78693955 CAGAGAAAGCAAAATAGTGCGGG + Intronic
992967329 5:82016348-82016370 CAAAGCAAACAAAATAAAGTGGG - Intronic
993069100 5:83135618-83135640 CACAGGAAGCAAAAAAATGGTGG - Intronic
993415447 5:87624327-87624349 CTGAGGAAAGAAAATATTGATGG - Intergenic
993713662 5:91253019-91253041 CTCAGGAAACACAATCATGGTGG - Intergenic
994412043 5:99418899-99418921 AAGAGGAAACAAAATAAAAGTGG - Intergenic
994481781 5:100346361-100346383 AAGAGGAAACAAAATAAAAGTGG + Intergenic
994615897 5:102103898-102103920 GAGAGGAAACAAAAAAGGGGAGG + Intergenic
994622141 5:102176460-102176482 TAGAGAAAGCAAAACAATGGTGG - Intergenic
994679882 5:102873266-102873288 GAGGGGAAACAGAAAAATGGTGG - Intronic
995299867 5:110566936-110566958 GAGAGGCCACAAAATCATGGTGG + Intronic
995341829 5:111069695-111069717 AAGAGGAAACAAAAAAAGGGAGG + Intergenic
995489173 5:112672010-112672032 TAGAGGAGACAAAATAACAGAGG - Intergenic
996205654 5:120732334-120732356 CAGATCAACCAAAAAAATGGAGG - Intergenic
996539071 5:124610142-124610164 AAGAGGACACAAACAAATGGAGG + Intergenic
997017136 5:129949175-129949197 CAGCAGCAACAAAATAATAGTGG + Intronic
997111026 5:131074534-131074556 AAGAGGATACAAACAAATGGAGG + Intergenic
998087582 5:139339332-139339354 CATGGAAAACAAAATAATGAAGG - Intergenic
999504878 5:152184262-152184284 CAGAGGAAACACCACAAAGGGGG - Intergenic
999830228 5:155311881-155311903 CAGAGGAAACATATGAATGGTGG + Intergenic
1000165699 5:158646515-158646537 GAGAGGAAAAAAAAAAAAGGAGG - Intergenic
1000801738 5:165736576-165736598 CAGAGATATCAAAATAATGATGG - Intergenic
1002257597 5:177969914-177969936 CAGAGGAAAAAAATTAGTGCTGG + Intergenic
1002628739 5:180553166-180553188 TAGAGAAAATGAAATAATGGGGG - Intronic
1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG + Intergenic
1003485780 6:6577916-6577938 CAGAGGACACTATATAAAGGAGG - Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004429837 6:15533396-15533418 CTGAGGAAACAGAATAACTGGGG + Intronic
1004731280 6:18361659-18361681 AAGATAAAAAAAAATAATGGGGG - Intergenic
1005328772 6:24728696-24728718 AAAAGGAAACATAATAATTGAGG + Intergenic
1005388784 6:25312405-25312427 CAGAAGAAAAAAAAAATTGGTGG - Intronic
1005442995 6:25891449-25891471 CAAAGGAAAAAAAATTTTGGAGG - Intergenic
1005731797 6:28704729-28704751 CAGAGAATACAAAATATTGATGG + Intergenic
1005831186 6:29672526-29672548 CAAAGGAGACAAAACAAAGGAGG - Exonic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1006030324 6:31172834-31172856 CAGAGGCAACATAAGAGTGGGGG - Intronic
1006246825 6:32744422-32744444 CAGAGGAAAAAAAAAAGTGGGGG + Intronic
1007866385 6:44974428-44974450 CAGAGGAGAAAGAATATTGGAGG - Intronic
1008197714 6:48545115-48545137 CAGAGGATAGAGAGTAATGGAGG + Intergenic
1008208484 6:48691546-48691568 CAGAGAAAAGAAACTAATAGAGG + Intergenic
1008209858 6:48707734-48707756 CACAGAAAAAAAAATCATGGAGG - Intergenic
1008902582 6:56638505-56638527 CAGAGGAAAAAAAATGATGCTGG - Intronic
1009498771 6:64384537-64384559 GAGAGGAAATAAAATAATTATGG - Intronic
1009738074 6:67705042-67705064 GAGAGGAAAAAAAAAAATGAGGG + Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1010021693 6:71167694-71167716 CAGAGGTAATTAAATGATGGGGG + Intergenic
1010528197 6:76929487-76929509 CAGGGGAAACAAGATAGTGTAGG + Intergenic
1011539072 6:88410869-88410891 AAGAGGATACAAACAAATGGAGG + Intergenic
1011953747 6:92999656-92999678 AAGAGGACACAAACAAATGGAGG + Intergenic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1012088096 6:94855490-94855512 AAGAGGATACAAACAAATGGAGG + Intergenic
1012089133 6:94869929-94869951 AAGAGGATACAAACAAATGGAGG - Intergenic
1012191840 6:96288686-96288708 CCCAGTAAACAAAATACTGGGGG + Intergenic
1012300291 6:97578860-97578882 GAAAGGAAACAAGATAATGAAGG - Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1012965049 6:105665013-105665035 CAAAGGAAAAAAAATCATGAAGG - Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013068714 6:106708804-106708826 CAGAGGAAATAAAATTATCAAGG - Intergenic
1013835309 6:114328015-114328037 CAGTGGAAATGAAATAATAGAGG + Intronic
1013894480 6:115069557-115069579 CAAAAGGAACTAAATAATGGAGG - Intergenic
1014181448 6:118388983-118389005 CATGGAAAACAAAATTATGGAGG + Intergenic
1014194356 6:118535597-118535619 GAGAGGAAACAAAATGGTGTGGG - Intronic
1014337730 6:120158909-120158931 CAGAGGAAACAGACCAATGAAGG - Intergenic
1014951357 6:127559231-127559253 CTCAGGAAACACAATCATGGAGG - Intronic
1015066122 6:129031079-129031101 AAGAGGAAACAGAATATTTGTGG + Intronic
1016737729 6:147498177-147498199 CTGAGGAAACAAAATCATTCAGG - Intergenic
1018501237 6:164413027-164413049 AAATGGAATCAAAATAATGGAGG - Intergenic
1018509076 6:164505823-164505845 CAGAGGAAACAATATGGTAGAGG - Intergenic
1020262339 7:6537221-6537243 CAGAAGAAAAAAAATACTGGTGG - Intronic
1020562952 7:9754342-9754364 GAGAGGTAATTAAATAATGGGGG - Intergenic
1021064413 7:16155856-16155878 CAAAAGAAACACAATAATAGAGG + Intronic
1021781477 7:24110962-24110984 CATATGAAATAAAAAAATGGAGG + Intergenic
1023240867 7:38146202-38146224 GAGAGAGAACAAAATAATTGTGG + Intergenic
1023278093 7:38542046-38542068 AAGAGAAAAAAAAATATTGGTGG + Intronic
1023323260 7:39024149-39024171 AAGAGGATACAAACAAATGGAGG - Intronic
1023454034 7:40319231-40319253 AAGAGGAAACAAATTAATTCTGG - Intronic
1023672120 7:42588083-42588105 GAGAGGAAACAAGAGAATCGAGG - Intergenic
1024263721 7:47590701-47590723 AAGAGAAAAGAAAATAATGCCGG + Intergenic
1024440342 7:49408893-49408915 CAGAGCAAAAAAAAAAAGGGGGG + Intergenic
1026182647 7:68055667-68055689 CAGATGGAAAAAAATAAAGGAGG + Intergenic
1026328187 7:69329216-69329238 CAGAGGAAAGGAAAAAAGGGAGG - Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1027447604 7:78292430-78292452 AAGAGGACACAAACAAATGGAGG + Intronic
1028055755 7:86240608-86240630 CACAAGAAACAAAATAAAAGGGG + Intergenic
1028187591 7:87805856-87805878 AAGAGAATCCAAAATAATGGTGG + Intronic
1029316728 7:99722490-99722512 GAAAGGAAACAAAATAGAGGAGG + Intronic
1029436240 7:100565500-100565522 CTGGGGAAGCAAAACAATGGGGG - Exonic
1029954692 7:104625533-104625555 CAGAGGAACAAAATTAAAGGAGG - Intronic
1031184585 7:118460407-118460429 CAGAGGAAAATAAAAATTGGAGG + Intergenic
1031261596 7:119527773-119527795 CAGATGAAAAGAAATAATGAAGG + Intergenic
1031901298 7:127414519-127414541 GAGAGGAAACACAAGAGTGGAGG - Intronic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1032382182 7:131496915-131496937 CAAAGCAAATAAAATAAGGGTGG - Intergenic
1032970532 7:137158179-137158201 AACAGTAAACAAAATAAAGGAGG - Intergenic
1033166720 7:139045319-139045341 CAGAAGAAACTAAATGATAGAGG + Exonic
1033882876 7:145908314-145908336 CAGAAAAAAAAAAAAAATGGTGG + Intergenic
1034141184 7:148818652-148818674 CACAGGAAAAAAAAAAATGTTGG - Intronic
1034477640 7:151296021-151296043 CTCAGGAAACACAATCATGGTGG + Intergenic
1034557063 7:151856843-151856865 CTAAGGAAACAAGATAAAGGAGG + Intronic
1034571425 7:151959598-151959620 CAGAGGATACAGATTAAGGGAGG - Intronic
1034585743 7:152090802-152090824 CTGAGGAAAGAAAATAAAGCAGG - Intronic
1034824971 7:154253856-154253878 CTTAGGAAACACAATTATGGTGG + Intronic
1035477401 7:159152973-159152995 CAGAGGAAACAAAAAGGTAGAGG - Intergenic
1035700470 8:1635268-1635290 CTGGGAAAACAAAATTATGGAGG + Intronic
1036048065 8:5166113-5166135 GAGAGGAAAAAAAATGATGGAGG + Intergenic
1036608518 8:10329514-10329536 CAGATGTAACTAAATAAGGGGGG - Intronic
1036978448 8:13441706-13441728 AAGAGGATACAAACAAATGGAGG + Intronic
1037231634 8:16665520-16665542 CAAAGGAGACAAAAAAGTGGAGG + Intergenic
1037294448 8:17385782-17385804 CACAGGAAACACAATCATGGTGG - Intronic
1038003106 8:23407137-23407159 CAGATGAAACAAAATGATGGCGG + Intronic
1038306945 8:26413496-26413518 CAGAGGAAACTGAAAAATGTAGG + Intronic
1038348526 8:26755190-26755212 CAGAGAAAAAAAAAAAAAGGAGG - Intronic
1038365811 8:26933183-26933205 CAGAACAAAGAAAATAATGGTGG + Intergenic
1039204606 8:35137577-35137599 CTGGGGGAACAAAAAAATGGGGG + Intergenic
1040362668 8:46682835-46682857 CTCAGCAAATAAAATAATGGGGG - Intergenic
1040417500 8:47208056-47208078 CAAAGCAAAAAAAATCATGGGGG + Intergenic
1040430351 8:47335242-47335264 CAGAAGAAAGAAAATAATATAGG - Intronic
1040486332 8:47875419-47875441 AATAGGAAACAGAAAAATGGTGG - Intronic
1040628314 8:49177970-49177992 AAGAGGACACACAAAAATGGAGG + Intergenic
1041213441 8:55576071-55576093 AAGAGGAAACAAACAAATGGAGG + Intergenic
1041772254 8:61484440-61484462 AAGAGGATACAAACAAATGGAGG + Intronic
1042698635 8:71586092-71586114 AAGAGGACACAAACAAATGGAGG + Intronic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1044221195 8:89672250-89672272 CTCTGGAAACAAAATCATGGTGG + Intergenic
1044255535 8:90056206-90056228 CAGAGCTAACAAATAAATGGTGG - Intergenic
1044812206 8:96074899-96074921 AAGAGGACACAAACAAATGGAGG + Intergenic
1045495311 8:102703203-102703225 CAGAGGAAACAAAAAACAGTGGG - Intergenic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1047454456 8:124997012-124997034 CAGATAAAACATAATATTGGGGG + Intergenic
1048784123 8:138032606-138032628 TAGAGGAAACTGAATCATGGGGG - Intergenic
1048886992 8:138916646-138916668 CAAAGGAAACAAAAGTCTGGAGG + Intergenic
1048976771 8:139677567-139677589 AGGAGGAAAAAAAATAAAGGAGG + Intronic
1049026010 8:139989404-139989426 GAGAGGAAACAAAAGAGTAGAGG - Intronic
1049902684 9:184810-184832 CAAAGGAAACAACATACTAGTGG + Intergenic
1050846977 9:10233336-10233358 CAGAGAACACAAAACAATGAAGG - Intronic
1051933494 9:22414881-22414903 AAGAGAAAACAAAAGAATAGAGG - Intergenic
1051984829 9:23071289-23071311 CAGTGGAAGCAGAATTATGGAGG - Intergenic
1052505252 9:29345018-29345040 CACAGTAAACAAAAAAAAGGGGG - Intergenic
1052721130 9:32172194-32172216 CACAGGGAAGAAAATTATGGAGG + Intergenic
1053128011 9:35598734-35598756 CAGTGGGAACAAAATAGTGATGG + Intergenic
1053607491 9:39675740-39675762 CAGAGCAAAGAAAATAACAGAGG - Intergenic
1053745708 9:41195096-41195118 CAAAGGAAACAACATACTAGTGG + Intronic
1053865343 9:42432098-42432120 CAGAGCAAAGAAAATAACAGAGG - Intergenic
1054246044 9:62666669-62666691 CAGAGCAAAGAAAATAACAGAGG + Intergenic
1054481563 9:65670118-65670140 CAAAGGAAACAACATACTAGTGG - Intronic
1054560166 9:66701202-66701224 CAGAGCAAAGAAAATAACAGAGG + Intergenic
1054682635 9:68236176-68236198 CAAAGGAAACAACATACTAGTGG - Intronic
1054865485 9:69996111-69996133 CAGTGGAAACATAATAAGGTAGG + Intergenic
1054989646 9:71308636-71308658 CTCAGCAAACAAAGTAATGGGGG + Intronic
1055207531 9:73751050-73751072 CAGAGGAAAAAAAAAATGGGTGG + Intergenic
1055218904 9:73903912-73903934 CTTAGGAAACAGGATAATGGTGG + Intergenic
1055283085 9:74697231-74697253 CAGAGGAGGGAAAATAAAGGGGG - Intergenic
1055610141 9:78014156-78014178 AAGAGAAAAGGAAATAATGGAGG + Intronic
1055794274 9:79957646-79957668 CTGAGAAAAAAAATTAATGGAGG - Intergenic
1055955696 9:81771615-81771637 CACAGAAAAAAAAATAGTGGAGG - Intergenic
1056221751 9:84456620-84456642 GAGTGGAAACTAAATAACGGAGG + Intergenic
1057466980 9:95323270-95323292 CAGAGCAAAAAAAAAAAAGGAGG + Intergenic
1057472959 9:95374193-95374215 CAGAGGTAAAAAAATAACAGGGG + Intergenic
1057966587 9:99509850-99509872 CAGAGGAAGCAAAACATTTGGGG - Intergenic
1058211103 9:102171150-102171172 AAGAGGATACAAACAAATGGAGG + Intergenic
1058303890 9:103412077-103412099 CTCAGGAAGCAAAATAATGTGGG + Intergenic
1058518464 9:105797885-105797907 TATAAGAAACAATATAATGGGGG + Intergenic
1058653310 9:107197181-107197203 CTCAGGAAACACAATCATGGCGG + Intergenic
1059702736 9:116791513-116791535 CAGTGTAAACAAGATCATGGGGG + Intronic
1060131335 9:121102895-121102917 AAGAGGACACAAACAAATGGAGG + Intronic
1060165133 9:121406894-121406916 CAGAGGAAACAAAAAAACAAAGG + Intergenic
1061673878 9:132204423-132204445 CAGAGGGAAGAAAACCATGGAGG + Intronic
1202781840 9_KI270718v1_random:5876-5898 CAAAGGAAACAACATACTAGTGG + Intergenic
1185611188 X:1394556-1394578 AAGAGGAAAGAAAAGAAGGGAGG - Intergenic
1186247507 X:7630342-7630364 CGTAGGAAACAAAATAATCAAGG - Intergenic
1186318166 X:8393699-8393721 CAGAGGCCACAAAAGATTGGTGG + Intergenic
1188380396 X:29484541-29484563 CTGATGCAACAAAATAAAGGAGG + Intronic
1188473235 X:30563289-30563311 CTCAGGAAACACAATCATGGTGG - Intronic
1188474564 X:30577583-30577605 CAGATGACAAAAAATAATAGCGG + Intronic
1188694404 X:33172225-33172247 CAAAGGAAATAAAAGTATGGCGG - Intronic
1188958534 X:36463150-36463172 CAAATAAAACAAAATAATGATGG - Intergenic
1189249826 X:39592112-39592134 GGGAGGAAAAAAAATTATGGAGG - Intergenic
1189556790 X:42153391-42153413 CACAGGAAACAAAGTAAAGGAGG - Intergenic
1189629507 X:42937384-42937406 GAGGGGAAAGAAAATAATAGAGG - Intergenic
1190099259 X:47508452-47508474 AAGAGAAAATAAAATAGTGGAGG + Intergenic
1190107735 X:47571658-47571680 AAGAGGAAACCAAATGATGGAGG - Exonic
1190447906 X:50548879-50548901 CAGAGCACAGAAAATAATGAGGG + Intergenic
1190914421 X:54799989-54800011 TAGAGAAAACAAAACAATGAAGG + Intergenic
1191002761 X:55678709-55678731 AAGAGGACACAAACAAATGGAGG - Intergenic
1191011849 X:55768491-55768513 CAGAGGAAAAAAAAGAATTAGGG + Intergenic
1191030801 X:55968417-55968439 CAGTGGAAACCAAAAAATGCAGG + Intergenic
1191102608 X:56748267-56748289 CAAGGGAAACAGAATAATAGAGG + Intergenic
1192090083 X:68144945-68144967 CACAGGAAAAACAATAATTGTGG + Intronic
1192265854 X:69537626-69537648 CAGAGGAAAATAAATAAGGCAGG - Intergenic
1192480795 X:71483814-71483836 CAGAAGAAAAAAAATAATGAGGG - Intronic
1193150856 X:78123167-78123189 CAGGGGAGCCAAAATGATGGAGG - Intronic
1193478724 X:81999684-81999706 CAAAGGAAACACAGTAATAGTGG - Intergenic
1193809659 X:86036560-86036582 GAAAGGAAGCAAAATAAAGGGGG + Intronic
1193997274 X:88382127-88382149 CAAAGGAAAAAAAAAAATGCAGG + Intergenic
1194643892 X:96434699-96434721 CAGAGGAAAGATAATGATGAGGG + Intergenic
1194804830 X:98314433-98314455 CATAGGAAGAAAAAAAATGGTGG + Intergenic
1195742536 X:108079745-108079767 CACAAGAAGCAAAATAATGAAGG + Intergenic
1195791531 X:108593027-108593049 CAGTGGAAAACAAAGAATGGTGG - Intronic
1196226405 X:113172566-113172588 CAGATAAAACAAAAAGATGGAGG + Intergenic
1196843571 X:119880689-119880711 CAGAGGGAACAGCATAAGGGTGG + Intergenic
1196846937 X:119903935-119903957 AAAAATAAACAAAATAATGGTGG - Intronic
1197581767 X:128293227-128293249 CTGAGGAAACATAATCATGGTGG - Intergenic
1197670020 X:129266389-129266411 CAAAAGAAATCAAATAATGGTGG - Intergenic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1199226263 X:145378288-145378310 CAGAGGAAATACAGTAATGAGGG + Intergenic
1199295876 X:146158121-146158143 CAGAAAATAAAAAATAATGGTGG + Intergenic
1199914933 X:152329193-152329215 AAGAGGACACAAACAAATGGAGG + Intronic
1200276026 X:154733607-154733629 CAGAGGAAAAACCATAAAGGAGG - Intronic
1200739457 Y:6837434-6837456 CTCAGGAAACACAATAATTGTGG - Intergenic
1200762290 Y:7050761-7050783 CATAGGAAACAAAATATTCGCGG + Intronic
1200969726 Y:9138246-9138268 CAAAGGAAAAAAAAGAATAGCGG + Intergenic
1201545217 Y:15154544-15154566 AAGAGGATACAAAGTAATGGAGG - Intergenic
1201775792 Y:17664334-17664356 AAGAGGACACAAACAAATGGAGG - Intergenic
1201825764 Y:18241658-18241680 AAGAGGACACAAACAAATGGAGG + Intergenic