ID: 1130331391

View in Genome Browser
Species Human (GRCh38)
Location 15:82925039-82925061
Sequence CAGCTGATCTTGGGGTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 80}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130331377_1130331391 28 Left 1130331377 15:82924988-82925010 CCTTTTCCTCTCCCCCTACCACT 0: 1
1: 0
2: 9
3: 152
4: 1616
Right 1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 80
1130331383_1130331391 14 Left 1130331383 15:82925002-82925024 CCTACCACTATGTTTAGGCTGAA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 80
1130331382_1130331391 15 Left 1130331382 15:82925001-82925023 CCCTACCACTATGTTTAGGCTGA 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 80
1130331376_1130331391 29 Left 1130331376 15:82924987-82925009 CCCTTTTCCTCTCCCCCTACCAC 0: 1
1: 0
2: 8
3: 146
4: 1353
Right 1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 80
1130331381_1130331391 16 Left 1130331381 15:82925000-82925022 CCCCTACCACTATGTTTAGGCTG 0: 1
1: 0
2: 1
3: 7
4: 88
Right 1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 80
1130331380_1130331391 17 Left 1130331380 15:82924999-82925021 CCCCCTACCACTATGTTTAGGCT 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 80
1130331386_1130331391 -10 Left 1130331386 15:82925026-82925048 CCCTTGAGGTGCTCAGCTGATCT 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 80
1130331384_1130331391 10 Left 1130331384 15:82925006-82925028 CCACTATGTTTAGGCTGAAGCCC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 80
1130331378_1130331391 22 Left 1130331378 15:82924994-82925016 CCTCTCCCCCTACCACTATGTTT 0: 1
1: 0
2: 1
3: 45
4: 481
Right 1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130331391 Original CRISPR CAGCTGATCTTGGGGTAAAC AGG Intronic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
903659601 1:24969039-24969061 GAGCTGATCTGTGGGCAAACTGG + Intergenic
907217744 1:52880227-52880249 TAGCTGGTCTTGGGAAAAACAGG + Intronic
907987224 1:59544024-59544046 CAGCTTATCTTGGGGCAAACTGG - Intronic
908137660 1:61149944-61149966 CAGCTGATTTAGGTCTAAACAGG + Intronic
910869261 1:91817361-91817383 CAACTGATCTTGGTGTGAAGAGG - Intronic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
923516498 1:234702194-234702216 CAGCTGTGCTTGTGATAAACAGG + Intergenic
1064454946 10:15478587-15478609 CAGCTGATCATGGGACACACAGG + Intergenic
1067015798 10:42755556-42755578 CAGCTGAGCTTGGGGAGAATGGG - Intergenic
1067375677 10:45726267-45726289 AAGCTGTACTTGGGGTAATCAGG + Intergenic
1067762015 10:49055545-49055567 CAGCTGACCTTGGGGAGAAGGGG - Intronic
1070708081 10:78656364-78656386 CTTCTGATCTTGGGGCAAATAGG - Intergenic
1071721155 10:88147590-88147612 CAGCAGAACTTGGGGTCTACAGG - Intergenic
1072019778 10:91386918-91386940 AAGCTGCTCTTGAGGTAAAGTGG - Intergenic
1074467334 10:113695232-113695254 CAGCTTATCTGAGGGTGAACTGG - Intronic
1075586968 10:123665483-123665505 CAGCTGTTCTTGGGACAGACAGG + Intergenic
1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG + Intronic
1085513781 11:77100759-77100781 CAGCAGTTCTTGGGGTAGAATGG - Intronic
1089503232 11:118945299-118945321 CAGCTGAGCTTGGGGACTACTGG - Intronic
1095193996 12:39290940-39290962 CTGCTGGTCTTGGAGTCAACAGG - Intergenic
1099125838 12:78756900-78756922 CAGCTAATCTTAGTATAAACTGG + Intergenic
1104039475 12:125120369-125120391 AATCTGTTCTTGGGGGAAACAGG + Intronic
1118524474 14:66623703-66623725 CAGCTGATGTCAGGGTAAAGGGG - Intronic
1121203909 14:92145010-92145032 CAAATGATCTTTGGGTATACTGG - Intronic
1125110882 15:36032410-36032432 ATGCTGCTCTTGGGGTAAATGGG + Intergenic
1125678906 15:41518344-41518366 GAGCAGATGTTGGGGAAAACTGG + Intronic
1128996840 15:72303627-72303649 TGGCTGATCTTGGGTTAGACAGG + Intronic
1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG + Intronic
1138922669 16:61551375-61551397 TAGCTGATCTTGAGCTAAAGAGG - Intergenic
1139924428 16:70478406-70478428 CACCTGCTCTTGGTGTACACTGG + Exonic
1141357858 16:83365452-83365474 CAGCTGACCATGGGGTAACCAGG - Intronic
1142807104 17:2376944-2376966 CAGCTGATCTGAGGGGAGACAGG - Exonic
1144600462 17:16608367-16608389 CAGCTCTTCCTGGGGTCAACTGG - Intergenic
1145790500 17:27623803-27623825 CAGCTGTTCTTGGGGTAGGGCGG + Exonic
1147329052 17:39685775-39685797 CAGCAGATTTTGGGGAGAACAGG + Intronic
1154267565 18:12892310-12892332 CAGCTGCTCATGGGGTACACAGG + Intronic
1154499524 18:14988294-14988316 CAACTGACCTTGGGGTAAGAAGG + Intergenic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1156515741 18:37678641-37678663 CAGCTGATCTTTGGATAAACAGG + Intergenic
1156700691 18:39820862-39820884 CTGCTGACCTTGGGCTGAACTGG + Intergenic
1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG + Intergenic
1157006734 18:43591265-43591287 CAAATAATCTTGGGGCAAACGGG - Intergenic
1158198875 18:54918228-54918250 CTGCTGAACTTGGTTTAAACAGG - Intronic
1162744804 19:12792309-12792331 CTGCTGAGGTTGGTGTAAACGGG - Exonic
1168183698 19:54682701-54682723 CAAGTGTTCTTGGGGCAAACAGG - Intronic
925686742 2:6481049-6481071 CAGCTGATCTAGGAGTTACCTGG - Intergenic
927511492 2:23646942-23646964 GAGCTGCTTTTGGGGTAAGCAGG - Intronic
928919869 2:36515541-36515563 CAGCTGATCTTGGAATGAAGAGG - Intronic
929925633 2:46205314-46205336 TAGCTGATCTTTGGGTGAAGTGG - Intergenic
930297417 2:49572291-49572313 AAGCTCTTCTTGGGGAAAACTGG - Intergenic
938498728 2:131818662-131818684 CAACTGACCTTGGGGTAAGAAGG + Intergenic
946956617 2:224937265-224937287 CAGCTGATATTGGGATAAATGGG + Intronic
1183882907 22:40850709-40850731 CAAGTGATCTTGGGGAAATCAGG + Intronic
1184812194 22:46843662-46843684 CATCTGTTTTGGGGGTAAACGGG + Intronic
949179516 3:1111742-1111764 CAGCGGATGTTGTGGTAAAAAGG + Intronic
951217959 3:20041432-20041454 CAGCTGCTCGAGGTGTAAACAGG + Intronic
956860142 3:73314664-73314686 CAGGTGATCTAGGGGGAAGCAGG + Intergenic
957946270 3:87067380-87067402 CAACTGATCTTGGATTAAATCGG + Intergenic
966680367 3:182635839-182635861 CAGCTGATCTTGGGGAAGGCTGG - Intergenic
968279656 3:197466760-197466782 CAGCTGGTCATGGGGTGAAATGG + Intergenic
968868465 4:3228363-3228385 CAGCTGCTCCTGGGGTTGACTGG + Intronic
969927902 4:10602398-10602420 CAGATGATCTTGGGTTAAAGTGG + Intronic
981945497 4:150338533-150338555 GGGCAGATCTTGGGGTACACTGG - Intronic
982993469 4:162310125-162310147 CAGGTGATCTAGGGATTAACTGG - Intergenic
986361996 5:6987732-6987754 CAGCTGATATTGGGCTGAAAGGG + Intergenic
988385113 5:30553029-30553051 AAGCTGGGTTTGGGGTAAACGGG - Intergenic
990378488 5:55197255-55197277 CAGAGGAGCTTGGGGTAAAAAGG - Intergenic
993650602 5:90516964-90516986 CAGATTATTTTAGGGTAAACAGG - Exonic
1004177173 6:13349937-13349959 CAGGTGAACTTGGGGTGCACAGG + Intergenic
1006885960 6:37382545-37382567 CAGCTGATCTTGGCCAAATCTGG - Intronic
1010082273 6:71877691-71877713 GAGCAGATCTTGGGGTGAAAAGG + Intergenic
1017474083 6:154770722-154770744 CAGTTGGTCTTTGGTTAAACTGG + Intronic
1019477486 7:1251060-1251082 CAGCTGGTCATGGGGTCACCAGG + Intergenic
1020462052 7:8437112-8437134 CAGGACACCTTGGGGTAAACAGG + Intronic
1038445100 8:27598178-27598200 CAGCTCATCTTGGGGGGAGCTGG + Exonic
1040831455 8:51681535-51681557 CTGCAGATCTGGGGGTAAACAGG + Intronic
1041320162 8:56604331-56604353 CTGCTGATCCTGGTGCAAACAGG - Intergenic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1044680749 8:94775141-94775163 CAGCTGATCTAGGGGCACAATGG - Intronic
1046891582 8:119427924-119427946 CAGCTGTTCTGGGGATAATCAGG + Intergenic
1046999160 8:120556174-120556196 GAGCTTAACTTGGAGTAAACAGG - Intronic
1047894743 8:129354113-129354135 CAGCTGTTGTGGGGGTGAACTGG + Intergenic
1050792302 9:9488386-9488408 CAGCAGGTCTTGGCGTATACTGG - Intronic
1059457911 9:114411452-114411474 CAGCTGATCCTGGGGGAAGCTGG + Intronic
1060232118 9:121833144-121833166 CAGCTTATCTTGTGGCATACAGG - Intronic
1061293833 9:129666586-129666608 CAGCTGCTCCCGGGGCAAACTGG - Intronic
1186544086 X:10430640-10430662 CAGATGAAATGGGGGTAAACTGG + Intergenic
1188039022 X:25350556-25350578 CAGGTGATCTTGGGAAGAACTGG + Intergenic
1188806045 X:34591154-34591176 ATGCTGAGCCTGGGGTAAACAGG - Intergenic
1199269316 X:145864399-145864421 AACCTGATCCTGGGGAAAACTGG - Intergenic