ID: 1130334063

View in Genome Browser
Species Human (GRCh38)
Location 15:82943722-82943744
Sequence CAGAACAAAAGGAGGACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 344}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130334058_1130334063 -4 Left 1130334058 15:82943703-82943725 CCACAGACAAGATTACCCGCAGA 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG 0: 1
1: 0
2: 2
3: 25
4: 344
1130334055_1130334063 4 Left 1130334055 15:82943695-82943717 CCCATAACCCACAGACAAGATTA 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG 0: 1
1: 0
2: 2
3: 25
4: 344
1130334051_1130334063 12 Left 1130334051 15:82943687-82943709 CCGCCCACCCCATAACCCACAGA 0: 1
1: 1
2: 3
3: 70
4: 638
Right 1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG 0: 1
1: 0
2: 2
3: 25
4: 344
1130334054_1130334063 5 Left 1130334054 15:82943694-82943716 CCCCATAACCCACAGACAAGATT 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG 0: 1
1: 0
2: 2
3: 25
4: 344
1130334056_1130334063 3 Left 1130334056 15:82943696-82943718 CCATAACCCACAGACAAGATTAC 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG 0: 1
1: 0
2: 2
3: 25
4: 344
1130334052_1130334063 9 Left 1130334052 15:82943690-82943712 CCCACCCCATAACCCACAGACAA 0: 1
1: 0
2: 0
3: 25
4: 316
Right 1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG 0: 1
1: 0
2: 2
3: 25
4: 344
1130334049_1130334063 23 Left 1130334049 15:82943676-82943698 CCCTGTGGATACCGCCCACCCCA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG 0: 1
1: 0
2: 2
3: 25
4: 344
1130334053_1130334063 8 Left 1130334053 15:82943691-82943713 CCACCCCATAACCCACAGACAAG 0: 1
1: 0
2: 1
3: 27
4: 237
Right 1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG 0: 1
1: 0
2: 2
3: 25
4: 344
1130334050_1130334063 22 Left 1130334050 15:82943677-82943699 CCTGTGGATACCGCCCACCCCAT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG 0: 1
1: 0
2: 2
3: 25
4: 344
1130334057_1130334063 -3 Left 1130334057 15:82943702-82943724 CCCACAGACAAGATTACCCGCAG 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG 0: 1
1: 0
2: 2
3: 25
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130334063 Original CRISPR CAGAACAAAAGGAGGACTAA AGG Intronic
901490892 1:9595720-9595742 CAGAACAGCAGGAGGAACAAGGG - Intronic
901562601 1:10084662-10084684 AAGAAAAAAAGGAAAACTAAAGG - Intronic
901584047 1:10272096-10272118 GAGGACAGATGGAGGACTAAAGG + Intronic
903553021 1:24171451-24171473 AATAACAAAAAGAGAACTAAAGG + Intronic
903897129 1:26614469-26614491 CAGAACCAAAGGAGAAAGAAGGG + Intergenic
904637358 1:31893204-31893226 CAGGATAAAAGAATGACTAAAGG + Intergenic
907111308 1:51928860-51928882 GAGAACAAAAGGATGAGAAAAGG - Intronic
908151009 1:61303006-61303028 TAGAACCAAATGAGGAATAATGG - Intronic
910141839 1:84034623-84034645 TAGAACAAAAGGAGGAGTAAGGG + Intergenic
910234840 1:85024769-85024791 CAAAACAAAAAAAGGAGTAAGGG - Intronic
910757056 1:90705170-90705192 CAGAAAAGAAGGAAGACAAAGGG + Intergenic
910801022 1:91146208-91146230 TATAGCAAAAGGAGTACTAAAGG - Intergenic
914263822 1:146020779-146020801 CAGAACACAAGAAGGATTAAGGG + Intronic
916380575 1:164206367-164206389 TAGAACAAAAGGTGGGGTAAAGG + Intergenic
916956641 1:169843856-169843878 CACAACAAGAGGAGGTTTAAAGG - Intronic
917577180 1:176335846-176335868 AAGAACAAAAGGAAGAATGAAGG - Intergenic
918418019 1:184332451-184332473 GTGAACCAAAGGAGGAATAAAGG - Intergenic
918867283 1:189918991-189919013 CACAACAAAAAGAAAACTAAAGG - Intergenic
920242596 1:204564049-204564071 CAGCAGTAAAGGAGGAGTAAAGG + Intergenic
921851043 1:219932276-219932298 TAGAACAAAAGAAGCATTAAAGG - Intronic
922175838 1:223196654-223196676 CAGAAAATAAGGTGGATTAATGG - Intergenic
922766918 1:228160747-228160769 CAGAACCAAAGGTGGAGGAAGGG - Intergenic
922931759 1:229395624-229395646 CAGAAGAAAACGAAGACTCAGGG - Intergenic
923381999 1:233430142-233430164 CAGAAAAAAAGGAGGAAAAATGG - Intergenic
924562556 1:245169262-245169284 AAGAACAAGAGGAGAAATAAAGG - Intronic
1064214364 10:13387229-13387251 CAGGACAAAGGGAGCACTTATGG - Intergenic
1064544138 10:16434632-16434654 CAGAAAAAAAGGAGGAGAAAAGG - Intergenic
1065081424 10:22133489-22133511 CAGAAGAGAAGGAGGAATGATGG - Intergenic
1065639278 10:27765487-27765509 CAGGAGAAAAGGAGAACGAACGG + Intergenic
1066273162 10:33843491-33843513 GAGAAGAAAAGGAGGTTTAATGG + Intergenic
1067277649 10:44849375-44849397 CGGAACAAAAGGTGGAGGAAAGG + Intergenic
1067358935 10:45558879-45558901 CAGAACACATTGAGGCCTAAAGG + Intronic
1067757465 10:49015881-49015903 CAGGACCAGAGGAGGACTGAGGG - Exonic
1068277100 10:54814172-54814194 TAAAACAAATGGAGGAATAAAGG - Intronic
1068946776 10:62737151-62737173 CAAAGCAAAAGGAGGAATTAAGG + Intergenic
1070414976 10:76180929-76180951 CAGGACACAAGGAGGTCTCAGGG + Intronic
1070420466 10:76231598-76231620 CAGAACAAAAGAAGTCATAAAGG + Intronic
1070441990 10:76455571-76455593 TAGAACAAAAGCAGGCCAAAAGG + Intronic
1071342985 10:84665404-84665426 CAGAGCAAAAGGAGGCCAAGCGG - Intergenic
1072259241 10:93652111-93652133 AAAAAGAAAATGAGGACTAATGG + Intronic
1072993972 10:100227000-100227022 CATAACAAAAGGAAGATTGAAGG - Intronic
1073348858 10:102804730-102804752 CAAAACAGAAGGAAGACTAATGG + Intronic
1074792143 10:116900483-116900505 GAGAACAAAAGGCAGACAAAAGG + Intronic
1076037755 10:127215069-127215091 AAGAACAAAACGAGAACCAAAGG - Intronic
1076422091 10:130338882-130338904 CAGAATCAGAGGAGGACTGACGG + Intergenic
1077261547 11:1624158-1624180 AAAAACAAAAGGAGGAGGAAAGG + Intergenic
1078343339 11:10518741-10518763 GAGAAAAAAAGGAGGAAAAAGGG + Intronic
1078487726 11:11739660-11739682 CAGAAACAAGGAAGGACTAAAGG + Intergenic
1078609977 11:12811595-12811617 CAGAACAAAAACAGGAGTCAGGG + Intronic
1078770439 11:14345549-14345571 AAGAACAAAAGAAGGAAAAAGGG + Intronic
1080862207 11:36159767-36159789 CAAAAAAAAAGGAGAACTCAGGG + Intronic
1085049129 11:73370937-73370959 CAGACCAGAAGGAGGTCTAAGGG - Intergenic
1085550512 11:77366019-77366041 CAGAAAAAATGGAGGTCAAAAGG + Intronic
1085694992 11:78696693-78696715 CAGCACAAAGGGAGGACCCAAGG - Intronic
1086972588 11:93099512-93099534 CAGACAGAGAGGAGGACTAAGGG + Intergenic
1087461180 11:98450327-98450349 TAGAACAAAAGGTGGAGAAAGGG - Intergenic
1087800239 11:102495909-102495931 CAGAACAAAAGGATCACCTAGGG + Intronic
1088970887 11:114773765-114773787 TAGAACAAAAGGTGGAAGAAGGG + Intergenic
1089164449 11:116464324-116464346 TAGAACAAAAGGTGGAGGAAGGG + Intergenic
1089164790 11:116467480-116467502 CAGAACAGAAGGCGGAAGAATGG - Intergenic
1090969737 11:131630029-131630051 CAGTACAAAGGGAGGAGGAAAGG + Intronic
1091025554 11:132137811-132137833 CAGAACAACAGGAGGCCAGAGGG + Intronic
1091495728 12:971218-971240 CAAAACAAAAGGTTGATTAAAGG - Intronic
1091830467 12:3545722-3545744 CAGAACTAAAGGAAGAAAAAGGG + Intronic
1093102553 12:15045481-15045503 CAGAACATGGGGAGGAATAAAGG + Intergenic
1094357601 12:29594911-29594933 AAGAACCAAAGGAGGAAGAAAGG + Intronic
1095910554 12:47422278-47422300 CAGAAAATAAGGAGGCCTGAGGG - Intergenic
1096759328 12:53826943-53826965 CAGAACTAGAAGAGGACTGAAGG - Intergenic
1097825660 12:64172519-64172541 AAGGAAAAAAGGAGGACTGAAGG + Intergenic
1098043515 12:66377234-66377256 CAGAACAAGAGGAGAACTTCTGG - Exonic
1098089013 12:66881038-66881060 AGTAATAAAAGGAGGACTAAAGG + Intergenic
1098208482 12:68137273-68137295 AAGAAGTAAAGGAGGGCTAAAGG - Intergenic
1098392280 12:69982023-69982045 CAGAGAAGAAGGAGGATTAAAGG + Intergenic
1098806474 12:75026051-75026073 CAGAAAAAGAGCAGGCCTAACGG + Intergenic
1101143305 12:101818095-101818117 AAGAACAAAAGTAGTTCTAAAGG - Intronic
1101212883 12:102552120-102552142 CAAAAGGAAAGGAGGAATAAAGG - Intergenic
1102733551 12:115136749-115136771 AAGAAGAAAAGGAGGAGGAAGGG + Intergenic
1103788229 12:123449601-123449623 CAGCACTTTAGGAGGACTAAAGG + Intergenic
1105907605 13:24828584-24828606 AAGAGAAAAAGGAGGACAAAAGG - Intronic
1106247832 13:27964064-27964086 CATCAAAAAAAGAGGACTAAAGG + Intronic
1107251058 13:38363747-38363769 AAGAACAGAATGAGGTCTAAGGG + Intergenic
1108746013 13:53395078-53395100 TAGAACAAAAGGTGGAGGAAGGG + Intergenic
1109192638 13:59344065-59344087 GTGAACAAAAGGGAGACTAAAGG + Intergenic
1109719665 13:66259891-66259913 CAGAGCAAAATAAGGATTAATGG + Intergenic
1111929939 13:94502691-94502713 AAGAAAAAAAGGAGGACACAAGG - Intergenic
1112070995 13:95850328-95850350 TAGAAAAATAGGAGGATTAAGGG + Intronic
1112314119 13:98346096-98346118 CAGAACAAGATGATGACTGAGGG - Intronic
1113715491 13:112503242-112503264 CAGAATAAAAGGAGAACTCCAGG + Intronic
1116585125 14:46693951-46693973 GGGAACAAAAGGAAGACTACTGG - Intergenic
1116978123 14:51138537-51138559 TAGAACAAAAGGTGGAAGAAGGG - Intergenic
1117622488 14:57601616-57601638 CTGAAAGAAAGGAGTACTAATGG + Intronic
1119991296 14:79200541-79200563 AAGAAGAAAAGGAGCCCTAAAGG + Intronic
1120544517 14:85794060-85794082 CAGAAAAAAAGGAGAAAGAATGG + Intergenic
1120562259 14:86009829-86009851 TAGAGCAAAAGGTGGAGTAAGGG - Intergenic
1120609839 14:86625710-86625732 CAGAAGAAAAGGAGAACTGTAGG - Intergenic
1121071890 14:91031004-91031026 CAGAACTAAAGGAGTTTTAATGG + Intronic
1121368271 14:93333946-93333968 CAGAGGAAAAGGAGGTGTAACGG - Intronic
1121877542 14:97467301-97467323 AAGAACAAAAGGAGAAAAAAGGG + Intergenic
1124837022 15:33205219-33205241 CAGAACATGAGCAGGACAAAAGG - Intergenic
1126143712 15:45457274-45457296 AAAACCAAAAAGAGGACTAAGGG + Intergenic
1128356950 15:66934894-66934916 CAGACCGAAAGAGGGACTAAAGG + Intergenic
1128903602 15:71447920-71447942 CAGGCAAAAAGAAGGACTAAAGG + Intronic
1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG + Intronic
1130565316 15:84989110-84989132 CAGAACAAAAGTAGAACAGAAGG - Intronic
1132427019 15:101725994-101726016 CTAAACAAAAGGAGGACATACGG - Intergenic
1133881658 16:9788194-9788216 GAGAAAAAAGGGAGGAGTAAAGG - Intronic
1137322442 16:47399037-47399059 CAGACCAAAAAGAGGGCTAGAGG + Intronic
1138158694 16:54731783-54731805 GAGAGCAAAAGGAGGACTGGAGG - Intergenic
1138213614 16:55183843-55183865 CAGAATAAGAGGTGGACAAATGG - Intergenic
1138461550 16:57151289-57151311 CAGAAAAAAGGGAGGGCTGATGG + Intergenic
1140237777 16:73174303-73174325 AACAACAAAAGGAGGAATAAGGG + Intergenic
1141799908 16:86300215-86300237 CAGGAGAGAAGGAGGAATAAAGG - Intergenic
1141902542 16:87001975-87001997 CAGAAGACAAGGAAGAGTAAAGG + Intergenic
1143583289 17:7838626-7838648 CAGACCAAGAGGAGGAGTGAGGG - Intergenic
1144147936 17:12416217-12416239 AAAAAAAAAAGGAGGACTTAGGG - Intergenic
1144856311 17:18270273-18270295 CAGAACAACAGGTGGAAGAAGGG - Intergenic
1146081936 17:29788315-29788337 TAGAACAAAAGGCTGAATAAGGG + Intronic
1147344745 17:39782511-39782533 AAGAAAAAAAAGAGGACTATTGG + Intronic
1147365795 17:39958325-39958347 CTGAACAAAAGGAGGTGGAATGG - Intergenic
1150501839 17:65658633-65658655 CAGGAGAAAAGCAGGACTAGAGG + Intronic
1156788175 18:40940230-40940252 GAGAACAAATGGAGGAAAAAAGG - Intergenic
1156847076 18:41678452-41678474 CATTACAAAAGGAGGAGAAAAGG - Intergenic
1156946263 18:42836486-42836508 CAGAAAAAAAGGAGGTCAACAGG + Intronic
1158080721 18:53587328-53587350 AAGACCAAAAGGTGGAATAATGG - Intergenic
1159090868 18:63847327-63847349 CAAAACAAAAAGAGGAATATGGG + Intergenic
1159720091 18:71878857-71878879 CAGAAATAAAGGTGGACAAAAGG + Intergenic
1160032085 18:75270905-75270927 CAGAACCAAAGGAGGCCGAAGGG + Intronic
1160548195 18:79675970-79675992 CAGAACAAAAGGAGGTTAAGGGG - Intergenic
1163087673 19:14994135-14994157 CAGAACAAGGGGAGGACAGATGG - Intronic
1165819792 19:38667148-38667170 CAGAACAGGGGGAGGACTCAAGG + Intronic
1166262566 19:41651255-41651277 TAGAACAAAACGAGGACTTCAGG - Intronic
1168174911 19:54619691-54619713 AAGAAAAAAAGCAGGTCTAAAGG - Intronic
925124187 2:1442151-1442173 GAGAAGAAAAGGAGGTTTAATGG - Intronic
925261159 2:2529753-2529775 CAGAACAAAATGAGAACGGATGG - Intergenic
925360339 2:3275939-3275961 CAGAACAAAAAGAGAACTCAAGG + Intronic
925943374 2:8839797-8839819 GAGGACAGAAGGAGGACTAGGGG - Intergenic
926513397 2:13810428-13810450 AAGAACAAAGGGAGGCTTAATGG + Intergenic
926799450 2:16646803-16646825 TAGAACAAAAGGTGAATTAAAGG + Intronic
927015351 2:18953713-18953735 CAGAACAAAAAGAGTAGAAAAGG + Intergenic
928048612 2:27965804-27965826 AAGAAAAAAAGGAGGAATAAGGG - Intronic
928460954 2:31472119-31472141 TAGAGCAAAAGGTGGAGTAAAGG - Intergenic
929057853 2:37893943-37893965 TAGAACAGAAGGAGGATTTAAGG - Intergenic
929368396 2:41190494-41190516 CAGAAACAAAGGAGAAGTAAAGG - Intergenic
931559010 2:63536673-63536695 CAGAACATAAGACGGATTAATGG + Intronic
931686999 2:64802762-64802784 CAGAACAAAAGGTGGAGGAAGGG - Intergenic
932526866 2:72479758-72479780 TAGAACAAAAGAAGGATTGATGG - Intronic
932775406 2:74525422-74525444 GAGGACAAAGGGAGGACAAAGGG - Intronic
935795677 2:106639316-106639338 CAGTACAAAGGGAAGACTATGGG - Intergenic
936053998 2:109246954-109246976 CAGAGCATGAGGAGGACTCATGG + Intronic
936585950 2:113757689-113757711 CAAAACAAAAACAAGACTAAAGG + Intergenic
936703928 2:115047892-115047914 CATGACAAATGGAGGACTGAGGG - Intronic
936846725 2:116843385-116843407 CAGAAAAAAAGGAGGAGCAAAGG + Intergenic
936963870 2:118106365-118106387 CAGAACACAAGTATCACTAAAGG - Intronic
938001514 2:127743611-127743633 CAGAAGTAAAGGAAGACAAACGG + Intronic
938305393 2:130250981-130251003 TACAACAAAAGCAGTACTAAGGG + Intergenic
939456703 2:142446368-142446390 TGGAACAATAGGAGCACTAAGGG + Intergenic
940559403 2:155275549-155275571 CAAAACAAAAAGTGGACAAATGG - Intergenic
941215709 2:162706108-162706130 CACAAAGACAGGAGGACTAAGGG + Intronic
941613365 2:167689436-167689458 AAGAATAAAAGGAGGAATAGTGG + Intergenic
942745681 2:179229293-179229315 CAGAACAAAAGGAGGGAAAAAGG + Intronic
942884778 2:180910098-180910120 TATGACAAAATGAGGACTAATGG + Intergenic
943931826 2:193864524-193864546 CAGAACAAGTGGAGGAATGAGGG - Intergenic
944023344 2:195133365-195133387 TAGAACAATAGGAGAAATAAAGG + Intergenic
944112178 2:196144552-196144574 CAGCACAAAAGAAGGCATAAAGG + Intronic
944215927 2:197255602-197255624 CAAAACAAAAGAAGAACTACAGG + Intronic
944328300 2:198433364-198433386 CAGAAGAAAAGAAGGACAGAAGG - Intronic
944466831 2:200010184-200010206 TAAAACAAAAGTAGGGCTAAGGG - Intergenic
944639829 2:201713421-201713443 CAGAAGAAAAGGAGAAAGAATGG - Intronic
945489454 2:210437944-210437966 CAGAAAAAAAGCATGGCTAAGGG + Intronic
945677074 2:212868518-212868540 CAGAACAGAAGGAGCATTTATGG + Intergenic
945969699 2:216223544-216223566 CAGAACAAAAGGCAGAGGAAGGG + Intergenic
946542452 2:220699474-220699496 CAGATCAAAAGTAAAACTAATGG + Intergenic
946869663 2:224074418-224074440 CAGAAGGCAAGGAGGAGTAAAGG + Intergenic
947082187 2:226411062-226411084 TAGAACAAAAAGAGGAGGAAGGG - Intergenic
947586046 2:231357546-231357568 TAAAATAAAAGGAGGACTAGGGG - Intronic
948245303 2:236478197-236478219 TATAACAAAAGCAGCACTAAGGG - Intronic
948719072 2:239885121-239885143 CAGAAACAATGGAGGACTGAAGG + Intergenic
1170753623 20:19175944-19175966 CCTAACAAAAGGAGAAATAAAGG + Intergenic
1170843085 20:19939748-19939770 TAGAAGAAAAGGAGGGCTCAAGG - Intronic
1172234639 20:33362685-33362707 TAGTACAAAAGGAGGAGGAAGGG + Intronic
1173719319 20:45239829-45239851 AAGAACAAAAGAAGAAATAAAGG - Intergenic
1174480774 20:50829760-50829782 CAGAAGAAAATGAAAACTAAAGG + Intronic
1174952392 20:55056375-55056397 TAAAATAAAAGGAGGAATAATGG + Intergenic
1177053099 21:16263570-16263592 CAGAACAAAAGGAAAACGCAAGG - Intergenic
1177461774 21:21421924-21421946 AAGAAGGAAAGGAGGACAAATGG - Intronic
1177687307 21:24454147-24454169 AAGATCAAAACCAGGACTAAAGG - Intergenic
1178172590 21:30058230-30058252 AAGAACAAAATTATGACTAACGG + Intergenic
1179222001 21:39416609-39416631 CAGATCAAAATCAGGACTATAGG + Intronic
1179536873 21:42058624-42058646 CAGCACAAAGGGAGGAGTCAGGG - Intergenic
1181987238 22:26808712-26808734 CAGGCCAAAAGGAGGAGCAAGGG - Intergenic
1182056412 22:27358759-27358781 CACAACAAGAGAAGGACAAAAGG - Intergenic
1182287039 22:29254699-29254721 CAGGACAACAGGAGGATTATAGG + Intronic
1184730096 22:46367093-46367115 CAGTGGAAAAGGAGGACGAAGGG + Exonic
950187118 3:10952044-10952066 CAGAACAAAACAGGGACTTAGGG + Intergenic
952773325 3:37021748-37021770 CAGAATAAAAGGATCAGTAAAGG - Intronic
953546225 3:43865501-43865523 CAGAGGGAAAGGAGGACTCAAGG - Intergenic
954864913 3:53720016-53720038 CAGAGGATAAGGAGGATTAATGG - Intronic
955115874 3:56001110-56001132 GAGAAGGAAAGGAGGAATAAAGG + Intronic
955850087 3:63211065-63211087 CAGAAAAAAAGAAGGTCTTATGG - Intergenic
956898192 3:73685199-73685221 CAAAACAATAGGAGGATTCAGGG + Intergenic
957221424 3:77387818-77387840 CAGAACAAAAGGAGCAGCTAGGG - Intronic
957480616 3:80788743-80788765 TAGAACAAAAGGTGGGATAAGGG + Intergenic
960215618 3:115032855-115032877 CACAGCAAAAGGAGTGCTAAGGG + Intronic
960247961 3:115420500-115420522 TAGAAGAACAGGAGGACTAGAGG + Intergenic
960520798 3:118653050-118653072 CATGATAAAAGGAGGCCTAAAGG + Intergenic
962152715 3:132909924-132909946 CAGAAGAAAAGGAAGACAACAGG + Intergenic
963641593 3:147867111-147867133 CAGAACAGAAGGAGCAGCAAGGG - Intergenic
963994051 3:151685787-151685809 CAGTACAAAAGCAGGAATATTGG + Intergenic
965424649 3:168506892-168506914 AAGAAGAAAAGAAGGAATAAGGG - Intergenic
965824435 3:172716616-172716638 CAGAAGAAAAGCAGGCCAAAGGG + Intergenic
966345589 3:178975830-178975852 CAGAAAAAAAACAGGAATAAAGG + Intergenic
967490765 3:190088626-190088648 CAGATCAGAAGGAGGGCAAATGG + Intronic
968325788 3:197814130-197814152 GGGAACAAAAGGAGGTTTAATGG + Intronic
968636405 4:1683061-1683083 CAGCGCACAAGGAGGACTCAAGG + Intronic
969090779 4:4692484-4692506 TAGAACAAAAGGTGGAAGAAGGG - Intergenic
970337346 4:15062211-15062233 CTGAACAAACCGAGCACTAATGG - Exonic
970927565 4:21470682-21470704 CAGACAAGAAGGAGGATTAAGGG + Intronic
970954171 4:21791462-21791484 AAGAAGAAAAGGAGGAAGAATGG + Intronic
971063251 4:22996932-22996954 GATATCAAAAGGAGGACTGATGG - Intergenic
971620378 4:28848310-28848332 CAGGAAAAAAGGAGGACTCCAGG + Intergenic
972196906 4:36664699-36664721 CAGAACAAATGAAGAACCAAGGG - Intergenic
973239133 4:47938689-47938711 CACAACAAAAGATGGACTTAGGG - Intronic
973603577 4:52565126-52565148 GGGAACAAAATGAGGAATAATGG + Intergenic
975097998 4:70479820-70479842 CAAAACAAAATTAGGACCAAAGG + Intronic
976018909 4:80595409-80595431 AAGAACAAAAGGAGGAAGAATGG - Intronic
976028457 4:80721170-80721192 CAGAATAAAAGAAGAAATAATGG + Intronic
976119189 4:81761363-81761385 GAGAAGAAGAGGAGGAGTAAGGG - Intronic
976299710 4:83506386-83506408 CAGAAGAAAAGGAGGACTTCCGG - Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976749938 4:88443701-88443723 CATAAGAAAAGGAGGGTTAAAGG - Intergenic
977235398 4:94502067-94502089 CAGAAGAAGAGTAGGAATAAGGG - Intronic
977635888 4:99297927-99297949 CATAGCAAAAGCAAGACTAAGGG + Intergenic
978759588 4:112342172-112342194 AACAACAAAAGGAGGACAAGTGG - Intronic
979471485 4:121103466-121103488 TAAAACAAAAGCAGTACTAAAGG - Intergenic
979542033 4:121895153-121895175 CACAGCAAAAGCAGGATTAAGGG + Intronic
979625488 4:122840346-122840368 CAAAAGAAAAGAAGGAATAATGG + Intronic
980182183 4:129414593-129414615 AAGAACAAAAGGTGGAATCAAGG - Intergenic
980503188 4:133683121-133683143 AAGAAGATAAGGAGGACTTAAGG + Intergenic
984077803 4:175205365-175205387 CAAACCAAAATGAGGACTGATGG - Intergenic
984436280 4:179714017-179714039 CAGAACAAGAGGAAGACAGAGGG - Intergenic
984522557 4:180818863-180818885 CAGAACAGAAGGAAGAGAAAGGG - Intergenic
984666352 4:182433491-182433513 CAGAAGAAAGGGAGGACGAGAGG + Intronic
985083715 4:186292432-186292454 CAGAACAAAGCGAGGATGAAGGG - Intergenic
985165134 4:187085081-187085103 CAGAACAAATGTAAAACTAATGG + Intergenic
985964426 5:3329223-3329245 CCCAACAGAAGGAGGACTATGGG - Intergenic
986480681 5:8183928-8183950 CAGAAGACAGTGAGGACTAAAGG + Intergenic
986590774 5:9367312-9367334 CAGAACAATAAGAGAACTCATGG - Intronic
986603474 5:9497832-9497854 CAGACCAAAAGAGGGACTAACGG - Intronic
987929714 5:24388518-24388540 TAGACCACAAGGAGGACCAAAGG - Intergenic
987995545 5:25273047-25273069 CAGAAGGAAAGGAGGACAAAAGG - Intergenic
990266534 5:54082643-54082665 CAGAAAAAAAGGAGAGCCAAGGG - Intronic
992215400 5:74520015-74520037 CTGAAGAAAAGCAAGACTAAAGG + Intergenic
993856504 5:93082795-93082817 CAGAACAAATGGATGAAGAATGG - Intergenic
994361555 5:98855563-98855585 CAGTATAAAAAGAGGACTAATGG + Exonic
994986198 5:106936760-106936782 TAGAACAAAAGGATGAATAAGGG + Intergenic
995623620 5:114054562-114054584 CAGCACCAAAGGAGCACTCAGGG - Intergenic
996028750 5:118681802-118681824 CTGCAGAAAAGGAGGACAAATGG + Intergenic
996506319 5:124271233-124271255 AAGAACAAAAGGAGGAAAGAAGG + Intergenic
999230419 5:150058596-150058618 CAGATCAAAATGAGCACCAAAGG - Intronic
1000321336 5:160136986-160137008 CAAAAAAAAAGAAGAACTAAAGG - Intergenic
1001272511 5:170325662-170325684 CAGAAGAAAAGGAGGAATGGAGG + Intergenic
1001570197 5:172725769-172725791 CAGACAAAAAGGAGGAGAAAGGG + Intergenic
1003313628 6:4991160-4991182 CAGAAGAAAAGGAATAATAAAGG - Intergenic
1004306091 6:14502980-14503002 CAGAATATAAGGAGGACTTGTGG - Intergenic
1004390814 6:15208154-15208176 CAAACCAAAAGGAGGAATGAGGG - Intergenic
1006204844 6:32331553-32331575 CTGAACACAAGGTGGACAAAGGG + Intronic
1006513564 6:34534146-34534168 CAGGAGCAAAGGAGGACTGAGGG - Exonic
1007659778 6:43477009-43477031 CCCAGCAAAAGGAGCACTAAAGG + Intergenic
1007698226 6:43747271-43747293 CAGAACAAAAGGAAGATGGAGGG + Intergenic
1008150565 6:47946240-47946262 CAGAAAAAAAGCAGTAATAATGG - Intronic
1008247872 6:49201556-49201578 TAGAAAAAAAGGAGGAAGAAAGG - Intergenic
1009417303 6:63429929-63429951 CGGAAGGAAAGGAGGAATAAAGG + Intergenic
1009765817 6:68073984-68074006 CAGAAAAAAAGGAGAAAAAAAGG - Intergenic
1009970842 6:70624122-70624144 TAGAACAAAAGGCTGAGTAAGGG + Intergenic
1010284877 6:74065009-74065031 CAGAACAAAACCATGACCAAAGG - Intergenic
1012004230 6:93692576-93692598 CTGGGCAAAAGGAGGCCTAAGGG - Intergenic
1012112228 6:95251400-95251422 CATCAAAAAAGGAGGATTAAGGG + Intergenic
1012128379 6:95458578-95458600 CAGAACAAAACGAAAGCTAAAGG + Intergenic
1012720078 6:102730104-102730126 TAGAAGAAAAGGAAAACTAATGG - Intergenic
1012747837 6:103117236-103117258 CAGAACAAGAGGTGGAGAAAGGG + Intergenic
1013334157 6:109138092-109138114 CTGAACAAAAGGGAGACTGAAGG + Intronic
1014281476 6:119446617-119446639 CAGAATAAAAGAAGGAATAAAGG - Intergenic
1014705568 6:124742320-124742342 TAGAACAAAAGGCAGAGTAAGGG + Intronic
1014772111 6:125468653-125468675 GAGAACAAGAGCAAGACTAAAGG + Intergenic
1015911727 6:138175290-138175312 CAAATCAAAAGCAAGACTAAGGG - Intronic
1016093147 6:140003451-140003473 CAGAACAAAAGGCTGGGTAAGGG + Intergenic
1016449420 6:144166484-144166506 CAGAAAGAAAGGAAGACTGAGGG - Intronic
1016736465 6:147485277-147485299 AAAGACAAAAGAAGGACTAAAGG - Intergenic
1016759938 6:147725836-147725858 CAGGACAAAAGGAGAAATGATGG + Intronic
1016869606 6:148803759-148803781 CAGAACAAAGTGAGGAATGATGG - Intronic
1017043048 6:150323162-150323184 CAGAATAAAGGGAGAACAAATGG - Intergenic
1017657370 6:156642757-156642779 TAGAGCAAAAGGCGGAGTAAGGG - Intergenic
1018404984 6:163470679-163470701 CAGAAGAAAAGGAAGAGAAATGG + Intronic
1020748520 7:12110501-12110523 CAGAAAAAAAAAATGACTAAAGG + Intergenic
1021271248 7:18589113-18589135 CAGAACCTAAGGAGAACTCAAGG + Intronic
1023153367 7:37223279-37223301 CAGTAAATAAGGAGGACTCAAGG + Intronic
1023693999 7:42825905-42825927 CAGAACAAACAGAGGATTATGGG + Intergenic
1023730958 7:43191830-43191852 CAGTAGAATAGGAGGACTGATGG + Intronic
1024412518 7:49061913-49061935 TAGAGCAAAAGGAGGAATAAAGG - Intergenic
1025066262 7:55858404-55858426 TAGCACAAAAGGAAGACTTAAGG + Intronic
1026744044 7:72997433-72997455 CAAAACAAAATGAGGACAATGGG + Intergenic
1027030151 7:74882128-74882150 CAAAACAAAATGAGGACAATGGG + Intergenic
1027099693 7:75367649-75367671 CAAAACAAAATGAGGACAATGGG - Intergenic
1028160766 7:87482444-87482466 CAAAATAAAAGAATGACTAAAGG + Intergenic
1029320980 7:99759812-99759834 AAGAACAAAATGAGGAGAAAGGG + Intronic
1030139728 7:106292265-106292287 AAGAAAAAAACGAGGAATAATGG - Intergenic
1030531812 7:110720400-110720422 AAGAAATAAAAGAGGACTAAAGG + Intronic
1031148815 7:118028824-118028846 CAGAAAAAAATGAGGAGAAATGG - Intergenic
1033492591 7:141858515-141858537 AAGAACTAAAGGAAAACTAAAGG - Intergenic
1034050306 7:147977011-147977033 CAGCAGAAAAAGAGGACAAAAGG + Intronic
1035349161 7:158232636-158232658 CAAAAAAAAAGGAGGACTATAGG + Intronic
1035849737 8:2905248-2905270 CAGAACAAACTGAGAACCAATGG + Intergenic
1037529787 8:19761734-19761756 CAGTCCAGGAGGAGGACTAAAGG + Intergenic
1038167399 8:25099103-25099125 CAGACCATAAGCAGAACTAATGG + Intergenic
1040947087 8:52894987-52895009 CAGAAAAAAAGCAGGAGGAAAGG + Intergenic
1041128260 8:54667269-54667291 CAGCACAACAGGATAACTAAAGG + Intergenic
1041716367 8:60935923-60935945 CAGAATAAAAGGCCGAGTAAGGG + Intergenic
1044123905 8:88433999-88434021 TACAACAAAAGGAGTACCAAGGG + Intergenic
1044605980 8:94047791-94047813 TAGAACAAAAGGTGGAGGAAGGG + Intergenic
1044923292 8:97187909-97187931 CCGATTAAAAGGAGGACTCACGG + Intergenic
1045147649 8:99365429-99365451 AACAGCAAAAGCAGGACTAAGGG - Intronic
1045756122 8:105544597-105544619 CTGAAGAAAAGGAGGTCTAATGG + Intronic
1046006231 8:108489064-108489086 TAGAACTGAAGGAGGATTAAGGG + Intergenic
1046607236 8:116384902-116384924 AAGAACAAAAAGAGGTCTGAGGG + Intergenic
1047053671 8:121140814-121140836 TACAACAAAAGGAAGACTCAAGG - Intergenic
1047066823 8:121293261-121293283 CAGAATAAAAGGATGAAGAAAGG + Intergenic
1047726026 8:127684649-127684671 CAGAAAAAAGTGAGGACCAAAGG + Intergenic
1048264865 8:132976753-132976775 CAGAACAGAAGGAGGAGGACTGG + Intronic
1048299868 8:133243671-133243693 AAGAAAAAAAGGAGGAAGAAAGG + Intronic
1048590525 8:135816899-135816921 TAGAACAAAAGGAGGAAGAATGG + Intergenic
1049769337 8:144372691-144372713 CATAACAGAAGGGGCACTAAAGG + Intergenic
1050957440 9:11682421-11682443 AAGAAAAAAAGGAAGACTGAGGG + Intergenic
1051607810 9:18933709-18933731 CAGAAACAATGGAGGACTGAAGG - Intronic
1052391356 9:27882022-27882044 CATGACAAAAGGAGGAGGAAGGG + Intergenic
1053535910 9:38925603-38925625 CAGAACAAATGGAAGAGCAAGGG - Intergenic
1053604290 9:39641196-39641218 CAGAACAAAAGGAGAGCTGTAGG - Intergenic
1053862109 9:42397246-42397268 CAGAACAAAAGGAGAGCTGTAGG - Intergenic
1054249250 9:62701218-62701240 CAGAACAAAAGGAGAGCTGTAGG + Intergenic
1054563361 9:66735750-66735772 CAGAACAAAAGGAGAGCTGTAGG + Intergenic
1054630223 9:67438349-67438371 CAGAACAAATGGAAGAGCAAGGG + Intergenic
1054878009 9:70116704-70116726 AAAAAAAAAAAGAGGACTAAAGG + Intronic
1055997819 9:82180877-82180899 CAGAACAAAGGGAAGACTTGAGG - Intergenic
1056240062 9:84636410-84636432 CAGAACAAAAGTAGGCCAAGAGG - Intergenic
1056536805 9:87535223-87535245 GAGAACGAAAGGGGGGCTAATGG - Intronic
1056744965 9:89292767-89292789 CACAGCTAAAGGAGTACTAATGG + Intergenic
1057303004 9:93897161-93897183 CAGAACAAAAGGGAAAGTAAAGG - Intergenic
1057577342 9:96253874-96253896 CAGAACAAAAGCAGAATTCATGG + Intronic
1058836721 9:108863834-108863856 CAAAACAAAAGCAGGAGTAGGGG + Intergenic
1059728416 9:117031613-117031635 CAGAAAAAAAGCAGGGCTCAAGG + Intronic
1059906213 9:118989819-118989841 CAGAACAAAAAGAAGACTGATGG + Intergenic
1059949075 9:119443087-119443109 AAGAACTACAGGTGGACTAAAGG + Intergenic
1060829180 9:126703058-126703080 CAGCACAGAGGGAGGATTAATGG + Intergenic
1061600938 9:131669625-131669647 CAGAACATGAGGAGGAGAAAGGG - Intronic
1186296187 X:8151119-8151141 TAGAGCAAAAGGAGCACTCATGG + Intergenic
1187310741 X:18138965-18138987 CATAAAAAAAGGAAGACTATTGG + Intergenic
1189759466 X:44306343-44306365 AAAAACAAAAGGAGGGCAAAGGG + Intronic
1190729625 X:53217036-53217058 GAGAACAAAAGAAGGGATAATGG + Intronic
1191608475 X:63086402-63086424 CAGATCTGAAGGAGGGCTAAAGG - Intergenic
1192186572 X:68950998-68951020 CAATACAAAAAAAGGACTAAGGG - Intergenic
1192872932 X:75202054-75202076 CATAACAAAAGGAAGACCATGGG + Intergenic
1193828136 X:86252164-86252186 CACATCAAAAAGAGGGCTAAGGG - Intronic
1194184066 X:90750193-90750215 CAAAACAAAATGAGGAGTAGGGG + Intergenic
1194649794 X:96500915-96500937 TAGAACAAAAGGTGGAATAAGGG + Intergenic
1195400054 X:104451890-104451912 AAGAACAAAAAGAGAATTAAAGG - Intergenic
1195420042 X:104664492-104664514 TCGGAGAAAAGGAGGACTAATGG - Intronic
1195793220 X:108613321-108613343 CAGCACAAAAAGAGGCCTATAGG + Intronic
1196018401 X:110963917-110963939 CAGAGCATAAGGAGAAGTAAAGG + Intronic
1196322403 X:114356704-114356726 CAGAAGAAAAGGAGGGAAAAAGG + Intergenic
1198809408 X:140520388-140520410 CTTACCAAAAGGAGGACAAAAGG - Intergenic
1200530659 Y:4332117-4332139 CAAAACAAAATGAGGAGTAGGGG + Intergenic
1200757525 Y:7003848-7003870 CAGAAAAAAAGGAGGAGGGATGG - Intronic
1201729743 Y:17191073-17191095 CAGAACACAAGGAGGACCAAGGG + Intergenic