ID: 1130334657

View in Genome Browser
Species Human (GRCh38)
Location 15:82948701-82948723
Sequence CAGGGGAAACAGCAAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 870
Summary {0: 1, 1: 3, 2: 21, 3: 147, 4: 698}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130334650_1130334657 18 Left 1130334650 15:82948660-82948682 CCAAAGTCTGAAAGGAAAGAGGA 0: 1
1: 0
2: 6
3: 55
4: 390
Right 1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG 0: 1
1: 3
2: 21
3: 147
4: 698
1130334648_1130334657 25 Left 1130334648 15:82948653-82948675 CCTGAGGCCAAAGTCTGAAAGGA 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG 0: 1
1: 3
2: 21
3: 147
4: 698
1130334646_1130334657 26 Left 1130334646 15:82948652-82948674 CCCTGAGGCCAAAGTCTGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 177
Right 1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG 0: 1
1: 3
2: 21
3: 147
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130334657 Original CRISPR CAGGGGAAACAGCAAGTGCA AGG Intronic
900812727 1:4820206-4820228 CTTGGGAAGCAGCAAATGCAGGG + Intergenic
901690119 1:10967336-10967358 CAGAGGGCACAGCCAGTGCAAGG - Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902125843 1:14210257-14210279 CAGGCAAGACAGCATGTGCAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902235105 1:15052325-15052347 CAGGCGAGAGAGCATGTGCAGGG + Intronic
902569882 1:17340513-17340535 CAGAGGGAACGGCAAGTGCGTGG + Intronic
902826662 1:18979243-18979265 CAGAGGGAACAGCAAGACCATGG + Intergenic
902919062 1:19655880-19655902 CAGGGAAAAGAACAGGTGCAAGG - Intronic
903367853 1:22815996-22816018 CAGGTGACACAGCACGTGAATGG - Intronic
903739086 1:25547870-25547892 TAGAGGGAACAGCAAGTGCAGGG + Intronic
903803840 1:25990071-25990093 CAAGGGAGACAGGAAGTCCAAGG + Intronic
903849263 1:26296482-26296504 CAGAGGGAACAGCAACAGCACGG + Intronic
904454890 1:30641606-30641628 CAGAGGAAACAGCATGTGTGAGG - Intergenic
904480239 1:30788771-30788793 CAGAGGGAACAGCATGTACAAGG + Intergenic
904488195 1:30841487-30841509 CAGGGAAAACAGCGTATGCATGG - Intergenic
904616200 1:31751193-31751215 TAGAGGAAACAGCCTGTGCAAGG - Intronic
904816380 1:33203930-33203952 CAGGGGAAACAGTCAGTAAAAGG - Intergenic
904849266 1:33445054-33445076 CAGGCAAGACAGCATGTGCAGGG - Intergenic
904921573 1:34012223-34012245 CAGCGGGAAGAGCAAGGGCAAGG - Intronic
905015418 1:34774988-34775010 GAGAAGAAAGAGCAAGTGCAGGG + Intronic
906551485 1:46669407-46669429 CAGAGAAAACAGCAAGTGTTAGG - Intronic
906733867 1:48105694-48105716 CAGGGGAGATAGCTGGTGCAGGG - Intergenic
907184320 1:52598197-52598219 TAGAGGAAGCAGCAAGTACAAGG - Intergenic
907393059 1:54171219-54171241 CAGAGGAAGCAGCGAGTGTAAGG + Intronic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
908241695 1:62194220-62194242 CAGAGGAAACAGCCAGTGCAAGG + Intergenic
908251571 1:62270068-62270090 GCAGGGAAACAGCAAGTGCCAGG + Intronic
908463657 1:64370282-64370304 CAGAGGGAACAGCTAGTGCATGG + Intergenic
908550675 1:65205954-65205976 TAGAGGGAACAGTAAGTGCAAGG - Intronic
908932925 1:69339452-69339474 CAGGCAAGACAGCATGTGCAGGG - Intergenic
909068558 1:70964498-70964520 CAGGAAAGACAGCATGTGCAGGG + Intronic
909352254 1:74667979-74668001 CAGGAGAGAAAGCAAGTGAAAGG - Intronic
909583814 1:77266829-77266851 CAGAAGAAACAGCAAGTGAGAGG + Intergenic
909685181 1:78339817-78339839 CAGGAGAAAGAGCTAGAGCAAGG + Intronic
911799143 1:102111276-102111298 CAGGCAAGACAGCATGTGCAGGG + Intergenic
911971238 1:104440516-104440538 CTGGGTAAAAAGCAAGTGGATGG - Intergenic
912179057 1:107195733-107195755 CAAAGGAATCAGCAAGTGCAAGG - Intronic
912251198 1:108014212-108014234 CAGAGGAAACAGCATGTACAAGG - Intergenic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912696929 1:111848911-111848933 CAGGGGAAAAGGGAAGAGCAAGG - Intronic
913403829 1:118465611-118465633 CAGGAGAGAAAGCAAGTGAAGGG - Intergenic
913968834 1:143398533-143398555 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914063213 1:144224132-144224154 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914115937 1:144742222-144742244 AAGAGGAAGCAGCAAGTGCAAGG + Intergenic
914333401 1:146693865-146693887 CAGGAGAGACAGCAAGTGAGAGG + Intergenic
914339341 1:146745707-146745729 AAGGGGAAAAAGCAAATGGATGG - Intergenic
916124273 1:161555419-161555441 CAGGTGATCCATCAAGTGCAGGG + Intergenic
916134154 1:161636778-161636800 CAGGTGATCCATCAAGTGCAGGG + Intronic
916155332 1:161839783-161839805 CAGAGGAAACAGCCATTGCAGGG + Intronic
917127100 1:171696685-171696707 CAGGAGAAACAGCAAGTCCAAGG + Intergenic
917626380 1:176850701-176850723 CACAGGGAACAGCAAGTGTAAGG + Intergenic
917704491 1:177618303-177618325 CAGAGGAAACAGAAAGATCAAGG + Intergenic
917809339 1:178642338-178642360 CAGTGGAAACAGCAAGACCCCGG - Intergenic
919141877 1:193582601-193582623 AAGAGGAAACAGGAAATGCATGG + Intergenic
919587462 1:199456596-199456618 CAGAGGGAACAGTAAGTACAAGG + Intergenic
919796671 1:201325220-201325242 TAGGGGAAGCACCAAGGGCAGGG + Intronic
919879945 1:201894817-201894839 CAGGGGAAGGAGCTAGGGCAGGG + Intergenic
920259393 1:204678674-204678696 CAGAGGGGACAGCAGGTGCAAGG - Intronic
920288643 1:204900662-204900684 CAGGGGAGACAGGGAGTGCTGGG + Intronic
920776355 1:208941732-208941754 CAGAGGGAACAGCAAATGCTAGG - Intergenic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921416209 1:214890464-214890486 CAGAGGGAAGAGCAAGTGTAAGG + Intergenic
921894042 1:220380383-220380405 CAGGCAAGAGAGCAAGTGCAGGG - Intergenic
922897723 1:229113454-229113476 CATGGCAGACAGCAAGTGCTGGG - Intergenic
923197466 1:231682346-231682368 CTTGAAAAACAGCAAGTGCAGGG - Intronic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923384252 1:233450842-233450864 CAGGCAAAAGAGCATGTGCAGGG + Intergenic
1064003806 10:11684528-11684550 TAGGGAAAACAGCTAATGCATGG + Intergenic
1064044114 10:11995838-11995860 CAGAGGCAACAGTATGTGCAGGG - Intronic
1064051788 10:12066093-12066115 TAGGGGAACCTGCAAGTGGAAGG - Intergenic
1064232872 10:13544868-13544890 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1064577613 10:16762010-16762032 CAGGGGGAACAGCAAGACCGGGG - Intronic
1066628136 10:37430757-37430779 CAGTGGAAACAGCAAGGGTGAGG + Intergenic
1066675701 10:37884788-37884810 CAGGGAAAGCATCAAGTGCAGGG + Intergenic
1067247294 10:44557551-44557573 CTGTCCAAACAGCAAGTGCAGGG - Intergenic
1067978997 10:51061245-51061267 CAGGCAAAAGAGCATGTGCAGGG + Intronic
1068226605 10:54114777-54114799 TAGTGGAAATAGCAAGTGAACGG + Intronic
1068612437 10:59075059-59075081 CAGAGAAAAGAGCAAGTACAAGG - Intergenic
1068894236 10:62181751-62181773 AAGAGGAAACAGCAAGTGCAAGG + Intergenic
1068922686 10:62501306-62501328 CAGAGGGAAGAGCATGTGCAAGG - Intronic
1069082086 10:64099417-64099439 AATGGGAAACATCAAGTGCATGG + Intergenic
1069099800 10:64306146-64306168 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1069172444 10:65249404-65249426 CAGGGGAAAAAACAAATCCAGGG + Intergenic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069839665 10:71331713-71331735 TAGGGGAAACAGGCAGAGCAGGG - Intronic
1070430997 10:76337500-76337522 CTGAGGAAGGAGCAAGTGCAAGG + Intronic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1071789195 10:88936569-88936591 CAGGGGCAACAGAGAGGGCAGGG - Intronic
1073381058 10:103078360-103078382 CAGGGGACACAGCCACTGCCGGG - Exonic
1073990817 10:109260792-109260814 CAGGCAAAAGAGCACGTGCAGGG + Intergenic
1074119354 10:110481877-110481899 TAGAGGGAAGAGCAAGTGCAAGG - Intergenic
1074221035 10:111438204-111438226 CAGAGGAAATGTCAAGTGCAAGG - Intergenic
1074324518 10:112436065-112436087 CAGAGGGAACAACATGTGCAAGG + Intronic
1074848038 10:117416071-117416093 AAGAGGAAACAGCAAGGGTAAGG + Intergenic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1075552123 10:123400435-123400457 CAGAGGGAAAGGCAAGTGCAAGG - Intergenic
1075570979 10:123545211-123545233 CAGGCAAAAGAGCATGTGCAGGG + Intergenic
1075772179 10:124948546-124948568 CAGAGCAAACAGCAAGTAAAAGG - Intronic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1076395507 10:130135589-130135611 CAGGAGACACAGGAAGTGCAAGG + Intergenic
1076450883 10:130556223-130556245 CGGGGCAAAAGGCAAGTGCAAGG - Intergenic
1076830392 10:132991535-132991557 CTGGGGCCACAGCAAGTTCAAGG - Intergenic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077457607 11:2690341-2690363 TAGTGGAAACAGCAGCTGCAGGG - Intronic
1077465713 11:2732844-2732866 CAGGGGAGACCGCCAGGGCAGGG - Intronic
1077795455 11:5486735-5486757 CATGGGCATCAGCCAGTGCAGGG - Intronic
1078296385 11:10075606-10075628 CAGGAGAGACAGCAAATGAAGGG - Intronic
1078508323 11:11967984-11968006 CAGGGGAAGCAACAGGTGTAGGG + Intronic
1078758892 11:14235913-14235935 CACAGGGAACAGCAAGTGCAAGG + Intronic
1079176308 11:18144590-18144612 CAGGCAAGACAGCACGTGCAGGG + Intronic
1079198894 11:18357176-18357198 TTTGTGAAACAGCAAGTGCAGGG - Intronic
1079312151 11:19376685-19376707 TAGGGAAGACAGCAAGTGAAGGG + Intronic
1079404193 11:20130732-20130754 CAGGGAATGCAGCAAGTTCATGG - Intergenic
1079759575 11:24311289-24311311 CAGGAGAGACAGACAGTGCAGGG - Intergenic
1080505765 11:32911665-32911687 CAGGAGAGACAGCAAGTGCAAGG - Intronic
1080590201 11:33716770-33716792 GAGGGGCAACAGCAGGTGCCAGG - Intronic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1080738569 11:35041965-35041987 CAGAGGAGACAGCAAATGAAAGG - Intergenic
1080974858 11:37326581-37326603 CTGAGGGAACAGCAGGTGCAAGG - Intergenic
1081356466 11:42120487-42120509 CAGGGAAGACAGCATGTGTAGGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081729279 11:45357656-45357678 CAAAGGGAACAGCTAGTGCAAGG - Intergenic
1081743510 11:45457295-45457317 CAGGAGAAACAGCAGCTGTAAGG + Intergenic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1082827148 11:57588228-57588250 CAGGAGAGAGAGCAAGTGAAAGG - Intergenic
1082893486 11:58164868-58164890 CAGAGGGAACAGCAAATGCAAGG - Intronic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1084851354 11:71943811-71943833 CAGGAGGAGCAGCATGTGCAAGG + Intronic
1084972693 11:72780476-72780498 GAAGGGAAAGAGCAAGAGCAGGG + Intronic
1086308485 11:85508362-85508384 CAGAGGGAATAGCAAGTGCAAGG - Intronic
1086400428 11:86457021-86457043 CAGGGGGAAAAGCAAGTACTTGG - Intronic
1086558656 11:88141778-88141800 CAGAGGAAACAGCACGTGAAAGG - Intronic
1086566128 11:88229226-88229248 CAGGGGACACAGCAACCCCAAGG - Intergenic
1087144534 11:94798925-94798947 AAGGGGAGACAGCAAGTGTAGGG + Intronic
1088312148 11:108471258-108471280 TAGTGGAATCATCAAGTGCAGGG + Intergenic
1088332446 11:108667704-108667726 CAGTGGAAACATCAAGTACCAGG - Intronic
1088710044 11:112499681-112499703 CAGAGCAATCAGCCAGTGCAGGG + Intergenic
1089372656 11:117972281-117972303 CAAAGGGAACAGCAAGTGCCAGG - Intergenic
1089416445 11:118296159-118296181 CAGGGGGAACTGGAAGTTCAGGG - Intergenic
1090197258 11:124827280-124827302 CAGAGGGAATAGCAAGTGCCAGG - Intergenic
1090257744 11:125297736-125297758 CAGAGGAAACAGCATTTTCAAGG - Intronic
1090998137 11:131885549-131885571 CAGCAGAAACTGCAAGAGCAAGG + Intronic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1091592747 12:1854751-1854773 CAAGGGAAACAGCATGTATAGGG - Intronic
1091989093 12:4940173-4940195 CAGAGGGCACAGCAAGTGCAAGG + Intergenic
1092106938 12:5927979-5928001 CAGGGGAAACACCAAAGCCAAGG + Intronic
1092312332 12:7371067-7371089 CAGGCAAAAGAGCATGTGCAGGG - Intronic
1092522112 12:9285832-9285854 CAAGGGGAGCAGCAAGTGCAAGG + Intergenic
1092545170 12:9446024-9446046 CAAGGGGAGCAGCAAGTGCAAGG - Intergenic
1092755043 12:11755472-11755494 GAGGGCAAACAGCAAGAGCCTGG - Intronic
1092891382 12:12972335-12972357 CAGACAAAACAGCTAGTGCAAGG + Intergenic
1093114193 12:15189364-15189386 AAAAGGAAACAGCAAGTGAAAGG - Intronic
1093130418 12:15385278-15385300 CAGAGGAAAAGGCAAGAGCAGGG + Intronic
1093229281 12:16523524-16523546 AAGGTAAAACAGCAAGTGAATGG - Intronic
1093296175 12:17394884-17394906 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1093783133 12:23160173-23160195 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1093919925 12:24848497-24848519 CTGGGGACACAGAAATTGCAGGG - Intronic
1094061705 12:26321196-26321218 CAGAGAAAAGAGCAAATGCAAGG + Intergenic
1094146052 12:27229513-27229535 AAGAGGAAACAGCAAATGCAAGG - Intergenic
1094507777 12:31076025-31076047 CAAGGGGAGCAGCAAGTGCAAGG + Intronic
1094691800 12:32776696-32776718 CAGGGGAAACAGACAGTGAACGG + Intergenic
1094701235 12:32872621-32872643 CAGGGGAACCAGCCTGGGCAGGG - Intronic
1095572291 12:43697061-43697083 CAGAGGGAACATCAAGTTCAAGG - Intergenic
1096231883 12:49901273-49901295 GAGGGGCAGCAGCAGGTGCATGG - Exonic
1096394380 12:51254781-51254803 CAGAGGGGACAGCAAGTTCATGG + Intronic
1096402604 12:51319620-51319642 AAGGAGAAAGAGCAAGAGCAAGG + Intronic
1096678948 12:53242151-53242173 CGGGGGCAAGAGCAGGTGCAGGG - Intergenic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097340569 12:58433040-58433062 TGGGGGAAAGAGCAAGTGGAGGG - Intergenic
1097340623 12:58433726-58433748 TGGGGGAAAGAGCAAGTGGAGGG + Intergenic
1097436846 12:59560690-59560712 CAATGGAAACAGCACCTGCAAGG + Intergenic
1097699648 12:62807044-62807066 CAGTAGCAACAGCAGGTGCAAGG + Intronic
1097807821 12:63985246-63985268 CAAGGGAAACATCATGGGCAAGG + Intronic
1098270014 12:68761044-68761066 CAGAGGCAACAGCAGGTGCGAGG + Intronic
1098407349 12:70140505-70140527 CAAGGGAAAGAGAAAGGGCAAGG - Intergenic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1099115398 12:78617837-78617859 AATGGGAAAGAGAAAGTGCATGG + Intergenic
1099719104 12:86338330-86338352 CAGCTGATACATCAAGTGCAGGG + Intronic
1100377079 12:94027327-94027349 GAGGGGAAAAAGAAAGTGCTAGG + Intergenic
1100377246 12:94028911-94028933 AAGAGGAAAAAGAAAGTGCAGGG + Intergenic
1101287161 12:103326627-103326649 CAGAGGGAACAGCAAAAGCATGG - Intronic
1101421405 12:104554318-104554340 CAGAGGGAACAGCATGTGCAAGG + Intronic
1101437985 12:104680326-104680348 CAGAGAGAAGAGCAAGTGCAAGG + Intronic
1101574322 12:105983451-105983473 CATGGAGAACAGCAAGAGCAAGG + Intergenic
1101677635 12:106933069-106933091 AAGGTGAAACATCAAGTGCTGGG + Intergenic
1101718846 12:107333994-107334016 CAGAGGGAACAGCCAGTGTAAGG + Intronic
1101834221 12:108283938-108283960 CAGCAGGAATAGCAAGTGCAAGG + Intergenic
1102115693 12:110401541-110401563 CAGGAGGAACAGCAAGTACAAGG + Intronic
1102694498 12:114787601-114787623 TAGAAGACACAGCAAGTGCAAGG + Intergenic
1102730868 12:115108217-115108239 CAGAGGGAAAAGCAAGTGCAAGG - Intergenic
1103155672 12:118682771-118682793 CAGAGGAAACAGCAAAGGCTGGG + Intergenic
1104411087 12:128558432-128558454 CAGGTAAGACAGCATGTGCAGGG - Intronic
1104647608 12:130508462-130508484 CAATGGAATCAGCAGGTGCAGGG - Intronic
1104659134 12:130596652-130596674 CATGGGACACAGTAAGTGCTCGG + Intronic
1104848974 12:131862114-131862136 CAGAGGGAACAGCTAGTGCAAGG + Intergenic
1104988263 12:132609783-132609805 CAGGGGCAACAGCACCTCCAGGG - Intronic
1105330633 13:19412298-19412320 CAGGCGGAATAGGAAGTGCATGG + Intergenic
1106347410 13:28892388-28892410 CAAGGTGAACAGCAAGTTCAAGG + Intronic
1106946877 13:34838015-34838037 CAGAGGAAATAGTAAGTACAAGG + Intergenic
1107073045 13:36292808-36292830 CAGGGAAAACAGACAGTGTAGGG + Intronic
1107452277 13:40520615-40520637 CGAGGGAAACAGAATGTGCATGG + Intergenic
1108257904 13:48628352-48628374 CAGGAGAGAGAGCATGTGCAGGG + Intergenic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1109332386 13:60945539-60945561 CAGAGGGAGCAGCTAGTGCAAGG + Intergenic
1110134768 13:72052440-72052462 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1110164890 13:72429484-72429506 CTGAGGAAACAGCAAGTGCTTGG + Intergenic
1110413959 13:75232295-75232317 CAGAGGGAACAGAAGGTGCATGG - Intergenic
1111624672 13:90769381-90769403 CAGGGGAAGCTGAAAGTGAAGGG + Intergenic
1111716515 13:91886208-91886230 CAAGAGAGACAGCATGTGCAGGG + Intronic
1111799208 13:92961229-92961251 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1112198513 13:97250993-97251015 CAGTGGAAATAGCAATGGCAAGG - Intronic
1112410741 13:99161337-99161359 CAGGCGAGACAGCTTGTGCAGGG + Intergenic
1113447889 13:110384562-110384584 CAGAGGACATAGCAAGTCCAGGG - Intronic
1113544859 13:111140499-111140521 CAGAGGGAACAGCTAGTGCGAGG + Intronic
1113914198 13:113861230-113861252 CAGGGGAAACAGCCAGGGCTGGG + Intronic
1114556704 14:23566387-23566409 CAGGGGATTCAGCCAGTACAAGG - Exonic
1114904508 14:27109445-27109467 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1114936910 14:27549638-27549660 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1115505907 14:34093808-34093830 CAGGGGAAATAGCTTGTACAAGG + Intronic
1115921492 14:38379244-38379266 CAGAGGAAACAGCAAGTGAATGG + Intergenic
1116013322 14:39376763-39376785 GAGGGGAAATAGGAAGTGTAGGG + Intronic
1116579254 14:46617798-46617820 CAGGAGAGAGAGCAAGTGAATGG + Intergenic
1117854311 14:60011230-60011252 CAGGCAAGACAGCATGTGCACGG + Intronic
1118250190 14:64152269-64152291 CTGGTCAAACAGCCAGTGCAGGG + Intronic
1118790873 14:69091544-69091566 AAGGGGAAACAGTGAGTGCCTGG - Intronic
1118884433 14:69854540-69854562 CAGAGGGAACAGCAAATACAAGG - Intronic
1119045480 14:71314991-71315013 CAGAGGAAAGAGCAAATGCAAGG + Intergenic
1119894599 14:78209254-78209276 CAGGTGAAACAGGAAGAGCATGG + Intergenic
1120094509 14:80373797-80373819 CAGAGGCATCTGCAAGTGCAAGG + Intronic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1120923170 14:89773204-89773226 AAGGGGAAAGAGCACGTGGAGGG + Intergenic
1120927374 14:89811127-89811149 CAGAGGGAACAGCATGTGCAAGG + Intronic
1121150452 14:91628616-91628638 CAGGAGAAAGAGACAGTGCAGGG - Intronic
1121263271 14:92581900-92581922 AAGGGGAAACATCAGGGGCAGGG + Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121526044 14:94620230-94620252 CAGAGGGAACAGTCAGTGCAAGG + Intronic
1122024882 14:98868436-98868458 GAGGGGAAATGGCAGGTGCAAGG + Intergenic
1122272310 14:100573721-100573743 CAGGGGAGACACCAAGGGCTGGG + Intronic
1122306808 14:100771727-100771749 CATGGAAAACAGCAAGTGTTAGG + Intergenic
1122580590 14:102769216-102769238 CAGAGGGAACAGCAGGTGCCAGG + Intergenic
1123670108 15:22647912-22647934 CAGGATAAATAGCTAGTGCATGG + Intergenic
1123802397 15:23834831-23834853 CAGGCAAAAGAGCATGTGCAGGG + Intergenic
1123978568 15:25577240-25577262 CCAGGGAAACGGCAAATGCAGGG - Intergenic
1124239443 15:28017695-28017717 CAGGTGACACAGCCTGTGCATGG + Intronic
1124425656 15:29560507-29560529 CAGTGGACACAGCAAGGGCAGGG - Intronic
1124526082 15:30454328-30454350 CAGGATAAATAGCTAGTGCATGG + Intergenic
1124614274 15:31230361-31230383 CAGGGAAGCCAGCAAGTGCTAGG - Intergenic
1124722063 15:32118930-32118952 CAGAAGGAACAGCCAGTGCAGGG + Intronic
1124772572 15:32553357-32553379 CAGGATAAATAGCTAGTGCATGG - Intergenic
1125194841 15:37034263-37034285 ATGGGGAAACAGAAAGTCCAGGG + Intronic
1125203919 15:37129430-37129452 AAGGGGCAAGGGCAAGTGCAAGG + Intergenic
1125359367 15:38849520-38849542 CAGGGGAAATAGCAAGGTAAAGG + Intergenic
1125507902 15:40277659-40277681 GAAGGGAAACAGGAAGTGAAAGG + Intergenic
1126177091 15:45745815-45745837 CAGAGGAAACAGCAGGTGTGAGG + Intergenic
1126475221 15:49058792-49058814 CAGTGGAAGCAGCAAGGCCAAGG - Intergenic
1127086140 15:55426192-55426214 CAGCTGATCCAGCAAGTGCAGGG + Intronic
1127278922 15:57472230-57472252 CAGAGGAAATAGCATGTGCAAGG + Intronic
1127294353 15:57596705-57596727 GAGGGGAAACAGCACAGGCACGG - Intronic
1127375311 15:58378937-58378959 CAGGGGAGAAAGCAATTGGATGG - Intronic
1127699128 15:61479990-61480012 CAGAGGAAATAGCAAGTGCAAGG + Intergenic
1128321347 15:66696868-66696890 CACAGAGAACAGCAAGTGCAAGG - Intergenic
1128527965 15:68425271-68425293 CAGGGCATTCACCAAGTGCAGGG - Intronic
1128737462 15:70061304-70061326 CAGGGAAAGGAGCAAGGGCAGGG + Intronic
1129153120 15:73701567-73701589 TAGAGGAAACAGCAGGTGGAAGG - Intronic
1129276062 15:74446073-74446095 CAGGGGAAGCAGGGAGTTCATGG + Exonic
1129941205 15:79498043-79498065 CTGTGGAAACAGCAAATTCAAGG - Intergenic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130430112 15:83839297-83839319 CAGAGGAAACACAAAGTTCATGG + Intronic
1130648485 15:85748768-85748790 CAGGGGACACAGCCAGTGGGGGG - Intronic
1130822232 15:87507856-87507878 CAGCAGAAACTGCAGGTGCAAGG - Intergenic
1130830625 15:87594887-87594909 CAGGGGACACAGCTCATGCAAGG - Intergenic
1131348300 15:91672134-91672156 CAGGAGAAATAGCAAATGCCAGG - Intergenic
1131947077 15:97635278-97635300 CAGGGGAAAGAGCATCTGAAAGG - Intergenic
1132097406 15:98997978-98998000 CAGGGGGAAAAACAAGTGCATGG - Intronic
1132761617 16:1511217-1511239 CAGGGGCAGCAGCACGTGCCTGG - Intronic
1132777598 16:1604412-1604434 CAGGTGGCACAGCATGTGCAGGG + Intronic
1133822406 16:9248394-9248416 AAGGGGGCAGAGCAAGTGCAGGG + Intergenic
1134271969 16:12740753-12740775 CAGAGTGAACAGCAGGTGCAAGG + Intronic
1134285440 16:12857652-12857674 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1134374123 16:13654294-13654316 CAGGCAAGAGAGCAAGTGCAGGG - Intergenic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135054394 16:19218891-19218913 CAGAGGGAACAACATGTGCAAGG - Intronic
1135101011 16:19605588-19605610 GAAAGAAAACAGCAAGTGCAAGG - Intronic
1135121480 16:19769993-19770015 CAGCGAGAAGAGCAAGTGCAAGG + Intronic
1135688094 16:24514504-24514526 CAGTGGAAACAGCACCTTCAGGG + Intergenic
1135987525 16:27194934-27194956 CAGGCAAAACAGCTTGTGCAGGG + Intergenic
1136073170 16:27801088-27801110 CAGAGAGAACAGCAAGTGCAAGG + Intronic
1136079572 16:27842853-27842875 CAGAGGGAACAGCAGGTCCAAGG - Intronic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136239624 16:28936252-28936274 CAGAGGAAACAGTAAGTGCAAGG - Intronic
1136317289 16:29461749-29461771 CAGGGGAACCCTCAGGTGCATGG + Exonic
1136431864 16:30201092-30201114 CAGGGGAACCCTCAGGTGCATGG + Exonic
1136722421 16:32336758-32336780 AAGGGGAAAGGGCAAGGGCAAGG + Intergenic
1136840735 16:33542730-33542752 AAGGGGAAAGGGCAAGGGCAAGG + Intergenic
1137068958 16:35881930-35881952 CAGGGGCAACAGCAGTTGCTAGG - Intergenic
1137398864 16:48136771-48136793 CAAAGGAAACAGCAATTGCAAGG + Intronic
1137697937 16:50474874-50474896 CAGGCAAAAGAGCATGTGCAGGG - Intergenic
1137918173 16:52455741-52455763 CAGAGGGAACAGCATGTGCAAGG + Intronic
1137963728 16:52910887-52910909 CAGGGGAAATGGGAAGTCCATGG + Intergenic
1138240023 16:55419895-55419917 CACCAGAAGCAGCAAGTGCAAGG - Intronic
1139254792 16:65530596-65530618 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1139490982 16:67285901-67285923 CAGAGGAAAGAGCAAGTACAAGG + Intronic
1139994933 16:70971642-70971664 AAGGGGAAAAAGCAAATGGATGG + Intronic
1140000217 16:71017385-71017407 CAGGAGAGACAGCAAGTGAGAGG - Intronic
1140798454 16:78462877-78462899 CAAGGGAAACAGTAAGGACAGGG - Intronic
1141077555 16:81021351-81021373 CAGTGGTAGCAGCAAGTGCCAGG - Intronic
1141188977 16:81809651-81809673 CAGAGAAAACAGCAAGTCCCAGG - Intronic
1141520278 16:84574214-84574236 CAGGGGACACAGCAACTTCCCGG + Intronic
1141530256 16:84641406-84641428 TTAGGGAAATAGCAAGTGCACGG - Intergenic
1141570816 16:84932660-84932682 CAGAGGGAAGAGCCAGTGCAGGG + Intergenic
1141656829 16:85421151-85421173 CAAGAGAAACAGGAAGGGCAGGG + Intergenic
1203004010 16_KI270728v1_random:181006-181028 AAGGGGAAAGGGCAAGGGCAAGG - Intergenic
1203135618 16_KI270728v1_random:1717413-1717435 AAGGGGAAAGGGCAAGGGCAAGG - Intergenic
1203150900 16_KI270728v1_random:1843027-1843049 AAGGGGAAAGGGCAAGGGCAAGG + Intergenic
1142848225 17:2692204-2692226 CGAGGGGAACAGCAAGTCCAGGG + Intronic
1142863113 17:2775527-2775549 CAGGGGGAGCAGCAAGTGCAAGG + Intergenic
1142927904 17:3257246-3257268 GAGAGGAAACAGCACCTGCAAGG - Intergenic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143497316 17:7319749-7319771 CAGAGGCAACAGCAAGGTCAAGG - Intronic
1143708143 17:8714810-8714832 CACAGGGAACAGAAAGTGCAAGG + Intergenic
1144028052 17:11296006-11296028 CAATGGGAATAGCAAGTGCAAGG + Intronic
1144419050 17:15079260-15079282 TAGAGGAAACAGGATGTGCAAGG + Intergenic
1144460041 17:15451208-15451230 CAGGCAAGACAGCATGTGCAGGG - Intronic
1144517544 17:15929064-15929086 CAGGAGAAACAGCATCTTCAGGG + Intergenic
1145001226 17:19306140-19306162 CAAGGGAAAAAGCAAGTGCTGGG - Intronic
1146240333 17:31216851-31216873 CAGAGGGAAAAGCAACTGCAAGG - Intronic
1146254843 17:31385791-31385813 CAGAGGGAACAGCATATGCAAGG + Intergenic
1146927000 17:36752095-36752117 TGGGGGACACAGCAAGTGCAGGG + Intergenic
1147392411 17:40118358-40118380 TAGAGGGAACAGCAACTGCAAGG + Intergenic
1147403275 17:40193508-40193530 ATGGGGAACCAGCAAGTGTATGG - Intronic
1147552600 17:41454859-41454881 CAGAGGAAACAGAATGTGCTAGG - Intergenic
1148211558 17:45811675-45811697 CAGAGGCAACTGCAAGTACAAGG - Intronic
1148431164 17:47644891-47644913 AAGGGGAAAGAGCAGATGCAGGG - Intergenic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148774415 17:50087644-50087666 CAGGACAAACAGCAGGTGCCTGG + Intronic
1149620928 17:58044445-58044467 CAAGAGAGACAGCATGTGCAGGG - Intergenic
1152143054 17:78549841-78549863 CAGGGGCCGCAGCAGGTGCAGGG - Intronic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1154100660 18:11470067-11470089 CAGGAGAGACAGCGAGTGAAGGG + Intergenic
1155341611 18:24819352-24819374 CAGTGCAAACAGCCCGTGCAGGG + Intergenic
1155753170 18:29454940-29454962 CAGGTGAGAGAGCATGTGCAGGG + Intergenic
1155870838 18:31026184-31026206 CAGAGAAAATAGGAAGTGCAAGG + Intronic
1156295439 18:35785288-35785310 CAGAGGGAACAGTCAGTGCAAGG - Intergenic
1156354295 18:36328363-36328385 TGGGGGGAACAGCAAGTGCAAGG + Intronic
1156902818 18:42321247-42321269 CAGCGGATCCATCAAGTGCAGGG - Intergenic
1157644444 18:49252737-49252759 CAGAGGAAACAGCCAGTGGAGGG + Intronic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1157756909 18:50226682-50226704 CAGAGGAAAAAGCCAGCGCAAGG - Intergenic
1157764042 18:50284334-50284356 CAAGGGAGTCAGGAAGTGCATGG - Intronic
1157880425 18:51316426-51316448 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1157892075 18:51427408-51427430 GAGGGGAAACAGGGAGGGCATGG - Intergenic
1159109698 18:64042615-64042637 CAGGCAAAACAGCACGTGCAGGG + Intergenic
1159456782 18:68669366-68669388 CAGGGGGACCAGCGAGTGCAAGG + Intergenic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1160685113 19:430987-431009 CAGGGGGAACAGCCATTGCAAGG - Intronic
1161145411 19:2675291-2675313 CAGGAACAGCAGCAAGTGCACGG + Intronic
1161438378 19:4277538-4277560 TGGGGGACACAGCCAGTGCAGGG + Intergenic
1161728613 19:5945276-5945298 CAGGAGAAACATCCCGTGCAGGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162265844 19:9573546-9573568 GAGGGAATGCAGCAAGTGCAAGG + Intronic
1162892927 19:13747193-13747215 TTGGGGGAACAGCAAATGCAGGG - Intronic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1163660602 19:18574876-18574898 CAGGCGCAACACCAGGTGCAGGG - Exonic
1163710436 19:18843351-18843373 CTGAGGGAACAGCAGGTGCAAGG + Intronic
1164464518 19:28476086-28476108 CAAGTGGAACAGCAAGTGCAAGG - Intergenic
1164747961 19:30629814-30629836 CAGGGGAAATGCCAAGGGCAGGG + Intronic
1164770096 19:30801775-30801797 GAGAGGCACCAGCAAGTGCAGGG - Intergenic
1164860675 19:31559933-31559955 CAGAGATAACAGCAAGTGCCAGG - Intergenic
1165454923 19:35904820-35904842 CAGAGGAAACAGCACACGCAGGG - Intronic
1165649284 19:37471341-37471363 CAGAGAGAATAGCAAGTGCAAGG - Intronic
1165783960 19:38450149-38450171 CAGGGGACAGAGCCAGAGCAGGG + Intronic
1165937981 19:39401084-39401106 CAGAGGGAACTGCAAGTGCCAGG + Intergenic
1166057895 19:40304302-40304324 CCTGGGGAACAGCAAGGGCAGGG + Intergenic
1166706579 19:44911329-44911351 CAGGGAAAGCACCAAGTTCAGGG - Intergenic
1166822577 19:45589574-45589596 CAGAGGGAACTGCAGGTGCAAGG - Intronic
1167112035 19:47468260-47468282 AAGGGGGAACAGCAGGTGCCAGG - Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1167839172 19:52099880-52099902 CAGGTGATCCATCAAGTGCAGGG - Intergenic
1167843679 19:52142217-52142239 CAGGTGATCCATCAAGTGCAGGG - Intergenic
1168253461 19:55154537-55154559 CAGAGGGAACAGCACATGCAAGG - Intronic
1168487627 19:56777966-56777988 CAGAGCGAACAGCAAGTGCCAGG - Intronic
1202702625 1_KI270712v1_random:176003-176025 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
925277724 2:2662273-2662295 CAGATGAATCAGGAAGTGCAGGG + Intergenic
925579465 2:5395958-5395980 CAGGTGAAACAGGAACTGCTGGG - Intergenic
925753607 2:7111489-7111511 CAAGGGAGAGAGCATGTGCAGGG - Intergenic
925797912 2:7566802-7566824 CAGAGGGAAGAGCATGTGCAAGG - Intergenic
926287268 2:11499289-11499311 CCTGGGAAACAGCAACAGCAAGG + Intergenic
926692505 2:15747327-15747349 CATGGGGAACAGCATGTGCCAGG + Intergenic
926862329 2:17322145-17322167 CAGGCAAGACAGCATGTGCAGGG - Intergenic
927701914 2:25274501-25274523 CAGAGGAAACAGCACCAGCAAGG - Intronic
928601653 2:32909410-32909432 CAAGGCAAACAGCAAGACCAAGG - Intergenic
928612944 2:33008880-33008902 GTGGGGACACAGCCAGTGCAAGG + Intronic
928823618 2:35392158-35392180 GAGGGGAAACAGAGACTGCAGGG + Intergenic
929241702 2:39660140-39660162 CAGAGTAAACAGCCAGTGCAAGG - Intergenic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929375746 2:41284645-41284667 CAGGGGAAAAAGAAAATGAAAGG - Intergenic
929819933 2:45264829-45264851 AAGGGGACAGAGCAAGTGGAAGG - Intergenic
929979008 2:46661676-46661698 ATGGGTAAACAGCAAGGGCAGGG + Intergenic
930196507 2:48516083-48516105 CAGAGAAAACAGAAAGGGCAAGG - Intergenic
930924525 2:56800632-56800654 CAGAAGAAACAGCAGATGCAAGG + Intergenic
931065164 2:58578121-58578143 GCAGGGAAACAGCAAGTGCAAGG + Intergenic
931079576 2:58753794-58753816 CAGGCAAGAGAGCAAGTGCAGGG - Intergenic
931083630 2:58804285-58804307 CAGGCAAGACAGCATGTGCAAGG + Intergenic
931829653 2:66037655-66037677 CTGGGGAGACAGGAAGTGCCTGG + Intergenic
931979754 2:67681940-67681962 CAGAAAGAACAGCAAGTGCAAGG - Intergenic
932055056 2:68434936-68434958 CAGAGGAAACTGCAAGTGCACGG + Intergenic
932057476 2:68461224-68461246 CAGGGGAAAGAACAATTGCAGGG - Exonic
932089338 2:68791004-68791026 CGAAGGAAACAGCAAGTGCAAGG - Intronic
932481905 2:72046787-72046809 CAGGGAAAACAGAAAGCACAAGG + Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932791592 2:74658240-74658262 CTGGGGAAACAACAAATCCAGGG + Intronic
933826785 2:86168844-86168866 CAGGGGATACAACAAGAGAAAGG + Intronic
934041571 2:88131361-88131383 CAGGGTAGGCAGGAAGTGCAGGG - Intergenic
934157608 2:89218108-89218130 CATGGGAAAGAGAAAGTTCAAGG + Intergenic
934173535 2:89559456-89559478 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934209657 2:89964318-89964340 CATGGGAAAGAGAAAGTTCAAGG - Intergenic
934283849 2:91633809-91633831 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934878464 2:97950497-97950519 CAGGGGGAGAAGCAAGTGTAGGG - Intronic
936248489 2:110848974-110848996 CATGGGAAATAGCAAAAGCAAGG - Intronic
936475372 2:112835055-112835077 AAGGTCAAACAGCAAGTGAATGG + Intronic
937260903 2:120586391-120586413 CAGAGGGAACAGTGAGTGCAAGG - Intergenic
937513805 2:122629538-122629560 CAGAGAAAAGAGCTAGTGCAGGG + Intergenic
937581074 2:123488442-123488464 AAGGAGAAACATCAAGTACATGG + Intergenic
937855924 2:126671992-126672014 CAGAGAGCACAGCAAGTGCAAGG + Intronic
938110249 2:128559610-128559632 CAGAGGAGGCAGCGAGTGCAAGG + Intergenic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
938429367 2:131218729-131218751 CAGGGGGAGCGGCAAGAGCAAGG + Exonic
938560851 2:132470734-132470756 CAGGGGAGACAGGGAGGGCACGG + Intronic
938981212 2:136528983-136529005 GAGGGGAAGAAGCAAGTGCCAGG - Intergenic
939067449 2:137501029-137501051 CAAGGGTAAAAGCAAGTGCATGG + Intronic
939076552 2:137609469-137609491 CAGAGGGAACAGCAAGATCAAGG + Intronic
939134233 2:138274559-138274581 CAGGTGATCCATCAAGTGCAGGG + Intergenic
939286127 2:140132491-140132513 CAAGAGAAACAGAAAGTTCAAGG + Intergenic
939701627 2:145399728-145399750 CAGGGGACAAAGCAAGTGAAGGG + Intergenic
939854851 2:147345867-147345889 CAAGGGAAAGAACAAGTGCAGGG - Intergenic
940201197 2:151152802-151152824 CAGAGGGAACAGCAACTGCAAGG - Intergenic
940392999 2:153154281-153154303 CAGGCAAGACAGCATGTGCAGGG - Intergenic
940631927 2:156250988-156251010 CAGGCAAGACAGCATGTGCAGGG - Intergenic
940983114 2:160024711-160024733 CAAGGGAAACAGCATTGGCAAGG + Intronic
941001692 2:160209006-160209028 CTGTGGGAAGAGCAAGTGCAAGG + Intronic
941629267 2:167866055-167866077 CAAAGGAAACAGCATATGCAAGG - Intergenic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
942671168 2:178377658-178377680 CAGGGTAGATGGCAAGTGCAGGG - Intronic
942749765 2:179274678-179274700 CAGAGGAAACAGCATATGAAAGG + Intergenic
943006409 2:182392270-182392292 CAAGAGAGACAGCATGTGCAGGG + Intronic
943665838 2:190607301-190607323 CAGGGGCAACAGCAAGTGGGTGG + Intergenic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
943998212 2:194798017-194798039 CAGGCAAGACAGCATGTGCAGGG - Intergenic
944384477 2:199149370-199149392 CAGGCAAGACAGCATGTGCAGGG - Intergenic
944448472 2:199816628-199816650 CAGAGGGAATAGCCAGTGCAAGG - Intronic
944917685 2:204377858-204377880 CAGGCAAGACAGCATGTGCAGGG - Intergenic
945392350 2:209279553-209279575 CAGGTGATCCATCAAGTGCAGGG - Intergenic
945468206 2:210196147-210196169 CAGGCAAAACAGCGTGTGCAGGG - Intronic
946217094 2:218192784-218192806 CAAGAGAAACAGCAAGTTTAGGG + Intergenic
946254607 2:218433555-218433577 CAGGGGGCACAGCAAGGACAAGG + Intronic
946324859 2:218980130-218980152 CAGTGCAAACCGCAAGTGCCTGG - Intergenic
946969893 2:225079923-225079945 CAGGGCAAACAGTTTGTGCAAGG - Intergenic
947170486 2:227306174-227306196 ATGGGGCAACAGCAAGAGCAAGG + Intronic
947534876 2:230934161-230934183 GTGGAGAAACAGCCAGTGCAGGG - Intronic
947873581 2:233453424-233453446 CAGGGGGAAGACCAAGTGCCTGG - Intronic
948022552 2:234748001-234748023 CAGGCAAGACAGCATGTGCAGGG + Intergenic
948057421 2:235019021-235019043 CAGAGGGAACAGCTAGTGCAAGG + Intronic
948460887 2:238129404-238129426 CAGAGGGAACAGCCAGTGCAAGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
948868880 2:240788472-240788494 CAGAGGGAACAGCATGTGAAAGG + Intronic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1168812872 20:717660-717682 CTGAGGAAACAGCACGTGCAAGG - Intergenic
1168846636 20:949703-949725 CAGAGGGGATAGCAAGTGCAAGG + Intergenic
1169735486 20:8833294-8833316 CAGGCAAAAGAGCATGTGCAGGG + Intronic
1169816330 20:9660733-9660755 AAGAGTCAACAGCAAGTGCAAGG + Intronic
1169861149 20:10153850-10153872 CAGAGGATATAGCAAGTACAAGG - Intergenic
1169933537 20:10858692-10858714 CAGTGGAAACTGCAAGAGCAGGG + Intergenic
1170443446 20:16401372-16401394 CAGGGGATACTGCAAGTCCCAGG - Intronic
1170989233 20:21286939-21286961 CAGAGGAAACAGCCACTGCCAGG - Intergenic
1171136476 20:22699425-22699447 CAGTGGAAACACCAAGTGTGTGG - Intergenic
1171154505 20:22859778-22859800 CAGAAGAAACAGCATGTGCAAGG - Intergenic
1171953691 20:31443005-31443027 TGGGGAAAACAGCAAGTGCAAGG + Intronic
1172293484 20:33792074-33792096 AAGGTCACACAGCAAGTGCATGG - Exonic
1172422497 20:34829079-34829101 CAGGGGGATCAGCATGTGCAAGG - Intergenic
1172623838 20:36336332-36336354 CAGAGGAAACAGCAAGCGCAAGG - Intronic
1173010341 20:39176355-39176377 AGGGGGAACCAGCAGGTGCAAGG - Intergenic
1173248265 20:41350718-41350740 CAGAGGAAACAGTATGTGCCAGG + Intronic
1173282893 20:41645149-41645171 CAGGCAAAAGAGCACGTGCAGGG - Intergenic
1173646880 20:44638921-44638943 CAGAAGGAACAGCATGTGCAAGG + Intronic
1173853732 20:46236083-46236105 CAGAGAGAACAGCAAATGCAAGG - Intronic
1173870517 20:46339117-46339139 CAGAGGGAACAGCAAGTCTAAGG + Intergenic
1173923873 20:46766034-46766056 CAAGGGGAACAGCAAATGAAGGG - Intergenic
1173943976 20:46935312-46935334 CAGGTCACACAGCCAGTGCATGG - Intronic
1174050481 20:47764071-47764093 CAGAGGGAGCAGCAAGTTCAAGG - Intronic
1174109236 20:48186521-48186543 CAGAGGGAACAGCCAGTACAGGG - Intergenic
1174251872 20:49225982-49226004 CAGAGGGAACAGAAAGTGCAAGG - Intronic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1174343088 20:49910151-49910173 CAGGGGAGACAACACGCGCAGGG + Intronic
1174438339 20:50528075-50528097 CAGAGGAAACAGCATATGCAAGG - Intronic
1174498250 20:50965032-50965054 CAAGGGGAACAGCAAGTGCAAGG + Intergenic
1174978564 20:55363716-55363738 CAGGAGAAACAGAAACTGCCAGG + Intergenic
1175051655 20:56161135-56161157 CAGAGGAAAGAGCAAGTGCAAGG - Intergenic
1175191432 20:57214585-57214607 CAGCGGAAACAGCATGTGTGAGG - Intronic
1175730048 20:61348257-61348279 CAGGCAAAAGAGCATGTGCAGGG + Intronic
1175789493 20:61732518-61732540 CAGAGGGAACAGACAGTGCAAGG - Intronic
1175838435 20:62011522-62011544 CAGGGAAAACACCAAGGGCGGGG + Intronic
1175873405 20:62218853-62218875 CAGGGGACACAGATAGTGCTGGG - Intronic
1176193540 20:63825546-63825568 TTGGAGGAACAGCAAGTGCAGGG - Intronic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176715628 21:10346918-10346940 CAGAAGAAACAGCAGGTACAAGG - Intergenic
1179021065 21:37641615-37641637 CAGAGGGAACAGCATTTGCAGGG + Intronic
1179255813 21:39714326-39714348 CAAGGGAAACAGTAGATGCAAGG - Intergenic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179766100 21:43574251-43574273 CAGAGGAGTCAGCCAGTGCATGG - Intronic
1180602719 22:17033035-17033057 CAGAAGAAACAGCAGGTACAAGG + Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1182051339 22:27315104-27315126 CAGAGGGAACAACAGGTGCAAGG + Intergenic
1182086244 22:27563216-27563238 CAGGGGGAATAGCAAATGCAAGG + Intergenic
1182353605 22:29712330-29712352 CAGAGCACACAGCAAGTGCAAGG + Intergenic
1182620699 22:31616928-31616950 CAGGGTAAATAGCAAGTCCCAGG - Intronic
1183243815 22:36678310-36678332 AAGGGGAGACAGCAAGTCAATGG + Intronic
1183252875 22:36742838-36742860 CAGGGGGAACAGCCTGGGCAAGG + Intergenic
1183281404 22:36934638-36934660 CAGTGCACGCAGCAAGTGCAGGG - Intronic
1183517424 22:38274891-38274913 CAGAGGGAACAGCTAGTGCAGGG - Intergenic
1184011884 22:41755025-41755047 CAGGAGGAACAGCAGCTGCAGGG + Intronic
1184040483 22:41940171-41940193 AAGGAGGAACAGCAAGTGCATGG - Intronic
1184610850 22:45602217-45602239 CCGGGGACAAAACAAGTGCAGGG + Intergenic
1184763180 22:46557173-46557195 CAGAGGGAACAGCACGTGCAAGG + Intergenic
1184774706 22:46617394-46617416 CAGGGGAACCTGCAAGCACAGGG - Intronic
1184871027 22:47238618-47238640 CAGGGGAAGCAGAAAGTCCCTGG - Intergenic
1184897657 22:47421049-47421071 CAGGGGAAGCAGCCAGGGAATGG - Intergenic
1185149870 22:49158173-49158195 CAGGGGCCACAGCAAATGCCTGG + Intergenic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
949320898 3:2809340-2809362 CAAGGGGAACAGCAAGGACATGG + Intronic
949856247 3:8463979-8464001 CAGGTACAACAGCATGTGCAAGG - Intergenic
949944194 3:9177366-9177388 CAGAGGGAGCAGCAAGTTCAAGG + Intronic
950245536 3:11413836-11413858 CAGTGGAACCATCAGGTGCAGGG + Intronic
950339428 3:12229565-12229587 CAGGGGAGAAAAAAAGTGCAAGG + Intergenic
950423198 3:12910637-12910659 CAGGGCATACAGGGAGTGCAGGG + Intronic
950467065 3:13161949-13161971 GTGGGGGAACAGCATGTGCAGGG - Intergenic
950526957 3:13529795-13529817 CAGGAGAAAGAGTGAGTGCAAGG + Intergenic
950577563 3:13841967-13841989 CAGAGGGAACAGTAAGTGCAAGG + Intronic
950681134 3:14585858-14585880 CAGAGGGGACAGCAGGTGCAAGG + Intergenic
950762339 3:15243151-15243173 CAGAGGGAACAGCAAGTACAAGG + Intronic
950825054 3:15809929-15809951 CAGAGGAAACAGCATCTGCAAGG - Intronic
951183285 3:19683328-19683350 CAGGCAAGACAGCATGTGCAGGG + Intergenic
951942234 3:28092139-28092161 CAGAGGAAAAAACATGTGCATGG + Intergenic
951944339 3:28117750-28117772 CTGAGGGAACAGCAAGTGAAAGG - Intergenic
953449987 3:42997854-42997876 CAGGGAAGGCAGCCAGTGCAGGG + Intronic
953591945 3:44266052-44266074 AAGGTCAAACAGGAAGTGCAAGG - Intronic
954383028 3:50229660-50229682 CAGAGGCAGCAGCAAGTGCAAGG - Intronic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
955040230 3:55309554-55309576 CAGAGGCAACAGCAAGTGCCAGG + Intergenic
955306371 3:57837119-57837141 CATAGGAAAAAGCATGTGCAAGG - Intronic
955317030 3:57947779-57947801 CAGTGGGAACAGCATGTGCAAGG + Intergenic
955413120 3:58668589-58668611 CTTGGGGAACAGCAACTGCAGGG - Intergenic
955796220 3:62639892-62639914 AAGAGGAAACAGCAAGTGCAAGG - Intronic
955874121 3:63472324-63472346 GAGGTTAAACAGCAAGTCCAAGG - Intronic
955964082 3:64370146-64370168 CAAGAGAGTCAGCAAGTGCAAGG + Intronic
956262682 3:67362257-67362279 GAGGGAGAACAGCATGTGCAAGG - Intronic
956287779 3:67628685-67628707 CAGGCAAGACAGCATGTGCAGGG - Intronic
956379696 3:68652752-68652774 CAGAGGGAAGAGTAAGTGCAAGG + Intergenic
956569050 3:70673475-70673497 CAGGCAAGACAGCATGTGCAGGG + Intergenic
956961167 3:74402890-74402912 CAGAGGGAACAGCTAATGCAAGG + Intronic
956964900 3:74447539-74447561 GAAGGGAAAGAGCAATTGCATGG + Intronic
957361837 3:79170062-79170084 CAAAGGAAACAATAAGTGCAAGG + Intronic
957382945 3:79457702-79457724 CAGGTGAAAGAGCATGTGCAGGG - Intronic
958056842 3:88423675-88423697 GAGAGGAAACAACGAGTGCAAGG - Intergenic
958736545 3:98016031-98016053 CAGGAGAGAGAGCATGTGCAGGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961270627 3:125685042-125685064 CAGGCAGCACAGCAAGTGCAAGG + Intergenic
961465699 3:127079826-127079848 ACGGAGAAACAGCAAGTGCAAGG - Intergenic
961530006 3:127534828-127534850 CAGGAGAAAAAGCAAGTGGCAGG - Intergenic
961534292 3:127560197-127560219 CTGGGGACACAGGAAGTGCAGGG - Intergenic
961534305 3:127560264-127560286 CAGAGGAAATAGTAAGTACAAGG - Intergenic
961534309 3:127560300-127560322 CAGAGGTAACAGGAAGTGTAGGG - Intergenic
961534325 3:127560422-127560444 AGGGGCAAATAGCAAGTGCAAGG - Intergenic
961534374 3:127560679-127560701 CAGTGGGAACAGGAAGGGCAAGG - Intergenic
961630459 3:128294756-128294778 CAGAGGAAACAGCATATGCAAGG + Intronic
961656283 3:128443927-128443949 CAGAGGGAACAGCATGTGCAAGG + Intergenic
961668501 3:128509204-128509226 CATGGGAAGAAGCATGTGCATGG - Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962206865 3:133441941-133441963 CAGGGGAGTCGGCAAGTGCTAGG + Intronic
962314520 3:134350880-134350902 CAGGGGCAGCAGCAAGGGAAGGG - Intergenic
962710547 3:138082091-138082113 CATGGAAAACAGCCAGGGCAAGG + Intronic
962991830 3:140584503-140584525 GAGGGGAAAAAGAAAGGGCATGG + Intergenic
963237788 3:142972569-142972591 AGAGAGAAACAGCAAGTGCAAGG - Intronic
963504368 3:146165027-146165049 CAGAAGAAACAGGAAGTGCAAGG + Intergenic
963507556 3:146206342-146206364 AAGGGGAAACAGCAAGTACAAGG - Intronic
964000794 3:151769665-151769687 CAGGAGAGAGAGCAAGTGAAGGG - Intergenic
964420407 3:156496415-156496437 CAGGCAAAAGAGCATGTGCAGGG - Intronic
964735294 3:159911249-159911271 CAGGGGCAACAGCCACTCCAAGG - Intergenic
964816836 3:160726895-160726917 CAGAGGGAATAGCAGGTGCAAGG - Intergenic
964903599 3:161691492-161691514 CTAGGGAAACAGCAAAAGCAAGG - Intergenic
965647169 3:170896536-170896558 CAGGAGATACAGCAAGTGAGGGG - Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967279825 3:187811130-187811152 CAGTGGAAATAGCAAGGCCAAGG + Intergenic
967300521 3:188008113-188008135 CAAATGAAACAGCAAATGCAAGG + Intergenic
967546799 3:190739478-190739500 TAGGGGACACATGAAGTGCAGGG + Intergenic
968406278 4:342084-342106 CAGGGGAAACAGAAAGGAAATGG + Intronic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
969293147 4:6253242-6253264 CAGAGGGAACAGCAAGTGTAAGG + Intergenic
969683382 4:8655739-8655761 CTGGTGATACAGCAAATGCAGGG + Intergenic
969827395 4:9768272-9768294 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
969835109 4:9834095-9834117 CTAGAAAAACAGCAAGTGCAAGG - Intronic
970155907 4:13141635-13141657 CAGGTAAGACAGCATGTGCAGGG + Intergenic
970430371 4:15983561-15983583 CAGAAGAAACGGCATGTGCATGG + Intronic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
971313859 4:25550527-25550549 TAGAGGGAACAGCAAGTGCAAGG + Intergenic
971341565 4:25774182-25774204 CAGAGGAAAAAGCCAGCGCAAGG + Intronic
971470558 4:27021439-27021461 CAGAGGGAACAGCAAATGCAGGG + Intronic
972295381 4:37732774-37732796 TAGGGGAAACAGGATGTGTATGG + Intergenic
972644593 4:40955277-40955299 AAGAGGGAACAGCAAGGGCAAGG + Intronic
973010429 4:45065957-45065979 CAGGTGAAGCAGAAAATGCAAGG + Intergenic
973633082 4:52837891-52837913 CCTGGGAAACAGCCAGGGCATGG - Intergenic
973840421 4:54855244-54855266 CATGGGAAACAGGAAGTCAAAGG + Intergenic
973922654 4:55704557-55704579 CAGGGCAAACAGCAAGGACAAGG + Intergenic
974018592 4:56673046-56673068 CATGGGAAACAGAAAGGGAAAGG - Intronic
974855144 4:67452426-67452448 CAGGAGAAAGAGAAAGTGAAGGG - Intergenic
974925305 4:68291450-68291472 CAGGCAAAACAGCATGTGCAGGG + Intergenic
975788574 4:77922289-77922311 CAGAAGAAACAGCAAATGCAAGG + Intronic
975862430 4:78691670-78691692 CAGGAGGAACAGCCAGTGCTTGG - Intergenic
975917506 4:79342114-79342136 CAGGCAAGACAGCAAATGCAGGG + Intergenic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
976114496 4:81712512-81712534 CAGAGGAAAGAGCAAGCTCAAGG + Intronic
976258045 4:83119265-83119287 CAGAGGAAACCAGAAGTGCAAGG - Intronic
977475292 4:97499786-97499808 CAGCAGAAACAGCTAGTGCAAGG + Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978746335 4:112198526-112198548 AAGAGGCAACAGAAAGTGCATGG - Intergenic
979125893 4:116970996-116971018 CAGGCAAAAGAGCATGTGCAGGG + Intergenic
979449614 4:120854865-120854887 CAGAGGGTACAGCAAGTGAAAGG + Intronic
980248765 4:130285006-130285028 CAGAGGGAATAGCCAGTGCATGG + Intergenic
980913533 4:139014577-139014599 CAGGGGAATCAGCAAAATCATGG + Intergenic
980933044 4:139199618-139199640 AAGAGGAAACATCAAGGGCAAGG - Intergenic
981497712 4:145412260-145412282 CAGAAGAAACAGCTAGTGCAAGG - Intergenic
981750671 4:148090341-148090363 TTGGGGGACCAGCAAGTGCAGGG + Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982500902 4:156153376-156153398 CAGTGGATCCATCAAGTGCAGGG + Intergenic
984318452 4:178160530-178160552 CAGGCAAGACAGCATGTGCAGGG + Intergenic
985329993 4:188821521-188821543 CAGAGGGAAGAGCAAGAGCACGG + Intergenic
985508146 5:296507-296529 CAGTGGAGTCAGCCAGTGCAAGG + Intronic
985842780 5:2321149-2321171 CAGGCAAAAGAGCATGTGCAGGG - Intergenic
985843017 5:2323584-2323606 CAGGGGAGACAGGGAGTGAAAGG + Intergenic
985958397 5:3281591-3281613 CCGTGGAAGCAGCGAGTGCAGGG + Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986308856 5:6536334-6536356 CAGGGAAAACAGCAGGTCCAGGG - Intergenic
986367191 5:7044202-7044224 CAAGGGAAAGAGCAATTGCAGGG - Intergenic
986693114 5:10330391-10330413 CAGGGAGAACAGCTAATGCAAGG - Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
986813166 5:11381527-11381549 CAGGAGGAACAGCAAGTTCAAGG - Intronic
987251275 5:16103742-16103764 GAGGGGAAACAGAAACTGCCAGG - Intronic
987781049 5:22435773-22435795 CAGGTGATCCATCAAGTGCAGGG - Intronic
988510385 5:31859606-31859628 CAGAGGAAACAAAGAGTGCAGGG - Intronic
988776310 5:34480793-34480815 CAGCTGATACATCAAGTGCAGGG - Intergenic
989558804 5:42827746-42827768 CAGATGAAAGAGCACGTGCAAGG + Intronic
989782852 5:45290128-45290150 CAGGCAAGACAGCATGTGCAGGG - Intronic
990742532 5:58926708-58926730 CAGGGGAAAGAGGAAGGGCAGGG + Intergenic
991000264 5:61775701-61775723 AACTGGAAATAGCAAGTGCAGGG - Intergenic
991406477 5:66305397-66305419 CAGAGGGAACAGCATGTGCAAGG + Intergenic
992881501 5:81114735-81114757 CAGAGGAAAGAACAAGTGCAAGG - Intronic
993085597 5:83359525-83359547 CAGGGGAAGTAGCCAGTGCCTGG + Intergenic
993176648 5:84494879-84494901 CAGGAGAGAGAGCAAGAGCAAGG + Intergenic
993200933 5:84813800-84813822 CAGGAAAGACAGCATGTGCAGGG - Intergenic
993307403 5:86289767-86289789 CAGGGCCTACAGCAGGTGCAAGG - Intergenic
993390837 5:87318547-87318569 CAGGAGAAACAGCATGTGAAGGG + Intronic
993539949 5:89136852-89136874 TAGAGAAAACAGCAAGTCCATGG - Intergenic
993704026 5:91149415-91149437 CAGGAGAAACAATGAGTGCAAGG - Intronic
994315318 5:98326386-98326408 CAGGCAAGACAGCATGTGCAGGG + Intergenic
995060426 5:107807146-107807168 CAGAGGAAACAGCTAGAACAAGG + Intergenic
995391664 5:111646651-111646673 CAGAGGAAAAAGCAACGGCAAGG + Intergenic
995502724 5:112825492-112825514 CAAAGGAAACAGCATGTGAAAGG - Intronic
995511856 5:112918510-112918532 GAGAGGAAACAGCAAGAGAAAGG + Intronic
995932490 5:117464631-117464653 CAGAGAAAACCACAAGTGCATGG - Intergenic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
996037193 5:118771586-118771608 CAAGAAAAACAGCATGTGCAGGG + Intergenic
996471564 5:123867239-123867261 CAGAGGAAACAGTATGTGCCAGG + Intergenic
996724241 5:126660008-126660030 GAGGGGAAAGAGGAAGTGTATGG - Intergenic
997022239 5:130015168-130015190 CAGGAGAGACAGAAAGTGAAGGG - Intronic
997591294 5:135074217-135074239 CAGGGGAGACACCAAGTGAGGGG - Intronic
997999878 5:138616564-138616586 CCTGGGAAACAGCAAATGCAGGG - Intronic
999430683 5:151522742-151522764 CAGAGGGAGCAGCAAGTGTAAGG + Intronic
999490590 5:152046585-152046607 CTGAGGAAACAGCCAGGGCAAGG - Intergenic
999681004 5:154060016-154060038 CAGAGGAAAGAGCAATGGCAAGG + Intronic
999862921 5:155667818-155667840 CACAAGGAACAGCAAGTGCAAGG - Intergenic
1000262212 5:159598770-159598792 AAAGGGAAACAGTAAGTGCAAGG - Intergenic
1000766798 5:165301634-165301656 CAGGCAAAAGAGCATGTGCAGGG - Intergenic
1001379250 5:171292599-171292621 CAGGGGAAACGGCAATTACGTGG - Intronic
1001536970 5:172504870-172504892 GAGGAGAAACAGAAAATGCAGGG + Intergenic
1001847802 5:174937286-174937308 CATGGCAAACAGCAGGTGCTGGG + Intergenic
1002190664 5:177475815-177475837 CAGGGGCAACAGCAGCTGAAAGG - Intergenic
1003146098 6:3511860-3511882 AAGGGGAACCAGCGTGTGCAGGG - Intergenic
1003267947 6:4583052-4583074 CAGTGGATCCATCAAGTGCAGGG - Intergenic
1003797687 6:9623377-9623399 AAGAGGAAACAGCGAGTACATGG + Intronic
1003913040 6:10760047-10760069 CAGGTGATCCATCAAGTGCAGGG - Intronic
1004761490 6:18671552-18671574 CAGAGGAAAAATCAAGGGCAAGG - Intergenic
1005481212 6:26257280-26257302 GAGGGTAAGGAGCAAGTGCAAGG + Intergenic
1006304997 6:33213514-33213536 CAGAGGAAACAGGAAGTGAGGGG - Intergenic
1006483317 6:34316682-34316704 CAGAGGGAACAGCAATTACAAGG + Intronic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1006878361 6:37317831-37317853 CAGAGGAAACAGCCAGTGCAGGG + Intronic
1007172454 6:39873363-39873385 CGAGGGAAGCAGCAAGTGCAGGG - Intronic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007679425 6:43624259-43624281 CAAGGGAAACAGCAAATGCCTGG + Intronic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1009769011 6:68121134-68121156 CAGGGAAGAGAGCATGTGCAGGG + Intergenic
1010389206 6:75318036-75318058 CAGAGGACACAGCATTTGCAAGG - Intronic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010802356 6:80191355-80191377 CAGTGGACACAGCTAGTGCTTGG + Intronic
1011859408 6:91736550-91736572 CAGATAAAACAGCAAGAGCATGG + Intergenic
1013299165 6:108786970-108786992 CAGGGCAGGCAGCAAGTCCAGGG + Intergenic
1013745891 6:113345469-113345491 CAGGGAAAACACAAAGGGCATGG + Intergenic
1013746415 6:113351709-113351731 AAGGAGGAACAGCAAATGCAGGG - Intergenic
1014832741 6:126122101-126122123 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1015294687 6:131577020-131577042 CCGGGGGAACAGCAAATGGAAGG + Intronic
1015741295 6:136456928-136456950 CAGGGTATAAAGCTAGTGCAAGG + Intronic
1015820182 6:137252592-137252614 CAGGGGAAACATCAAGGACAAGG - Intergenic
1015879918 6:137861797-137861819 TAGAGAAAACAGTAAGTGCAGGG + Intergenic
1018050330 6:160003954-160003976 CTGGGGGAACAGCCAGTTCAGGG + Intronic
1018116667 6:160592941-160592963 CTGGGGAAAGAACAACTGCAAGG - Intronic
1018147581 6:160906925-160906947 CTGGGGAAACAACAACTGCAGGG + Intergenic
1018554038 6:165032647-165032669 CTGGGGAAACATCAGGGGCAAGG - Intergenic
1018764714 6:166924559-166924581 AAAGGGAGACAGCAACTGCAGGG - Intronic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019372197 7:668345-668367 CAGGGGAGACATCACGTGAAAGG + Intronic
1019457324 7:1137207-1137229 TCGAGGAAACAGCAGGTGCAGGG - Intronic
1019640891 7:2103115-2103137 CAGAGGCAGCAGCAAGCGCAGGG - Intronic
1020763968 7:12298518-12298540 CAGGTGATCCATCAAGTGCAGGG - Intergenic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1021210244 7:17841906-17841928 CAGAGGAATCAGCAAATGTAAGG + Intronic
1021280430 7:18710095-18710117 CAGGCAAAAGAGCATGTGCAGGG + Intronic
1021759106 7:23886032-23886054 CAGGAGGAACAGCAAGTGGAAGG + Intergenic
1021901653 7:25291420-25291442 CAGGCACAACAGCATGTGCAGGG - Intergenic
1022029470 7:26479173-26479195 CAGAACAAACAGCAAGTGCAAGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022130982 7:27404315-27404337 CAGCGAATACAGTAAGTGCAGGG + Intergenic
1022208314 7:28183819-28183841 CACAGGACACAGGAAGTGCACGG - Intergenic
1023103783 7:36744843-36744865 CAGGTTAAACTGCAAGTGCATGG - Intergenic
1023557432 7:41437828-41437850 CAGGGGAGACAGCAAGATCCAGG - Intergenic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1024989994 7:55225871-55225893 CAGGAAGAACAGCTAGTGCATGG - Intronic
1026592413 7:71708333-71708355 CAGGGAAGAGAGCATGTGCAGGG + Intronic
1026683591 7:72489209-72489231 CAGGGGAAACAGGCAGAACAAGG + Intergenic
1027470606 7:78568961-78568983 TAGGGCAAACAGCAAGTGAAAGG - Intronic
1027729164 7:81847930-81847952 CAGAGGACACTGCATGTGCAAGG + Intergenic
1028278721 7:88893783-88893805 CAGAGGAAACAGTAATTACATGG + Intronic
1029049592 7:97670564-97670586 CAGAGAAGACAGCAGGTGCAAGG - Intergenic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1029409437 7:100399377-100399399 TTGGGGAAACAGGAAGTGCCAGG - Intronic
1029633558 7:101768615-101768637 CAGAGGGAACAGCAGGTACAAGG - Intergenic
1030856408 7:114563035-114563057 CAGGGAAGAGAGCATGTGCAGGG + Intronic
1032977367 7:137241078-137241100 CAGGAGAGACAGCGAGAGCAAGG + Intronic
1033192370 7:139293353-139293375 CAAGGGAAACTGGAAGGGCATGG - Exonic
1033340211 7:140486112-140486134 CAGGTGATCCATCAAGTGCAGGG + Intergenic
1033921542 7:146398960-146398982 CAGAGGAAAGAGAAAGTTCAAGG - Intronic
1034526784 7:151669136-151669158 CTGGGGAAAGAGTGAGTGCAGGG - Intronic
1035922719 8:3694784-3694806 CAGAAGTAACAGAAAGTGCAGGG + Intronic
1036616080 8:10388836-10388858 CAGGGGAAGCAGCAAGCTAATGG - Intronic
1037432934 8:18832774-18832796 CAGGCAAAAGAGCAGGTGCAGGG + Intronic
1037984725 8:23282703-23282725 CAGGCAAGACAGCAAGTGCAGGG - Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1038240807 8:25806603-25806625 CAGGAGAGAGAGCACGTGCAGGG - Intergenic
1038255481 8:25947279-25947301 CAGGGAAGAAAGCATGTGCAGGG - Intronic
1038958699 8:32495310-32495332 CAGGCAAGACAGCATGTGCAGGG - Intronic
1039016138 8:33151063-33151085 AAGGGCAAACAGCTAGTGAATGG - Intergenic
1039122817 8:34167922-34167944 AGGGAGAAAGAGCAAGTGCAAGG - Intergenic
1039479779 8:37863924-37863946 CAGCTGTGACAGCAAGTGCAGGG + Intronic
1040618244 8:49061591-49061613 CTGGGGAAACAGCAATTAGAGGG + Intronic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1040957142 8:52990964-52990986 AAGAGGAAACAGGAAGTGCAAGG + Intergenic
1041007679 8:53511045-53511067 TAGGGGAAGCAGCAGGTCCATGG + Intergenic
1041278823 8:56190935-56190957 CAGAGGAAATAGCACGTGCAAGG + Intronic
1041968770 8:63712533-63712555 CAGGCAAAAGAGCATGTGCATGG - Intergenic
1042022134 8:64379284-64379306 AAGGGGAAAAAGCAATTGCAGGG + Intergenic
1042056835 8:64772880-64772902 CAGAGGGTACAGCCAGTGCAAGG - Intronic
1042372609 8:68008783-68008805 CAGGCAAGACAGCATGTGCAGGG - Intronic
1042505783 8:69558344-69558366 CAGTTGAAACAGCAGGGGCAGGG - Intronic
1042770265 8:72372895-72372917 CAGAAGAAACAGCATTTGCAAGG - Intergenic
1043368765 8:79566161-79566183 CAGTGGAAAGAACAAGAGCAAGG - Intergenic
1044152548 8:88799783-88799805 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1044836276 8:96298524-96298546 AAGGGGAAACAGTAAGATCAAGG - Intronic
1045368394 8:101496817-101496839 CAGGTGGAAGAGCAAGTGCCAGG + Intronic
1045820087 8:106326683-106326705 CAGAGGGACCAGCCAGTGCAAGG + Intronic
1045871425 8:106931945-106931967 CAGGAGAGAGAGCATGTGCAGGG + Intergenic
1046146707 8:110170847-110170869 CAGGCAAAAGAGCATGTGCAGGG - Intergenic
1046541692 8:115591710-115591732 CAAAGGAAACAGAAAGTGCAGGG + Intronic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1047717272 8:127607074-127607096 CAGAGGAAACAGTAAATGCAAGG + Intergenic
1047811517 8:128414905-128414927 CAGGGGAAGGAGAAAGTGAAGGG + Intergenic
1048210595 8:132451193-132451215 CAGGCAAGACAGCATGTGCAGGG - Intronic
1048555999 8:135476558-135476580 CAGAGGGAAAAGCAAGTGCAAGG - Intronic
1049433039 8:142574095-142574117 CATGGGAAACACCAAGAGCACGG - Intergenic
1049889443 9:54919-54941 CAGAGGAAAAAGAAAATGCAAGG - Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051556090 9:18384250-18384272 CAGGAGAGACAGCGAGTGAAGGG + Intergenic
1052371003 9:27664325-27664347 CAGAGCAATCAGCAAGTGCGAGG - Intergenic
1053345280 9:37373536-37373558 CAGGAGGAGCAGCACGTGCAAGG + Intergenic
1053730928 9:41056189-41056211 CAGAGGAAAAAGAAAATGCAAGG - Intergenic
1054697584 9:68375901-68375923 CAGAGGAAAAAGAAAATGCAAGG + Intronic
1055908174 9:81317471-81317493 CAGAGGCAATGGCAAGTGCAGGG - Intergenic
1055993836 9:82135977-82135999 CAGGGAAGAGAGCATGTGCAGGG + Intergenic
1056132759 9:83601931-83601953 CAGAGAGAGCAGCAAGTGCAAGG + Intergenic
1056592134 9:87972341-87972363 CAGGAAGAAAAGCAAGTGCAAGG + Intronic
1056641230 9:88372587-88372609 CAGCTGACACATCAAGTGCAGGG + Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1058553267 9:106138565-106138587 AAAGGGAAACAGCAAATTCAGGG + Intergenic
1058726882 9:107813058-107813080 CAAGAGAGACAGCATGTGCAGGG + Intergenic
1058730220 9:107842686-107842708 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1058983502 9:110191431-110191453 CAGGCAAGACAGCAAGTGGAGGG - Intronic
1059570286 9:115426949-115426971 CAGGGAAGAGAGCATGTGCAAGG - Intergenic
1059681941 9:116594214-116594236 AAGGGGAAAAAGCCAGTACAGGG - Intronic
1059989885 9:119854979-119855001 CAGGCAAGAGAGCAAGTGCAGGG + Intergenic
1060802496 9:126553652-126553674 CAGTGGACACAGCCACTGCAAGG - Intergenic
1060853181 9:126894499-126894521 CAGAGGGAACAGCACGTGCAAGG + Intergenic
1061194597 9:129100838-129100860 CAGGGCATTCACCAAGTGCAGGG + Intronic
1061519121 9:131107191-131107213 CAGGGTGCACAGCTAGTGCAGGG + Intronic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1062205730 9:135335849-135335871 CAGGGGCCAGAGCAGGTGCAGGG + Intergenic
1062233373 9:135495777-135495799 CAGTGTTAACAGCAAGTGCCAGG - Intronic
1062342126 9:136098410-136098432 CAGTGGGAACAGCGGGTGCAAGG - Intergenic
1062419615 9:136473729-136473751 CAGGGGTGACAGCAAATGGAGGG + Intronic
1062675353 9:137740037-137740059 GAGGGAAAAAAGCAAGTGCACGG - Intronic
1203768200 EBV:37277-37299 CAGGGGCAAGGGCAAGTCCAGGG + Intergenic
1185820126 X:3194897-3194919 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1185954321 X:4472740-4472762 CAGAGGAAACTGCAGGTGCTGGG - Intergenic
1186404207 X:9287466-9287488 CAGTAGGAACAGCAAGAGCAAGG - Intergenic
1186763896 X:12750973-12750995 CAGGTGAAACAGCTAGGACATGG + Intergenic
1186780115 X:12903764-12903786 CTGGGAAAACACCAAGTGCCTGG - Intergenic
1187087991 X:16061751-16061773 CAGGGGGAACAGCAGGTACCAGG - Intergenic
1188264078 X:28048906-28048928 CAGTGGTAACTGAAAGTGCATGG - Intergenic
1188329191 X:28847643-28847665 CAAAAGGAACAGCAAGTGCAAGG - Intronic
1188962008 X:36503393-36503415 CAAGAGAGACAGCATGTGCAGGG + Intergenic
1188999752 X:36931217-36931239 CAGCTGATACATCAAGTGCAAGG + Intergenic
1189085946 X:38024300-38024322 CAGGCAAAAGAGCGAGTGCAGGG - Intronic
1189301842 X:39957966-39957988 ACGGGGGAACAGCCAGTGCAAGG + Intergenic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1190477485 X:50842302-50842324 CAGCGCAAACAGCCAGGGCATGG + Intergenic
1192232561 X:69276019-69276041 CAGAGGAAACAGCCAGTTCAAGG + Intergenic
1192268777 X:69558947-69558969 CCGAGGAAACAGCATGTGCAAGG + Intergenic
1192285272 X:69728451-69728473 CAGAGGAAACAATATGTGCAAGG + Intronic
1192291931 X:69806776-69806798 CAGAGGAAATGGCATGTGCAAGG + Intronic
1192508314 X:71704807-71704829 CAGGGAAGACAGCATGTGCAGGG - Intergenic
1192518382 X:71776746-71776768 CAGGGAAGACAGCATGTGCAGGG + Intergenic
1192527037 X:71855926-71855948 CAGGGAAGACAGCATGTGCACGG - Intergenic
1192781944 X:74303570-74303592 CAGGGGACAGAGCAAGATCATGG + Intergenic
1193530073 X:82645620-82645642 CAGGTGATCCATCAAGTGCAGGG - Intergenic
1195525450 X:105883945-105883967 CAGGGGAAGCAGAAAGTTTAAGG + Intronic
1195526043 X:105890634-105890656 CAGGCAAGACAGCATGTGCAAGG + Intronic
1196779891 X:119374461-119374483 CAGAAGAAACTGCATGTGCAAGG + Intergenic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1197392546 X:125884719-125884741 CAGGTGACAGAGCAAGTGAAGGG - Intergenic
1197922934 X:131614687-131614709 CAGAGGGAACAGCAAGTGCTCGG - Intergenic
1198254032 X:134909425-134909447 CAGAGTAAACAGCAAGAGCCAGG - Intronic
1198418842 X:136448651-136448673 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1198972866 X:142301138-142301160 CAGGGGAAACAGTGAAGGCAGGG - Intergenic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1199849715 X:151716750-151716772 CAGAGGAAACAGCAAATGCAAGG - Intronic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200283838 X:154802116-154802138 CAGAGGGAACAGCCTGTGCACGG - Intronic
1200705778 Y:6441298-6441320 CAGGAGCAACAACAAGGGCAAGG + Intergenic
1201028333 Y:9723410-9723432 CAGGAGCAACAACAAGGGCAAGG - Intergenic
1201376612 Y:13329876-13329898 CAGGAGAGACAGGAAATGCACGG - Intronic
1201864766 Y:18637918-18637940 CTGAGGAAACTGCAAGTGCTGGG - Intergenic
1201868556 Y:18682460-18682482 CTGAGGAAACTGCAAGTGCTGGG + Intergenic