ID: 1130334716

View in Genome Browser
Species Human (GRCh38)
Location 15:82949091-82949113
Sequence TGGCAAATGAGTGCATGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130334711_1130334716 19 Left 1130334711 15:82949049-82949071 CCTGCATGTGAGAGGTTGGGAAG 0: 1
1: 0
2: 1
3: 25
4: 200
Right 1130334716 15:82949091-82949113 TGGCAAATGAGTGCATGGTAGGG 0: 1
1: 0
2: 1
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130334716 Original CRISPR TGGCAAATGAGTGCATGGTA GGG Intronic
902277592 1:15350658-15350680 TGGCAGATGAGGGCATGGAGAGG - Intronic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
905881973 1:41469933-41469955 TGGCAGATGAGGGCAGGGGAGGG - Intergenic
905908727 1:41639259-41639281 TGGCAAAGGGGTGGATGGGAGGG + Intronic
906352272 1:45072189-45072211 TGGCAAATGAGTATATGAAAAGG - Intronic
906731687 1:48087290-48087312 TGGCAAATAAGCGCATGAAAAGG - Intergenic
907324176 1:53626109-53626131 TGGCAAACGAGGGCAGGGCATGG + Intronic
908760514 1:67507480-67507502 TGGGCAATGAGTGCATGGAGGGG - Intergenic
909306549 1:74087263-74087285 TGGCAAATGTGTTAATGGAAAGG - Intronic
916609770 1:166379949-166379971 TGGCAAATGGGCCCATGGAAAGG + Intergenic
920768045 1:208852336-208852358 TGGCAATAGGGTGCAGGGTAGGG - Intergenic
921481532 1:215669511-215669533 TGGCTAATCAGATCATGGTATGG - Intronic
924941749 1:248816901-248816923 TGGCAAATTAGTGCAGTGGAAGG + Intronic
1063030350 10:2228361-2228383 TGACAAATCAGTGCAAGGGAGGG + Intergenic
1063383515 10:5601700-5601722 TGGCAAGTGAGGGCCTGGTCAGG - Intergenic
1063933277 10:11050868-11050890 GGGCGAGTGAGTGAATGGTAGGG - Intronic
1064688748 10:17892282-17892304 TGGCAGAGGAGTGCATGGGGAGG - Intronic
1065965179 10:30765077-30765099 TGGCAGATGAGTCCAGGGAAAGG - Intergenic
1066033344 10:31453102-31453124 ATGCAAATGAGTGCATGCTTAGG + Intronic
1070208144 10:74285306-74285328 TGGAAAATGAGTGTGTGGCATGG + Intronic
1070216283 10:74385002-74385024 TTGCAAATGGTTGCATGGTTGGG + Intronic
1072121033 10:92405716-92405738 TGGCATAAGGTTGCATGGTAAGG + Intergenic
1072226266 10:93372829-93372851 TTGCAAATCATTGAATGGTAAGG - Intronic
1072329722 10:94335862-94335884 TGGGTAATGAGTACATTGTAAGG + Intronic
1075903314 10:126060897-126060919 TGACAAATGAGAGAATGGTGTGG + Intronic
1077439966 11:2563529-2563551 GGGGAAATCAGTGCATGGTGCGG - Intronic
1077909559 11:6562385-6562407 AGGCAAATGAATACACGGTATGG + Intronic
1080828796 11:35872066-35872088 TTGCAAAGGAGTGTATTGTATGG + Intergenic
1080952607 11:37052717-37052739 TGGCAAATTAGTGAATGGTGTGG + Intergenic
1081866790 11:46364673-46364695 TAGCAAATCAGTGCAGTGTATGG + Intronic
1084475987 11:69390123-69390145 CAGCGAATGAGTGCATGGCATGG + Intergenic
1087508112 11:99054386-99054408 TGGCCAATGAGTTCAAAGTAAGG - Intronic
1088901607 11:114122067-114122089 TAGCAGATGTGTGCCTGGTATGG + Intronic
1089944253 11:122451501-122451523 TGTCCAATGAGTGCGTGGTGAGG + Intergenic
1090468785 11:126959744-126959766 TGGGTAATGAGTGAAAGGTAGGG - Intronic
1095480489 12:42629928-42629950 TAGCAAATGGGTGCACGGAAAGG - Intergenic
1098127369 12:67312864-67312886 TGTCAATTCAGTGCATTGTATGG - Exonic
1099762084 12:86936820-86936842 TGGCAAATCAGTATATGATAAGG + Intergenic
1100617617 12:96243183-96243205 TGGTAAATGGGTGAATTGTATGG - Intronic
1107048037 13:36014948-36014970 TGGCACATTAGAACATGGTAGGG - Intronic
1108303228 13:49102546-49102568 TGGCAAATGGGAGAATAGTAAGG - Intronic
1108604243 13:52021512-52021534 GGGCAAAGGAGAGCATGGGAAGG + Intronic
1109442242 13:62390489-62390511 TGGCAAATGATTGTTTGCTAAGG - Intergenic
1111411401 13:87881725-87881747 TGGCAAGTAATTGCCTGGTAAGG + Intergenic
1112718159 13:102210851-102210873 GGGCAAAATAGTGCATGGTATGG + Intronic
1112973712 13:105291354-105291376 TGGCCAATGACTGCAGGATATGG - Intergenic
1113181978 13:107639400-107639422 GAGCAAATGCGTGCATGGCATGG - Intronic
1119932502 14:78561975-78561997 TTGCAGAAGAGTGCATGGGATGG - Intronic
1121082718 14:91121265-91121287 TGGCAAAAGAGTGAACTGTATGG + Intronic
1121753941 14:96386664-96386686 TGTAATATGAGTGCATTGTATGG + Exonic
1122032622 14:98924712-98924734 TGATAAATGAGTGAATGGTAGGG - Intergenic
1122379449 14:101291283-101291305 TGAAAAAAGAGTGCATGGTGTGG - Intergenic
1129768088 15:78182699-78182721 TGGCCAATGTGTACACGGTATGG - Exonic
1130196503 15:81784523-81784545 TGGCAGATGAGTGGATGCCAGGG + Intergenic
1130334716 15:82949091-82949113 TGGCAAATGAGTGCATGGTAGGG + Intronic
1130577876 15:85108340-85108362 TTGCAGATGAGTGCATAGCAGGG - Intronic
1134544853 16:15100172-15100194 TTGCAAATGGCTGAATGGTAGGG + Intronic
1135362483 16:21826889-21826911 TTGCAAATGGCTGAATGGTAGGG + Intergenic
1136579717 16:31143842-31143864 TGGCAGATGACTGCATGTCAAGG + Intronic
1139020288 16:62740448-62740470 GGGCAAATGATTCCAAGGTACGG + Intergenic
1139527402 16:67525392-67525414 TGGCAAATGAATGAATGATGTGG + Intronic
1140636920 16:76925908-76925930 TGGCAGATAATTGCATGATATGG + Intergenic
1141064350 16:80901841-80901863 TTTCAAATGAGTGAATTGTATGG - Intergenic
1143777744 17:9210353-9210375 TGCCAACTGTGTGCATGGTAAGG - Intronic
1146543009 17:33713726-33713748 TGGCAAATCAGTGCAGGTTTAGG + Intronic
1147903128 17:43803595-43803617 TGGCACCTGAGTTCCTGGTAGGG - Intronic
1149018178 17:51933029-51933051 TGGCAAATGTGAGCATGCCAGGG + Intronic
1155817004 18:30324803-30324825 TGGGAAATTAGTTCATGGCATGG - Intergenic
1163980882 19:20898932-20898954 TGGCAAATGAGTGGGTGAGAGGG - Intergenic
1165168277 19:33872380-33872402 GGGCAAATGAGTGGATGGATGGG - Intergenic
1165168326 19:33872557-33872579 GGGCAAATGAGTGGATGGATGGG - Intergenic
925778565 2:7358023-7358045 CTGCAAATGAGTGAATTGTATGG - Intergenic
925975904 2:9141951-9141973 TGGGAGATGAGGGCATGGTTAGG - Intergenic
926638573 2:15210348-15210370 TGGCAAATGGGTACATGAAAAGG + Intronic
930451132 2:51539697-51539719 TAGCGAATGACTGCATGGCAAGG + Intergenic
933176773 2:79183056-79183078 TGGGAGATGAGGGCATTGTATGG - Intergenic
933734681 2:85486405-85486427 TGGCAAATGAGTATTTGTTAAGG + Intergenic
934530233 2:95081614-95081636 TGGCAAATAAGTCCATGAAAAGG - Intergenic
934883135 2:98000626-98000648 GGGAAAATGAGTGCAAGGTAAGG - Intergenic
935284704 2:101554003-101554025 TGTAAAATGAGTGCATGTAAAGG + Intergenic
935339419 2:102046344-102046366 TGGGAGATGTGTGCATGGTGTGG - Intergenic
935865466 2:107383146-107383168 TGGAAAAAGACTCCATGGTATGG - Intergenic
936346223 2:111677433-111677455 TGGGACCTGAGTGCCTGGTAAGG - Intergenic
936496591 2:113027639-113027661 TGGCAGCTGAGTGGATGGTGGGG + Intronic
937898193 2:126994833-126994855 TGGCCAATGAGTACATGAAAAGG + Intergenic
938623775 2:133085924-133085946 TGGTAAATCAGTGCATGTTGGGG - Intronic
939511099 2:143105761-143105783 GAGCAAATGAATGGATGGTAAGG - Intronic
939920425 2:148103950-148103972 TGGCATATGTGTGCATGATGAGG + Intronic
941081256 2:161063203-161063225 TGGTAAATGAGTGCAGAGCAAGG - Intergenic
941123031 2:161553669-161553691 TGGAAAAAGAGTGCATGATGGGG + Intronic
945180793 2:207088990-207089012 TGGCAAATGAGTGTAGGTTCTGG - Intronic
948654406 2:239467648-239467670 TGGCATGTGTGTGCATGGTGTGG + Intergenic
1169561046 20:6801475-6801497 TGGAAAATGAATGCATAGTCAGG - Intergenic
1170327967 20:15177072-15177094 GGGCAAGTGAGTGCAGGGTCTGG - Intronic
1181680454 22:24492620-24492642 TGGCAAATCAGTGGGTGGTGAGG + Intergenic
1182062648 22:27408777-27408799 TGGAAATTGTGTGCATGTTACGG + Intergenic
1183392983 22:37556399-37556421 GGGTAAATGGGTGCATGGAAGGG + Intergenic
1184382093 22:44151238-44151260 TGGCATATGTGTGCATGGGTTGG + Intronic
1184440243 22:44507455-44507477 TGGCAAATGAGCCCATGGAAAGG + Intergenic
949459378 3:4273831-4273853 TGGCAAGGGAGGGCATGGGAAGG + Intronic
949584438 3:5424078-5424100 TGGCTACTGAGTGCCTGGTGGGG + Intergenic
949602838 3:5619868-5619890 TGGTAATGGAGGGCATGGTATGG + Intergenic
953037270 3:39223974-39223996 TTGTAAATGAGTGTATTGTATGG + Intergenic
954896814 3:53982199-53982221 TGGGAAGTGAGTGCATGGTAGGG - Intergenic
960172430 3:114477794-114477816 ATGCAAAAGAGTGCAGGGTACGG - Intronic
960419794 3:117429874-117429896 TGGCAGATGTGTGTGTGGTAAGG - Intergenic
960721385 3:120627643-120627665 TGATAAATGAGTGAAGGGTAGGG + Intergenic
962062432 3:131944300-131944322 TGACAAATGACTTCATGGTGTGG + Intronic
962121276 3:132562690-132562712 TGGCAAATCAGTACATTGAAGGG - Intronic
964894050 3:161573346-161573368 TGGGAAATGACTGCTTGGTTTGG + Intergenic
968953779 4:3708022-3708044 TGGCAGATGAGTGCCTGGTGTGG + Intergenic
970426634 4:15952114-15952136 TAGCTAATGACTTCATGGTAAGG + Intergenic
972958271 4:44419370-44419392 AGGCAACTGACTGCATGGCAGGG + Intronic
973783704 4:54315473-54315495 TGGCAAATGAGTGCATTCTGTGG - Intergenic
975748467 4:77497505-77497527 TGGTAACTGAGTGTCTGGTATGG - Intergenic
980011846 4:127604678-127604700 TTGCTAATTAGTGCATGGTGTGG - Intergenic
980222396 4:129935897-129935919 TTAAAAATGAGTGCCTGGTAGGG - Intergenic
980679198 4:136134410-136134432 TGTCAATTAAGTACATGGTAAGG - Intergenic
980820125 4:138004443-138004465 TGGCAAATCTGTTCATAGTATGG - Intergenic
981916146 4:150035449-150035471 TGGCCAATGAGTACATGAAAAGG + Intergenic
986362998 5:7000024-7000046 TAGCAAATGAGTTCAGGGTTTGG - Intergenic
988714459 5:33811369-33811391 TGGCAAGGGAGTGCAGGGGAAGG + Intronic
994083708 5:95735376-95735398 TGGGAAATGAGTGGCTGGGAGGG + Intronic
994902665 5:105795841-105795863 TGGCAAATTGGTGCATTTTATGG - Intergenic
997824773 5:137096667-137096689 TGGCAAATGAGTGCAAACGATGG - Intronic
997991905 5:138551476-138551498 TGGCAAAGGGGTGACTGGTATGG + Intergenic
998323434 5:141255433-141255455 TGGCAAATGTGTGCAAGGGCAGG + Intergenic
999969365 5:156843841-156843863 TGGCAAATGAGTAGATGTGATGG + Intergenic
1004609618 6:17227277-17227299 TGTCAAGTGGGAGCATGGTATGG + Intergenic
1007117437 6:39353337-39353359 TGGCAAATAAGTACATGACAAGG - Intronic
1008077525 6:47160740-47160762 TGGTAAATGTGTGCAAGTTAGGG - Intergenic
1008345229 6:50418554-50418576 TGGGAGATGATTGTATGGTAGGG - Intergenic
1009531326 6:64819926-64819948 TGGCAAATAATAGCATGGAAAGG + Intronic
1011885177 6:92084714-92084736 TGTCAAATGTGTGCATTGTGGGG - Intergenic
1015603079 6:134929476-134929498 TGGCAACTGATTGCATGGGGAGG + Intronic
1017074819 6:150607817-150607839 TGGGAAATGGGTGCATGGATGGG + Intronic
1018057412 6:160064254-160064276 TGTGACAGGAGTGCATGGTATGG + Intronic
1021422357 7:20460137-20460159 TGGCCCATGTGTGCATGGTCTGG + Intergenic
1021773871 7:24032407-24032429 TGTCAAATGAGGGGATTGTAAGG + Intergenic
1021861285 7:24908482-24908504 TGGGTAAAGAGGGCATGGTAGGG - Intronic
1023763637 7:43490268-43490290 TGGGGAATGGGAGCATGGTACGG - Intronic
1023908599 7:44538800-44538822 TGCCAAGTGAGTCCATGGTGGGG - Exonic
1025933180 7:66012692-66012714 TGGGATATGAGTGCAAAGTAGGG - Intergenic
1025960236 7:66214147-66214169 TGGCTAAGGAGTGTGTGGTATGG - Intronic
1026519905 7:71107572-71107594 GGGCAAAAGAGTCCTTGGTACGG + Intergenic
1032424734 7:131813363-131813385 TGGAAAGTGAGGGCATTGTAAGG - Intergenic
1032788867 7:135226998-135227020 TTGCAAATGACTGAATGGTAGGG + Intergenic
1033635201 7:143205688-143205710 TTGCAAATGTGTGCATTATAAGG - Intergenic
1034301019 7:150015434-150015456 TGGCAACTGAGTGTATGTGATGG - Intergenic
1034805034 7:154081868-154081890 TGGCAACTGAGTGTATGTGACGG + Intronic
1037491352 8:19399888-19399910 TGGCAAATGAATGTATTGTGTGG - Intergenic
1040903273 8:52439253-52439275 TGGCGTGTGTGTGCATGGTATGG + Intronic
1042048732 8:64684164-64684186 TGTTAAATGAATGCATGGTTGGG + Intronic
1042120655 8:65484551-65484573 TTGTAAATGAGTGGATGGTAAGG + Intergenic
1043358424 8:79440986-79441008 GGGGAAATGAGTACCTGGTAGGG + Intergenic
1043526784 8:81105946-81105968 TTGCAAATGAATACATGATACGG + Intronic
1044194849 8:89362972-89362994 TAGTAAAGGAGTCCATGGTAAGG + Intergenic
1044391434 8:91656935-91656957 TGGCTGATGAGTGAATGGGAAGG - Intergenic
1045379459 8:101608907-101608929 TGGAAGAAGAGTGTATGGTAGGG + Intronic
1045758714 8:105576357-105576379 TGTCAGATGAGTGAATGATAGGG + Intronic
1045806865 8:106172394-106172416 TGGCAAATGAGCACATGAAAAGG - Intergenic
1045929451 8:107605227-107605249 TGGTCAATGACTGCATGGCAGGG - Intergenic
1046757461 8:117986752-117986774 TGGCAAATGTTTCCATGCTATGG - Intronic
1046936121 8:119887373-119887395 GGGGAAAGGAGTGCAGGGTAAGG - Intronic
1047182927 8:122606232-122606254 TGGCAAAGAAGTGCAGGGCAAGG + Intergenic
1047411114 8:124625444-124625466 AGGGAAATGAGTGCATGGTTGGG + Intronic
1048536785 8:135303825-135303847 TGGCAAATGAGTGAATGAGCAGG + Intergenic
1049864169 8:144922967-144922989 AGGGCAATGAGTGCATGGCAGGG + Intergenic
1051757982 9:20425477-20425499 GTGCAAATGAGTGCATGAAAAGG - Intronic
1054804327 9:69383495-69383517 TGGCCAAGGAGACCATGGTATGG + Intronic
1055984935 9:82048562-82048584 TAGGAAATGAGGGCAAGGTAAGG + Intergenic
1059350364 9:113659936-113659958 TGGCACATGTGTTCAGGGTATGG - Intergenic
1059530187 9:115028366-115028388 TGGCAATTGAGTACTTTGTAGGG + Intronic
1061619356 9:131801473-131801495 TGGAACATGGGTGCATGGTGGGG + Intergenic
1203674973 Un_KI270756v1:14257-14279 TGGCAAAAGAGAGAATGGAATGG - Intergenic
1186920363 X:14271959-14271981 AGGGAAATGAGGGCACGGTAGGG + Intergenic
1187832737 X:23399345-23399367 GGCCAAATGAGTTCATGGGAGGG + Exonic
1188307817 X:28580235-28580257 TGGCAAATGAATGCATCAAAAGG - Intergenic
1188541846 X:31259401-31259423 TGGCAAATGAGAGAATGAAAAGG - Intronic
1188938709 X:36210468-36210490 TGGCAAATAAGCACATGGAAAGG - Intergenic
1188962830 X:36513847-36513869 TGGGAAGTGAGTGCATGGTGAGG + Intergenic
1189323838 X:40101374-40101396 GAGCAAAGGAGTGCATGGGAGGG + Intronic
1191662919 X:63669127-63669149 CGTCAAATGAGTTCATGGAAAGG + Intronic
1193037438 X:76967318-76967340 TGGGAGATGAGTGACTGGTATGG - Intergenic
1193989941 X:88294490-88294512 TGGGAAATGAGAGCATATTAAGG - Intergenic
1196676328 X:118424449-118424471 TGGCCAATGAGTACATGAAAAGG - Intronic
1196798571 X:119522152-119522174 TGGCAGATAACTGCTTGGTAAGG - Intergenic
1199285555 X:146050529-146050551 TGGGAAATCAGTGCAGCGTATGG - Intergenic
1201640406 Y:16171250-16171272 TGGTCAATGGGTGCATGGCAGGG - Intergenic
1201662408 Y:16414075-16414097 TGGTCAATGGGTGCATGGCAGGG + Intergenic