ID: 1130335245

View in Genome Browser
Species Human (GRCh38)
Location 15:82952545-82952567
Sequence TGCTCCGGCGGCCGCTCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130335242_1130335245 -10 Left 1130335242 15:82952532-82952554 CCATCTCCGGCGCTGCTCCGGCG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1130335245 15:82952545-82952567 TGCTCCGGCGGCCGCTCCGACGG 0: 1
1: 0
2: 1
3: 4
4: 66
1130335239_1130335245 -8 Left 1130335239 15:82952530-82952552 CCCCATCTCCGGCGCTGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1130335245 15:82952545-82952567 TGCTCCGGCGGCCGCTCCGACGG 0: 1
1: 0
2: 1
3: 4
4: 66
1130335241_1130335245 -9 Left 1130335241 15:82952531-82952553 CCCATCTCCGGCGCTGCTCCGGC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1130335245 15:82952545-82952567 TGCTCCGGCGGCCGCTCCGACGG 0: 1
1: 0
2: 1
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130335245 Original CRISPR TGCTCCGGCGGCCGCTCCGA CGG Exonic