ID: 1130335754

View in Genome Browser
Species Human (GRCh38)
Location 15:82955892-82955914
Sequence CTAATTTAGGTTGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130335754 Original CRISPR CTAATTTAGGTTGAGGAGGA TGG Intronic
908025464 1:59946975-59946997 CTAATTTAATTTGAGGAAGATGG + Intergenic
909086180 1:71172387-71172409 CCATTTTAGGGTGTGGAGGATGG + Intergenic
909371237 1:74885428-74885450 CTAATCTAGGGTATGGAGGACGG - Intergenic
910917130 1:92301003-92301025 CTAATTTAGTTGGAGGTGGGTGG + Intronic
911978362 1:104533512-104533534 CTATTTTAGGTTTAGCATGATGG + Intergenic
914228621 1:145743849-145743871 TTAATTTATGTTGAGGAGTTAGG - Exonic
919137198 1:193525046-193525068 CTAGTTTATGTTGAGGACCATGG - Intergenic
919214567 1:194535331-194535353 CCCATTAAGGGTGAGGAGGACGG + Intergenic
923069020 1:230545880-230545902 CTAGAAAAGGTTGAGGAGGAGGG + Intergenic
923207672 1:231774536-231774558 CTAATTTACTTTGAGGTGCAGGG + Intronic
923745271 1:236694029-236694051 CTAAGATAGGTGGAGGAGGGAGG - Intronic
924030226 1:239878865-239878887 CTAATTCAGCCTGAGGAGGAAGG + Intronic
924060525 1:240169573-240169595 CTACTTGAGGCTGAGGCGGAAGG - Intronic
1062794359 10:332388-332410 CTTATTTATGGTGATGAGGAGGG - Intronic
1063606543 10:7527455-7527477 CTTTTTTAAGTTGAAGAGGAGGG + Intergenic
1066275076 10:33860758-33860780 CTTACTTAGGTTGATGAAGATGG - Intergenic
1066708753 10:38209571-38209593 CAAGTTTGGGTTGAGGAGAAAGG - Intergenic
1068705953 10:60075683-60075705 TTAATTAAAGTTGAGGATGATGG + Exonic
1068831541 10:61501415-61501437 CTAAATTAGGATGAAGAGTAGGG + Intergenic
1070457840 10:76634476-76634498 CAAACTTTGCTTGAGGAGGAAGG + Intergenic
1074360202 10:112819732-112819754 CCGATTTAGGATGAGGACGATGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076071155 10:127490843-127490865 CTGATTTAAGTTGAAGAAGATGG - Intergenic
1078148156 11:8736240-8736262 CTATTTTAGGCTGAGGTGGGAGG + Intronic
1079941236 11:26683310-26683332 CTAATTTATGTAGGGGAGAAGGG - Intronic
1080669668 11:34364436-34364458 CTAATCTAGGTTGCACAGGATGG - Intergenic
1082183948 11:49156363-49156385 CTAATTTTGAATAAGGAGGAGGG + Intronic
1084371511 11:68748042-68748064 CAAGTGTAGGTGGAGGAGGAGGG - Intronic
1086682410 11:89689006-89689028 CTAATTTTGAATAAGGAGGAGGG - Intergenic
1086981290 11:93200249-93200271 CTACTTTAGATTGAGAAGGTGGG + Intergenic
1087402958 11:97691167-97691189 GTAATTTTGTTTGAGGAGCAGGG - Intergenic
1088363823 11:109018296-109018318 CTGATTTAGGTGGAAGAAGAAGG - Intergenic
1088559578 11:111099093-111099115 CTAATTCAGGAAGAGGAGGCGGG + Intergenic
1088750254 11:112836872-112836894 GTAATTTGGTTTGAGGAGGTGGG - Intergenic
1089319673 11:117616630-117616652 CTTTTTTTGGTTGGGGAGGAGGG + Intronic
1089422421 11:118341806-118341828 TAACTTTAGGTTGAGCAGGACGG - Intronic
1089477153 11:118773699-118773721 CTAATTTAGGCTGGGGATGGTGG + Intronic
1090714727 11:129420175-129420197 CTAATACATGTTTAGGAGGAGGG - Intronic
1091817455 12:3450061-3450083 CTTGTTTTGGTTGAGGTGGATGG + Intronic
1091990584 12:4952481-4952503 ATGGTTTAAGTTGAGGAGGAAGG + Intergenic
1096606904 12:52773186-52773208 CTAATTTCTGTTCAGGAGGGTGG - Intronic
1096711845 12:53463229-53463251 AGAGTTTAGGTTGATGAGGAAGG - Intronic
1100344238 12:93711486-93711508 CTAATTTATGATGAGGAGTCTGG - Intronic
1101647218 12:106642721-106642743 CTATTTCAGGTTGAGCAGTAAGG + Intronic
1102399989 12:112620486-112620508 CAAATGTAGGTGGAGAAGGATGG - Intronic
1102842813 12:116144266-116144288 CTAATTTTGGATGAGAAGTAAGG + Intronic
1103296939 12:119895720-119895742 TTAATAAAGGTGGAGGAGGAAGG + Intergenic
1107575522 13:41716477-41716499 CTGATTTCAGTTGAGGAAGAAGG + Intronic
1107906228 13:45063724-45063746 CTAAATTAAGTTGAGCAAGATGG + Intergenic
1108549040 13:51524781-51524803 TTAATTTGGGTTGAGGAAGAGGG + Intergenic
1108884277 13:55160038-55160060 CTAAATTAGATGGAGGATGAAGG + Intergenic
1117566317 14:56997095-56997117 CTAATTTAGGCTAATTAGGATGG + Intergenic
1117825140 14:59694008-59694030 CAAATTGAGGTTGAGGTGAAGGG - Intronic
1119866936 14:77981706-77981728 CTGATTTTGGGTGAGGATGAGGG + Intergenic
1120462342 14:84813248-84813270 CTAATTTAGCTTGGGTTGGAAGG - Intergenic
1120486050 14:85114176-85114198 CCAAAGTAGGTTGAGAAGGAAGG + Intergenic
1120546281 14:85815479-85815501 CTACTCTAGGTTTAGGTGGAAGG + Intergenic
1121247925 14:92476236-92476258 CTCATCTAGGTTGCTGAGGAAGG - Intronic
1121264442 14:92590454-92590476 GCAAGTTAGGTTGAGCAGGAGGG - Intronic
1123743112 15:23298395-23298417 CTCATGCACGTTGAGGAGGAGGG + Intergenic
1124276151 15:28327480-28327502 CTCATGCACGTTGAGGAGGAGGG - Intergenic
1124306549 15:28584127-28584149 CTCATGCACGTTGAGGAGGAGGG + Intergenic
1125478291 15:40062557-40062579 CAGACTTAGGCTGAGGAGGAAGG + Intergenic
1130284355 15:82542593-82542615 CCAATTTAGTCTGAGGTGGAGGG - Intronic
1130335754 15:82955892-82955914 CTAATTTAGGTTGAGGAGGATGG + Intronic
1130967903 15:88710669-88710691 CTAAATTGGCTTGGGGAGGAGGG + Intergenic
1132645088 16:995325-995347 ATAATTTAGGTTGTGGGTGAAGG - Intergenic
1133873523 16:9711651-9711673 CTAATTTGGCTGGAGGAGTAGGG - Intergenic
1136179092 16:28538745-28538767 CTGATTTCGGGAGAGGAGGAAGG + Intronic
1136656598 16:31712984-31713006 CTAATTAAGTTTAAGAAGGAGGG - Intergenic
1136922677 16:34345258-34345280 CTTATTTGGGGTGAGAAGGAGGG - Intergenic
1136981896 16:35066548-35066570 CTTATTTGGGGTGAGAAGGAGGG + Intergenic
1138514824 16:57530287-57530309 CTCATTTATTTTAAGGAGGAGGG - Intronic
1141053446 16:80794271-80794293 CCACTTGAGGTTGAGGAGGCTGG - Intronic
1141256035 16:82403348-82403370 CTAACTGAGCTTGAAGAGGATGG - Intergenic
1141350276 16:83288373-83288395 CTACATGAGGTGGAGGAGGAGGG + Intronic
1141842453 16:86582240-86582262 CTCTTTTTGGTTCAGGAGGAAGG - Intergenic
1143829474 17:9639565-9639587 CTAATTTATTTTGGGTAGGAGGG + Intronic
1144325096 17:14171659-14171681 CTAGAGTAGGTGGAGGAGGAAGG - Intronic
1144473970 17:15568538-15568560 CTAGAGTAGGTGGAGGAGGAAGG - Intronic
1145394289 17:22482490-22482512 CATCTTTAGGTTGAGGAGGCTGG + Intergenic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1150574775 17:66420701-66420723 CCATTCTAGGTTGAGGAGCATGG + Intronic
1151209589 17:72534386-72534408 ATAATATGGGTTGTGGAGGAGGG - Intergenic
1153465176 18:5380575-5380597 CTAGTTTATCTTTAGGAGGAAGG + Intergenic
1156094083 18:33508894-33508916 CAAATTTGGGTTGAGGAGTAAGG - Intergenic
1158703369 18:59769749-59769771 CCAATTCAGGGTGGGGAGGAAGG + Intergenic
1160095629 18:75869980-75870002 CTAATATATGTGGAGGAGGAAGG + Intergenic
1163281949 19:16323870-16323892 CTTATTGAGGTTGGGGAGGAGGG + Intergenic
1166713577 19:44952387-44952409 CAAATTTAGGTAGAGGACCATGG - Intronic
925399648 2:3563214-3563236 ATGACTTAGGTTTAGGAGGACGG - Intergenic
926679934 2:15655308-15655330 CAAAGTCAGGTTGAGGAGGTTGG - Intergenic
927600004 2:24432326-24432348 CTCACTTAGGATGTGGAGGAGGG + Intergenic
928301849 2:30132093-30132115 CTATTTGAGGTTGTGTAGGAAGG - Intergenic
929405280 2:41634634-41634656 CTTATTCAGATTCAGGAGGATGG - Intergenic
933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG + Intergenic
934664600 2:96161176-96161198 CTACTTGAGGTGGACGAGGAGGG + Intergenic
936859076 2:116994470-116994492 TTAATTGAGCTTGAGGAGGCGGG - Intergenic
937569629 2:123340490-123340512 ATAATGTAGGCTGAGGAGGAGGG - Intergenic
939183578 2:138832559-138832581 CTAATTTAGGGAAAGAAGGAAGG - Intergenic
940242481 2:151578323-151578345 CAAATTAAGTTTGAGGAAGATGG + Intronic
940243473 2:151589001-151589023 CAAATTAAGTTTGAGGAAGATGG + Intronic
940244429 2:151599554-151599576 CAAATTAAGTTTGAGGAAGATGG + Intronic
940339483 2:152565255-152565277 CTAACTTAGGGTTTGGAGGAAGG + Intronic
940898265 2:159102386-159102408 CTACTTGAGGCTGAGGTGGAAGG - Intronic
940898522 2:159104655-159104677 CTACTTGAGGCTGAGGTGGAAGG - Intronic
942325660 2:174775002-174775024 CTAATTACGGGTGAGGAGGATGG + Intergenic
946094501 2:217261394-217261416 CAAATCTAGCTAGAGGAGGAGGG - Intergenic
946305826 2:218856542-218856564 AGACTTGAGGTTGAGGAGGAAGG - Intergenic
947728831 2:232417149-232417171 CTGGTTTAGGGTGGGGAGGATGG - Intergenic
947940618 2:234051751-234051773 CAAATTTAGGTTAAGGTGGGAGG + Intronic
948265071 2:236629957-236629979 CTGGTTTAGGTTGAGTATGATGG - Intergenic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1172072973 20:32272196-32272218 CTGACTGACGTTGAGGAGGAGGG + Intergenic
1175763247 20:61575282-61575304 CAAGTTTAAGTTGAGGAGAAAGG + Intronic
1176078646 20:63260723-63260745 CTAATGTAGGCTCGGGAGGAGGG - Intronic
1177485767 21:21753957-21753979 TTAATTTAGCTTATGGAGGATGG + Intergenic
1180792506 22:18583697-18583719 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1181139313 22:20792462-20792484 CTACTATGGGGTGAGGAGGAGGG + Intronic
1181229231 22:21411618-21411640 CTGATTAGGGTGGAGGAGGAGGG + Intergenic
1181249420 22:21523245-21523267 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
952166039 3:30750097-30750119 CTAATTTACTTTGATGAAGAAGG - Intronic
952298283 3:32081061-32081083 CTAAGTTAGGTTGAGTATCAAGG - Intergenic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
956051315 3:65251424-65251446 CTTATCTAGGTTGACAAGGAGGG - Intergenic
956361262 3:68450286-68450308 CAGATTTAGGGTGAGGAGAATGG + Intronic
958099520 3:88990615-88990637 CTCACTTATGTTGAGGAGGCTGG - Intergenic
959300364 3:104591831-104591853 CTAATGTAGGTTGTGGAGTCTGG + Intergenic
959633873 3:108539313-108539335 GTACTTAAGTTTGAGGAGGAGGG + Intergenic
961614360 3:128167153-128167175 CTAATCTAGCCTGAGGAGGGTGG - Intronic
962036201 3:131654264-131654286 TTATTTTAGGTTGAGGGGTATGG + Intronic
966691229 3:182743512-182743534 CTAATCTTGGTTTTGGAGGATGG - Intergenic
970813659 4:20127187-20127209 CTAATTTAGGGAGTGGAGCATGG + Intergenic
971353570 4:25874041-25874063 CTAATTTAGATCGAGTATGAAGG - Intronic
971956678 4:33429607-33429629 CTGGTTTAGGGTGAGGAGAAGGG + Intergenic
973175639 4:47202011-47202033 TTAAGTTAGGGTGATGAGGATGG - Intronic
974828674 4:67162204-67162226 CTAGATGAGGTTGAAGAGGAGGG - Intergenic
974998554 4:69193345-69193367 CAAACTGAGGTTGAGGAGGTCGG - Intronic
977241584 4:94576924-94576946 GAAATTTATGTTGAGGAGCAAGG + Intronic
977246493 4:94637624-94637646 CTAATTTAGTCTGAAGATGATGG + Intronic
978563983 4:110062591-110062613 CTAATGTAACTTGGGGAGGAAGG - Intronic
979200117 4:117967617-117967639 CTAAAGTGGGTTGAGGAGGAAGG + Intergenic
980095325 4:128484115-128484137 ATGATTTCTGTTGAGGAGGATGG + Intergenic
980099695 4:128529348-128529370 CTCATTTAAGCTGAGGGGGATGG - Intergenic
981419080 4:144528396-144528418 GTAATTTAGATTGATGAAGAAGG - Intergenic
981435357 4:144714624-144714646 TAAATTTATGTTGAGGATGAAGG - Intronic
983525371 4:168755295-168755317 CTAATTTAGATGGAGGATCAGGG + Intronic
983555575 4:169056335-169056357 CTGAATTATGTTGAGCAGGATGG + Intergenic
983841496 4:172462140-172462162 GTAATTTAGGTTGAGTCTGAAGG - Intronic
987404253 5:17508984-17509006 TTTATTTAGTTTGTGGAGGAAGG + Intergenic
988450938 5:31342478-31342500 CTAACTGAGGGTGAGGAAGAGGG + Intergenic
988936134 5:36084438-36084460 ATAATTGAGGTTCAGGAGGATGG + Intergenic
990362578 5:55035668-55035690 CTAATTTGGGCGGAGGAGCATGG + Intergenic
991225920 5:64272230-64272252 CTATTTTAGTTTGAGGAGTCAGG + Intronic
991588982 5:68229448-68229470 CTAAGTCAGGTGGAGGTGGAGGG - Intronic
992238316 5:74735770-74735792 CTAATTTGGGTTAAAGAAGAGGG + Intronic
992613341 5:78526562-78526584 TTAATTTACTTTGATGAGGAAGG - Intronic
994231117 5:97311537-97311559 CTAATTTTTTTTAAGGAGGAAGG + Intergenic
997865500 5:137459322-137459344 CTATTTTTGTTTGAGGGGGAAGG - Intronic
1000399272 5:160808657-160808679 CTAATTTGGGTTGAATGGGAAGG - Intronic
1001427780 5:171635402-171635424 TAAATTTAGGTTGAGGGTGAGGG - Intergenic
1007979029 6:46131074-46131096 CTAATTTAAGTGGAGGTGGGGGG - Intronic
1008308551 6:49935869-49935891 CGTATTTAGATTGAGTAGGAGGG - Intergenic
1009940808 6:70285767-70285789 ATATTTTATGTTGAGAAGGATGG - Intronic
1010028545 6:71247261-71247283 ATATTTTTGGTTGAGGAAGAAGG - Intergenic
1010575615 6:77526455-77526477 ATAATTTATTTTGAGGAGCATGG - Intergenic
1010850399 6:80768566-80768588 CTAAATTAGGATGAGAAGGTTGG + Intergenic
1012155698 6:95817389-95817411 CTACTTTTGATTGAGGAGTAAGG + Intergenic
1012697574 6:102407486-102407508 CTAATATAGCTTGAGGAGACTGG - Intergenic
1012710976 6:102604110-102604132 GGAATTTAGGCTGAGGAGGGTGG - Intergenic
1014959344 6:127663350-127663372 GTTATTTGGGTTAAGGAGGATGG + Intergenic
1020695988 7:11414442-11414464 CTAATTTGTGTTGAGCAGGGTGG - Intronic
1022165124 7:27751894-27751916 CTTATTTAGGCTGAGGCGGGTGG - Intronic
1022431875 7:30332376-30332398 AAAATTTCGGTTGAGGAGGTGGG + Intronic
1023205467 7:37745040-37745062 TTAAATGAAGTTGAGGAGGAAGG - Intronic
1023390008 7:39700626-39700648 CTCACCTAGGTTGAGAAGGAAGG + Intronic
1026395796 7:69953040-69953062 CTAATTTAGGGGAGGGAGGAGGG - Intronic
1027180577 7:75936570-75936592 CTCATTTCGGTAAAGGAGGAGGG + Intronic
1037634936 8:20693170-20693192 GGAATTGAGGTAGAGGAGGAAGG + Intergenic
1042738894 8:72020734-72020756 CTAATTTAGATTGAGAAGGCAGG + Intronic
1042883147 8:73516740-73516762 ATAATTTAAGTTTATGAGGAAGG + Intronic
1043183301 8:77112408-77112430 CTAAATTATGTTGAATAGGACGG - Intergenic
1043480594 8:80648438-80648460 CTTATTTTAGTTGAGGATGAGGG + Intronic
1043542840 8:81281515-81281537 CCACTTGAGGGTGAGGAGGAAGG + Intronic
1044299890 8:90571714-90571736 CTAAGTTAGGCTGAGGCAGAGGG - Intergenic
1044613283 8:94115287-94115309 CTACATTAGGAAGAGGAGGAGGG - Intergenic
1047562227 8:125999931-125999953 TGAATTTGGGTTGGGGAGGATGG - Intergenic
1048435358 8:134411636-134411658 CTACTTTAGACTGAGGAAGAGGG - Intergenic
1048462895 8:134637469-134637491 CTGAATTTGGGTGAGGAGGAAGG - Exonic
1050828914 9:9986661-9986683 CAAATTTATGTTAAGGAAGAAGG + Intronic
1051910354 9:22148110-22148132 CTAATATGGATTGTGGAGGAAGG + Intergenic
1052542802 9:29832319-29832341 TCAATTTAGGTTGAAGAAGATGG - Intergenic
1052727449 9:32246104-32246126 CTAAGCTAGGTTGTGGAGGATGG - Intergenic
1053194983 9:36110446-36110468 CTAAGGTAGGCTGAGGAAGAAGG - Intronic
1053559342 9:39173940-39173962 AGAAGTTAGGGTGAGGAGGAGGG + Intronic
1053823457 9:41994180-41994202 AGAAGTTAGGGTGAGGAGGAGGG + Intronic
1054137769 9:61445006-61445028 AGAAGTTAGGGTGAGGAGGAGGG - Intergenic
1054607116 9:67193185-67193207 AGAAGTTAGGGTGAGGAGGAGGG - Intergenic
1055591153 9:77815445-77815467 CTAATTTAGATTTATGAGGTTGG + Intronic
1057715453 9:97491652-97491674 CTAGCTTAGGTGGAGCAGGATGG + Intronic
1062183441 9:135203325-135203347 CTAATTTGGGAGGAGGAGGTGGG - Intergenic
1186194530 X:7097883-7097905 CTAAGTCAGCCTGAGGAGGAAGG + Intronic
1186811093 X:13189297-13189319 CTAATGTAGGTTAAGGTTGATGG + Intergenic
1187608192 X:20909955-20909977 CAAAGTTAAGTTGAGAAGGAAGG + Intergenic
1191256295 X:58281051-58281073 CTAGAGGAGGTTGAGGAGGATGG - Intergenic
1193664040 X:84294056-84294078 GTGATTTAGGCTCAGGAGGAGGG - Intergenic
1198178286 X:134177715-134177737 CTTTTTTATGCTGAGGAGGAAGG + Intergenic
1199022947 X:142903926-142903948 CCAATTTATGTTGGGTAGGAAGG + Intergenic
1199491514 X:148405377-148405399 CTAATGTAGGGTGAGGGGAAAGG - Intergenic
1199912120 X:152298157-152298179 CTAATATAGGATGTGGAGGTTGG + Intronic
1201518596 Y:14846797-14846819 CTTATTTAGGTTGCAAAGGATGG + Intergenic
1201566887 Y:15374603-15374625 CTAAGTAAGCTAGAGGAGGAAGG + Intergenic