ID: 1130336250

View in Genome Browser
Species Human (GRCh38)
Location 15:82959437-82959459
Sequence AGGCAGAGCACAGTCATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 9, 3: 54, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130336245_1130336250 21 Left 1130336245 15:82959393-82959415 CCCATTGGCATGCACAGAGTGGC 0: 1
1: 0
2: 4
3: 16
4: 310
Right 1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG 0: 1
1: 0
2: 9
3: 54
4: 302
1130336246_1130336250 20 Left 1130336246 15:82959394-82959416 CCATTGGCATGCACAGAGTGGCT 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG 0: 1
1: 0
2: 9
3: 54
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130336250 Original CRISPR AGGCAGAGCACAGTCATTGC AGG Intronic
900397709 1:2460038-2460060 AGCTGGAGCACAGTCACTGCCGG - Intronic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905298999 1:36973195-36973217 AGGCAGGGAACAGGCTTTGCAGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
907759860 1:57347094-57347116 AGGGAGAGCCCATTCAGTGCAGG + Intronic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910579878 1:88811652-88811674 AGCCAGAACACAGTCATTCTTGG + Intronic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912969024 1:114262985-114263007 AGGAAGAGGAAAGTCATTGCAGG + Intergenic
913571243 1:120122097-120122119 AGGCAGATCCCAGATATTGCAGG + Intergenic
914292053 1:146283074-146283096 AGGCAGATCCCAGATATTGCAGG + Intergenic
914553097 1:148733857-148733879 AGGCAGATCCCAGATATTGCAGG + Intergenic
915735833 1:158084389-158084411 AAGCAGAGCAAAGTCAGTGCAGG - Intronic
916345630 1:163788149-163788171 GAGGAGAGCACAGTCAATGCAGG - Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
916849534 1:168689528-168689550 AGGGAGAGAACATGCATTGCAGG - Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917406310 1:174711419-174711441 AGGCTGCGCACAGTGCTTGCGGG + Intronic
917794772 1:178525333-178525355 AGGCAGAGGACAGGCATTCAGGG - Intronic
918102467 1:181388142-181388164 AGCCAGAGCACGGCCATCGCTGG + Intergenic
918299145 1:183186347-183186369 AGCCAGAGCGCAGGCATGGCGGG - Exonic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920929077 1:210369946-210369968 AGGCAGTGGTCAGTCATTGAAGG + Intronic
1063156487 10:3383912-3383934 CAGCAGAGCACAGTCATAGATGG - Intergenic
1064130829 10:12708227-12708249 TGGGAGTGCACTGTCATTGCAGG - Intronic
1065259170 10:23907036-23907058 AGGCAGCGTACAGTCATTTATGG + Intronic
1067454541 10:46408791-46408813 AGGCAGAGGCCATTCAGTGCAGG - Intergenic
1067632662 10:47975848-47975870 AGGCAGAGGCCATTCAGTGCAGG + Intergenic
1067664871 10:48269331-48269353 AGGCAGAGAATTGGCATTGCTGG - Intronic
1068224921 10:54095641-54095663 AGGCATAGCAGAATCACTGCTGG + Intronic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072265160 10:93720202-93720224 AGGCAGAGCACAGACTCTGGGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1078077773 11:8177157-8177179 AGGCAGAGCAGAGGCCATGCAGG + Intergenic
1078141369 11:8695572-8695594 GGGAAGAGAACAGTCATTGGAGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080060519 11:27951790-27951812 AGGCAGAGCATGGACTTTGCAGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1083443695 11:62693049-62693071 AGGCAGATCAGAGACAGTGCTGG - Intronic
1083512887 11:63227935-63227957 AGGAAGAGCACAGCAATTACGGG - Intronic
1083668453 11:64287694-64287716 AGCCACAGCACAGTCAGCGCGGG - Intronic
1084264548 11:67998077-67998099 AGTCAGAGCTCAATCAGTGCAGG - Intronic
1084963279 11:72728801-72728823 TGGCAGAGCACAGTAAGTTCTGG + Intronic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089120127 11:116128037-116128059 AGGCAGACCACAGTCTTTAAAGG + Intergenic
1089977455 11:122744958-122744980 AGGCAGAGGACTTTCCTTGCAGG + Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090963598 11:131579232-131579254 AAGCAGAGCTTAGTCATAGCAGG + Intronic
1091436068 12:474058-474080 ATGTAGAACAGAGTCATTGCTGG + Intronic
1093018161 12:14175696-14175718 AGGCAAAGCATAGTCTTTGGTGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1096239298 12:49951035-49951057 AGGCAGGCCACAGTCACGGCAGG - Exonic
1096513110 12:52142767-52142789 AAGCAGAGCACAGCCAGTGCAGG + Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1097802156 12:63926473-63926495 AGGCAGAGCACAGACTTAGGAGG - Intronic
1098649174 12:72942150-72942172 AGGCAGAGCACAATGAATACGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1103968064 12:124652709-124652731 AGGCAAAGCAGAGTGAGTGCTGG + Intergenic
1104108661 12:125686510-125686532 TGGCAGATCACAGTGATGGCTGG - Intergenic
1108480601 13:50866321-50866343 AGGCAGCGCAGAGTCAAGGCAGG - Intergenic
1108585804 13:51868906-51868928 AGGCACAGCTCAGGCTTTGCGGG - Intergenic
1109648740 13:65296301-65296323 AGTCAGAGCACTGACATTACTGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112909010 13:104458934-104458956 GGGAATAACACAGTCATTGCCGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115348634 14:32369138-32369160 AGGCAGAGATTGGTCATTGCAGG + Intronic
1115736677 14:36339146-36339168 AGGAATAGCACAGACAATGCTGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118325012 14:64774691-64774713 AGGTAGGGCACGGGCATTGCTGG - Intronic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119478747 14:74946913-74946935 AGGCAGAGCCCAGACATGCCTGG - Intronic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1128290755 15:66476692-66476714 AGGCAGAGGGCAGCCATGGCAGG + Intronic
1128820753 15:70650673-70650695 AGGCAGAACACAGTTATTCCTGG - Intergenic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1131086724 15:89581837-89581859 AGGCAGAGCACAGACTTTACAGG + Intronic
1131445233 15:92493356-92493378 AGGCACAGTACAGTCATTCCAGG - Intronic
1132407443 15:101552362-101552384 AGCCACAGCTCAGTCACTGCTGG - Intergenic
1132693852 16:1193450-1193472 CCTCAGAGCACAGTCCTTGCTGG - Intronic
1133997428 16:10759130-10759152 AGTCAGAGCTCAGTGAGTGCTGG - Intronic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1135423243 16:22318440-22318462 GAGCAGAGCACAGTGATTGAGGG + Intronic
1135876654 16:26206737-26206759 AGGCACAGCACAGTCAGAGATGG - Intergenic
1137737972 16:50739115-50739137 AGGCAGAGCGCAGACAATGAAGG - Intergenic
1137813935 16:51380236-51380258 AGGCAGGTCCCAGTCCTTGCTGG + Intergenic
1138269068 16:55681744-55681766 AGGCAGATGACAGCCCTTGCTGG - Intronic
1138345644 16:56318421-56318443 AGCCAGAGACCAGGCATTGCAGG - Intronic
1138541730 16:57691776-57691798 AGGCAGTGGGCAGTCCTTGCAGG - Intergenic
1141292769 16:82735382-82735404 ATGAATAGCACAGTCACTGCAGG - Intronic
1141697269 16:85626016-85626038 AGGCAAAGGACAGCCCTTGCAGG - Intronic
1142129512 16:88426305-88426327 AGGCAGGGCTCAGCCCTTGCAGG - Intergenic
1203123902 16_KI270728v1_random:1559950-1559972 AGGCAGGGCACAGCCAAGGCAGG - Intergenic
1142498007 17:316644-316666 AGGTGGAGCACAGGCACTGCAGG - Intronic
1142498124 17:317220-317242 AGGTGGAGCACAGGCACTGCAGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146604351 17:34245620-34245642 AAGCAGAGCACAGACATAGAAGG + Intergenic
1147947961 17:44091269-44091291 CAGCAGAGCACCCTCATTGCTGG - Exonic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149626418 17:58083612-58083634 AGGCAGAGCACAGGCAGGGGCGG - Exonic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151487462 17:74410193-74410215 AGGCAGAGGACAGGCTTTGGGGG + Intergenic
1151688067 17:75661317-75661339 AGGAAGAGCACAGGCTTTGGAGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153914264 18:9732169-9732191 AGGCAGAGCAGAGCCCATGCTGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157158984 18:45295562-45295584 GGTCAGGGCACAGTCACTGCCGG + Intronic
1157333520 18:46720768-46720790 AGGCTGAGCACACTCATTGCAGG - Intronic
1158116742 18:54004658-54004680 AGGCAGAGCACAGCTATTAAGGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160009083 18:75090013-75090035 AGGGAGAGCACAGTCAGAGGTGG + Intergenic
1160186263 18:76678875-76678897 AGCCAGAGCCCAGCCACTGCGGG - Intergenic
1161684730 19:5697149-5697171 GGGCAGAGCACAGAGCTTGCAGG - Intronic
1162292293 19:9789293-9789315 GGGCAGAGCAGAGTCATCGAGGG - Intronic
1164618587 19:29680868-29680890 AGGCAGAGCACGGGCATGGACGG - Intergenic
1164923134 19:32104740-32104762 AGGCCGACCACAGTTATTCCAGG - Intergenic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927693982 2:25227806-25227828 AGGCTGTGAACAGTCATGGCAGG + Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
929052081 2:37846198-37846220 AGGTAGAGCACAGTTGTGGCAGG - Intergenic
929122757 2:38496939-38496961 TGGCAGAGCAAAATCACTGCAGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
932109727 2:68987019-68987041 AGGCAGAGGCCTCTCATTGCTGG + Intergenic
935145068 2:100390114-100390136 TTGCAGAGCACAGCCATTCCTGG + Intergenic
935676965 2:105602811-105602833 AGGCAGAGCACAGACTTTTAGGG + Intergenic
936293526 2:111247452-111247474 AGGCAGATCACAGCCCTTCCTGG + Intergenic
936508541 2:113127587-113127609 AGGCAGTGGACTGCCATTGCGGG - Intronic
938150160 2:128875527-128875549 AGGCTGACCACATTCATTCCTGG + Intergenic
940137645 2:150457130-150457152 TGGCAGAACTCAGTCATTACAGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941339162 2:164284694-164284716 AGGCAGAGCACAGATATTTAGGG + Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942332666 2:174843895-174843917 ATGCATGGCACAATCATTGCTGG + Intronic
943028223 2:182654713-182654735 AGCCAGAGCCCATTCATTGAAGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943869617 2:192977223-192977245 ATGCAGAGCAGGGGCATTGCAGG + Intergenic
944215003 2:197246136-197246158 AGGCAGGGCACAGTCATTCATGG - Intronic
946196302 2:218034600-218034622 AGGCAGAGCACAGCCAGGGTGGG + Intergenic
946411403 2:219517025-219517047 GGGCAGAGCTCAGTCTTAGCAGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169933523 20:10858622-10858644 AGGCACAGCACAATCACTGGAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170212756 20:13861708-13861730 GGGCAAAGCAAAGTCATTGGAGG - Intronic
1170423889 20:16219052-16219074 AGGCAGAGCACACTCCCTCCGGG - Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170771331 20:19335452-19335474 ACACAGAGAACAGTAATTGCTGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1173891158 20:46511706-46511728 AGGCAGAGCACAGTAATTACAGG - Intronic
1174116790 20:48231723-48231745 AGGCAGTGCAAAGTCATTGGTGG - Intergenic
1174482670 20:50842332-50842354 AGGAAGAGAACAGCCTTTGCAGG - Intronic
1175166001 20:57045248-57045270 AGGCAGAGCAGAGTTTGTGCCGG + Intergenic
1175699488 20:61126705-61126727 GCCCAGAGCACAGACATTGCAGG - Intergenic
1176035477 20:63034253-63034275 AATCACAGCACAATCATTGCAGG + Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177175039 21:17693982-17694004 AGGCAATGCACAGTAATAGCAGG + Intergenic
1178095601 21:29211980-29212002 AGGCATAGCACAGTCTTAGTTGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180615541 22:17123530-17123552 AGGCAGAAAACAGCCATTGGTGG - Intronic
1180919513 22:19513842-19513864 AGACAGAGCATCGTCATTCCAGG - Intronic
1181485885 22:23231617-23231639 AGGCAGAGCACAGCCAGCTCAGG - Intronic
1181504308 22:23341271-23341293 AGGGAGAGCAAAGACATTACAGG + Intergenic
1181655417 22:24293882-24293904 AGGGAGAGCAAAGACATTACAGG + Intronic
1181709296 22:24671505-24671527 AGGGAGAGCAAAGACATTACAGG + Intergenic
1182114839 22:27750219-27750241 AGGCTGAGCACTGTGTTTGCAGG + Exonic
1182676242 22:32042150-32042172 AGGCAGACCAGAGTCCTGGCAGG + Intergenic
1183192293 22:36329391-36329413 AGACAGAGCAATTTCATTGCTGG + Intronic
950829167 3:15858012-15858034 AGGTAAAGCACAGTTATAGCAGG - Intronic
950859174 3:16132395-16132417 AGGGAAAGCCCAGTCATTCCAGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951396073 3:22167661-22167683 AGGCAGAGCAAGGACATTGCTGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957219061 3:77358905-77358927 AAGATGAGCACAGTCATTGTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957582466 3:82091958-82091980 AAACAAAGCACAGTCATTTCAGG - Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960856138 3:122103969-122103991 AGGCAGAGGACAGCCACTTCTGG + Intronic
960996308 3:123342736-123342758 AGGCACAGACCAGTCAGTGCAGG + Intronic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964432078 3:156617817-156617839 GGGCAGAGCACAGGAATTGTTGG + Intergenic
967125977 3:186425079-186425101 AGGCAGAGCTCAGTCTTTGGTGG + Intergenic
967276308 3:187778840-187778862 ATGCAGAGGACAGGCATTCCAGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
969172002 4:5371613-5371635 ACGCAGAGCACAGCCAGGGCTGG - Intronic
969197783 4:5576849-5576871 AGGCACAGGACAGTGATTTCAGG - Intronic
971536615 4:27759869-27759891 AGGCAGAACACAGTCATACCGGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973683831 4:53349136-53349158 AGGCAGAGCTGAGTCACAGCAGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975394833 4:73862939-73862961 AGGCAGGGCCCAGTCACTGAAGG - Intergenic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977521740 4:98093745-98093767 AGGCAAAGCACAGCAATTGGGGG + Intronic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978644653 4:110915587-110915609 AGGCAGAGCAGAGACATGGAAGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979476877 4:121168870-121168892 AGTCAGAGATCAGTCACTGCTGG - Intronic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981459190 4:144992046-144992068 AGGCAGAGCACAGGCAGAGTAGG - Intronic
982834544 4:160108148-160108170 AGGCAGAGACCAATCAATGCAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983893504 4:173056591-173056613 AAGCAGTGCACAGCCATTGAAGG + Intergenic
984710511 4:182880398-182880420 CGGCATGGCACAGTCGTTGCTGG - Intergenic
986397600 5:7345562-7345584 AGGCTGGGCACAGCCACTGCTGG + Intergenic
987537289 5:19205968-19205990 AGGAAGAACACAGCGATTGCAGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
990762760 5:59148949-59148971 AAGCTGAGCACAAGCATTGCAGG - Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994160179 5:96548634-96548656 AGGCAGAGTATTGTCATTGGGGG - Intronic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995292139 5:110469419-110469441 AGGCAGGGCACAGCCATGACTGG - Intronic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
997250758 5:132386943-132386965 AGGTAGAGCACAGCCATAGGTGG - Intronic
997762549 5:136463484-136463506 ATGCTGAGCACAGTGATTGGAGG - Intergenic
997997472 5:138598166-138598188 AGGCAGAGCACAGACCTACCCGG - Intergenic
998412887 5:141924518-141924540 AGGCAGATGACAGTGATTCCTGG + Intronic
999282610 5:150375181-150375203 AGGCAGGGCACAGGCCATGCAGG - Intronic
1002666060 5:180825920-180825942 AGGCAGGGCCCAGTCTTTACAGG - Intergenic
1007179944 6:39922801-39922823 AGGCAGAGCAAAAGGATTGCAGG - Intronic
1007224105 6:40300848-40300870 CTGCTGAGCACAGTCCTTGCTGG - Intergenic
1008234954 6:49034041-49034063 AGGCAAAGCAGATTCATTGCAGG + Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009443985 6:63717630-63717652 ATGCAGAGCAGAGTCATTGAGGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009928904 6:70153000-70153022 TGGCAGAGCACACTCATTAGAGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011811042 6:91132711-91132733 AAGCAGAGCAAAGTCTTTGTTGG + Intergenic
1014107103 6:117578435-117578457 TGGCAGAGCACAGTGATGGAAGG + Intronic
1015526351 6:134177748-134177770 AGGTAGAGCCCAGTTATGGCTGG + Intronic
1015939270 6:138432111-138432133 AGCCAGAGCACAGTTAGTGCTGG - Exonic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018173558 6:161160844-161160866 AGGCAGAGCAGAGGCGTTACAGG + Intronic
1021133845 7:16943012-16943034 GGGCAGAGCACAGTGCTTGCAGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022137842 7:27466245-27466267 CCACAGAGCACAGACATTGCCGG - Intergenic
1022383045 7:29878510-29878532 TGCCAGGGCACAGTCATGGCAGG + Intronic
1022475657 7:30707870-30707892 AGGCAGAGGACAAACCTTGCAGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023036331 7:36134469-36134491 AGGCAGAGCTCAGACCTTGATGG - Intergenic
1023362958 7:39434289-39434311 AGGCAGAGGACATTCATAGAAGG + Intronic
1023374490 7:39542466-39542488 AGGCAGAGTAAAGGCATTGGAGG - Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1026419660 7:70221002-70221024 AGGCAGAGCCCAGCAGTTGCAGG - Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1037686193 8:21141577-21141599 AGTCAGAGCACAGACATCTCTGG + Intergenic
1038098167 8:24339802-24339824 ACACAAAGCACAGTCATTGTTGG + Intronic
1044616212 8:94144993-94145015 AGGCTGAGCACAGCAAGTGCTGG + Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1046552539 8:115734618-115734640 AGGCACAGAACAGTCTTTCCAGG + Intronic
1046613556 8:116451464-116451486 AGGCAGAGAATAGGCATTCCAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047085782 8:121513795-121513817 AGGCAGTCCCCAGGCATTGCTGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048310840 8:133321414-133321436 AAGCAAGACACAGTCATTGCTGG + Intergenic
1049690179 8:143954870-143954892 AGGCAGAGGAAAGGCCTTGCTGG - Intronic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051428657 9:16960199-16960221 AGTCAGAGCACACTCTTTGGGGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055464945 9:76555724-76555746 AGGCTGAGCACAAGAATTGCTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056523533 9:87421835-87421857 AGACAGAGCACAGTCATGTAGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059377803 9:113899440-113899462 AGGCAGAGCTCAGGTAATGCTGG - Intronic
1059495848 9:114708805-114708827 ATGCAGGGCACAGTCATTAAGGG + Intergenic
1059751329 9:117250193-117250215 ATGCCTAGCACATTCATTGCTGG - Intronic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1059921137 9:119161146-119161168 AGGGAAAGCACAGTCATCTCTGG + Intronic
1060272702 9:122158267-122158289 AGGCAGAGGAGTGTCATGGCAGG - Intronic
1062120534 9:134831670-134831692 AGGCTGAGAGCTGTCATTGCGGG - Intronic
1062602564 9:137324545-137324567 ACCCAGAGCATCGTCATTGCAGG - Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185474137 X:403555-403577 AACCACAGCACGGTCATTGCCGG + Intergenic
1185740611 X:2529091-2529113 AGGCATTGCACCGTCATGGCTGG + Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189507826 X:41630542-41630564 AGGCAATACACAGTCATGGCAGG + Intronic
1189601627 X:42632840-42632862 AGGTAGAGCACCATCATTACTGG + Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189806055 X:44736757-44736779 AGGCAAAGCAAAGGAATTGCTGG - Intergenic
1190477435 X:50841956-50841978 AGGCAAAGCAGAGACATTCCAGG + Intergenic
1190648280 X:52543742-52543764 AAGCAGAGGACAGTGAGTGCAGG + Intergenic
1190991467 X:55555164-55555186 TGACAGAGCAGAGTCATAGCTGG + Intergenic
1191649061 X:63517158-63517180 ACGTAGAGCAGAATCATTGCAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195882023 X:109602246-109602268 AGGCAGATTATAGCCATTGCTGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic