ID: 1130336438

View in Genome Browser
Species Human (GRCh38)
Location 15:82960855-82960877
Sequence AATCTGGGGTCCTCATAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130336433_1130336438 5 Left 1130336433 15:82960827-82960849 CCAGTTGCTCTATGTGAGGTCTT 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1130336438 15:82960855-82960877 AATCTGGGGTCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 128
1130336432_1130336438 8 Left 1130336432 15:82960824-82960846 CCACCAGTTGCTCTATGTGAGGT 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1130336438 15:82960855-82960877 AATCTGGGGTCCTCATAGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130336438 Original CRISPR AATCTGGGGTCCTCATAGTG AGG Intronic
900228891 1:1546012-1546034 CCTCTGGGGTCCTCAGGGTGGGG + Intronic
901455555 1:9360973-9360995 ATGCTGGGGTGCCCATAGTGAGG + Intronic
907464182 1:54624150-54624172 ATTCTGGGGTCCTCAGAATAGGG - Intronic
908104781 1:60830283-60830305 GATCTGGGCTCCTCAAAGAGTGG - Intergenic
909505326 1:76381789-76381811 AATCTTGGTCCCTCATATTGTGG - Intronic
909600869 1:77459645-77459667 AATCTGTGGTTCTCAAAGTGTGG - Intronic
909928475 1:81467080-81467102 AAGTTGGTGTCCTCATAATGTGG + Intronic
912624710 1:111197473-111197495 AATCTGGGGTCAGCAAAGAGGGG + Intronic
912992882 1:114506843-114506865 AATCTGTGTTCCTCAAAGTGTGG + Intronic
921987425 1:221327313-221327335 AAGCTAGGGTCCTCAAACTGAGG - Intergenic
1064268349 10:13843301-13843323 AATCAGCGGTTCTCAAAGTGTGG - Intronic
1065898367 10:30183961-30183983 AATCTGGATTCCTCATAGATGGG + Intergenic
1067183412 10:44007164-44007186 AATCTGGGTTTGTCATAGTCAGG - Intergenic
1072987160 10:100151041-100151063 TATCTGGAGCCCACATAGTGTGG - Exonic
1074299573 10:112221374-112221396 AATCTAGAGTCATCAAAGTGTGG + Intergenic
1074889868 10:117726504-117726526 AACCTAGGCTCCTCAAAGTGTGG - Intergenic
1074961404 10:118449155-118449177 AATCTGGAATCTTCATGGTGGGG - Intergenic
1080840667 11:35980930-35980952 AAACTGGGGTCCCCAGACTGTGG - Intronic
1081831395 11:46119481-46119503 AATCTGGTGTCATCATATTCCGG - Intronic
1084675166 11:70629878-70629900 ATATTAGGGTCCTCATAGTGAGG - Intronic
1085792141 11:79505343-79505365 CATATGGAGTCCTCAAAGTGTGG - Intergenic
1098691124 12:73489159-73489181 AAGCTGGGGTGCTCAGTGTGTGG - Intergenic
1099532758 12:83805921-83805943 ATTCTGAGGTCCTCACAGTTAGG - Intergenic
1105216770 13:18291555-18291577 ACTCTGAGGTACTCATATTGAGG - Intergenic
1109962436 13:69648673-69648695 ATTTTGGGGTCCTCCTATTGTGG - Intergenic
1112665658 13:101569958-101569980 AATCTGGGGTAATTTTAGTGAGG - Intronic
1115450112 14:33538185-33538207 TATCTAGGGTCCTTAAAGTGGGG - Intronic
1115481553 14:33866373-33866395 ACCCTGGGGTGCTAATAGTGTGG + Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1120715432 14:87836214-87836236 AAACTGGGGTCTTCATACTGGGG + Intergenic
1121880776 14:97498589-97498611 CATCTGGAGTCCTAAAAGTGTGG - Intergenic
1202834478 14_GL000009v2_random:67660-67682 AATCTGGGGTCTGCATATGGTGG - Intergenic
1126374959 15:47988477-47988499 GATCTGTGGTTCTCAAAGTGTGG + Intergenic
1127961685 15:63895141-63895163 GATCAGGGGTTCTCAAAGTGTGG - Intergenic
1128762096 15:70224089-70224111 AGTGTGGGGTGCTAATAGTGGGG - Intergenic
1130336438 15:82960855-82960877 AATCTGGGGTCCTCATAGTGAGG + Intronic
1132290886 15:100703172-100703194 AATCTGGAGTGCTCACAGAGAGG + Intergenic
1132713774 16:1280484-1280506 AAGCTCGGGTCCTCATGATGGGG + Intergenic
1136687406 16:32003372-32003394 AGTGTGGGGTCCTCACAGTCCGG - Intergenic
1136788020 16:32946923-32946945 AGTGTGGGGTCCTCACAGTCCGG - Intergenic
1136881765 16:33906866-33906888 AGTGTGGGGTCCTCACAGTCCGG + Intergenic
1138952025 16:61924072-61924094 AGTCAGCGGTCCTCATAGTGTGG - Intronic
1141342142 16:83213122-83213144 AAGCTGGGGCCCTCACAATGGGG + Intronic
1203090245 16_KI270728v1_random:1208580-1208602 AGTGTGGGGTCCTCACAGTCCGG - Intergenic
1145018178 17:19412274-19412296 GACCTGGGGGCCTCAGAGTGGGG - Intronic
1146411768 17:32591918-32591940 TATCAGGGGTCCTTAAAGTGTGG - Intronic
1155102387 18:22624869-22624891 AGTCTGGGGACCTCATGGTTAGG - Intergenic
1160226390 18:77014611-77014633 AATCTGGGGTATTCATTGGGTGG - Exonic
1160430602 18:78809464-78809486 AGTGTGGGGTCCTCTGAGTGGGG - Intergenic
1160442511 18:78903220-78903242 AACCTGGGGGCCTCAAGGTGGGG + Intergenic
1163188739 19:15659408-15659430 AATCAGGGGTCATTTTAGTGGGG - Exonic
1163216055 19:15878726-15878748 AATCAGGGGTCATTTTAGTGGGG + Exonic
1164705099 19:30313900-30313922 ACTCTGAAGTCCGCATAGTGCGG - Intronic
1166801500 19:45460593-45460615 AATCTGGGCTCATCATTGTCTGG - Intronic
1202638210 1_KI270706v1_random:60032-60054 AATCTGGGGTCTGCATATGGTGG + Intergenic
925388732 2:3481708-3481730 GATCAGTGGTCCTCAAAGTGGGG + Intronic
927212538 2:20647495-20647517 GATGTGGGGTTCTCAAAGTGTGG + Intronic
927699260 2:25257667-25257689 AATCTGGGGTTCTCCTGGCGAGG - Intronic
929939542 2:46322592-46322614 AAGCAGTGGTTCTCATAGTGTGG - Intronic
930067075 2:47335808-47335830 AATTTGGGGTCCTGTTGGTGGGG - Intergenic
931158016 2:59657492-59657514 ATTCTGAGCTCCACATAGTGTGG + Intergenic
934297557 2:91755123-91755145 ACTCTGAGGTACTCATATTGAGG + Intergenic
938933858 2:136111684-136111706 CATTTGGGGTCATCATACTGAGG - Intergenic
939387700 2:141522066-141522088 AATCAGAGGTCCACAAAGTGTGG + Intronic
946447788 2:219754575-219754597 ACTCTGGGGTGCTCAGAGTCAGG - Intergenic
946707340 2:222471325-222471347 AAACTGGGAACCTCTTAGTGAGG + Intronic
947810145 2:232998910-232998932 AATATGGGGTCCTCAGTGGGTGG + Intronic
1175075851 20:56372297-56372319 AATCGGGGGTTCTCAAACTGAGG + Intronic
1180363757 22:11921847-11921869 AATCTGGGGTCTGCATATGGTGG - Intergenic
1182890067 22:33810635-33810657 ACTCTGGGATCCTGATAGTGAGG - Intronic
1183358452 22:37371538-37371560 AATCTGCGGTCCTGAGACTGGGG - Exonic
1183364045 22:37397862-37397884 AGTCTGGGGTCCTCATAACCTGG + Intronic
951520093 3:23603307-23603329 AATCTCAGGCCCTCATAGGGTGG - Intergenic
953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG + Intronic
954388203 3:50255372-50255394 AATCTGGGTTCCTCAGGGGGAGG - Intronic
955193694 3:56785353-56785375 AATCTTGGGTCCTTATAGATGGG + Intronic
955416855 3:58700278-58700300 TATCTGAGGTCCACATGGTGAGG - Intergenic
955779865 3:62472900-62472922 GATCAGTGGTTCTCATAGTGTGG + Intronic
955969055 3:64418945-64418967 AATCTGGGTACCTCAAACTGTGG + Intronic
956016984 3:64894211-64894233 ACTCTGGGGTCATCATAAAGAGG + Intergenic
956245188 3:67175026-67175048 AATCTGGTGATCTCAAAGTGGGG - Intergenic
958462881 3:94420759-94420781 AATCTGGGTGCCTCATTGTTGGG - Intergenic
958638737 3:96778391-96778413 AAACTGGGGTCCACCAAGTGGGG + Intergenic
961626898 3:128270348-128270370 ATAGTGGGGTCCACATAGTGGGG - Intronic
961948485 3:130719929-130719951 ATTCTGGGGCCCTCATTGTAGGG - Intronic
962223936 3:133588745-133588767 AAACTGGGGTCCACCAAGTGGGG + Exonic
966269324 3:178085582-178085604 AAGCTGGTCTCCTCATTGTGAGG + Intergenic
966359140 3:179115411-179115433 AATCTGTGGTTCTCAGAGTGTGG + Intergenic
966389704 3:179439000-179439022 AATCTGTGGTTCTCAGAGTGTGG + Intronic
966465436 3:180226828-180226850 ACTCTGGGGTCCCCAGAGTTTGG + Intergenic
966648609 3:182274083-182274105 AATCAGTGGTTCTCAAAGTGTGG - Intergenic
968936130 4:3611501-3611523 ATTCAGGGGCCCTCATTGTGTGG - Intergenic
969493443 4:7512734-7512756 AAGCAGAGGTCCCCATAGTGAGG - Intronic
971185753 4:24374357-24374379 AACCTTGTGTCCTCATAGTGGGG + Intergenic
971351552 4:25860729-25860751 GATTTGGGGACCTCATGGTGGGG - Intronic
971776731 4:30975976-30975998 AATCTGCAGCCCTCATAATGTGG + Intronic
973729094 4:53805804-53805826 AATCAGGGGTTCTCAAAGTGTGG + Intronic
974794014 4:66725654-66725676 AAGCAGTGGTCCTCAAAGTGTGG - Intergenic
976188880 4:82470113-82470135 AATCTGGGCTTCTCACAGTGTGG - Intergenic
977030117 4:91872964-91872986 AGTCTGGATTCCTCATAGTTGGG + Intergenic
980990789 4:139736649-139736671 AATTAGGGGTTCTCAAAGTGTGG + Intronic
982241542 4:153304647-153304669 AACCTGTGTTCCTCAAAGTGTGG + Intronic
983095631 4:163558166-163558188 AATCGGGGGTCCTCATCATCTGG - Intronic
984778762 4:183505547-183505569 TCTCTGGGGTCCCCAGAGTGGGG + Intronic
1202765545 4_GL000008v2_random:145890-145912 AATCTGGGGTCTGCATATGGTGG + Intergenic
985563657 5:604470-604492 AGGCTGGGCTCCTCACAGTGGGG + Intergenic
985950661 5:3219439-3219461 ACTTTGGGGTCCTCATGGCGAGG + Intergenic
986638270 5:9846353-9846375 ATTCTGGTCTCCTCATAGTCTGG + Intergenic
988340001 5:29959267-29959289 AAACTGGTGTCCTCATTGGGAGG - Intergenic
989829850 5:45902345-45902367 AATATGGGGTCATATTAGTGTGG - Intergenic
991093433 5:62714918-62714940 AGTCAGGAGTCCTCAAAGTGTGG - Intergenic
993775995 5:91996805-91996827 CATCTATGGTCCCCATAGTGTGG + Intergenic
994597798 5:101861034-101861056 ACTCTGGGGACCTTATATTGGGG - Intergenic
995461898 5:112412019-112412041 AATGTGGAGTCCTCATCTTGAGG - Intronic
996111677 5:119573280-119573302 AAGCTGGGCTCCTCATGCTGGGG + Intronic
1001599103 5:172917391-172917413 AGTCATGGGTCCTCAGAGTGGGG + Intronic
1003803687 6:9701310-9701332 AATCTATGGTTCTCAAAGTGTGG - Intronic
1006489916 6:34378589-34378611 CCTCTGGAGTGCTCATAGTGTGG - Intronic
1009345081 6:62604719-62604741 AATCTGGGGTCCTCAAAATTAGG + Intergenic
1019923335 7:4176703-4176725 ACTCTGGGGACCTCATAGAAGGG + Intronic
1021548547 7:21844048-21844070 AATCAGGGGTCCGCAAACTGTGG + Intronic
1022341604 7:29473555-29473577 AAATTGGAGTCCTCAAAGTGTGG + Intronic
1023054389 7:36279825-36279847 TCTCTGCGGTCCTCAAAGTGTGG - Intronic
1026533029 7:71216413-71216435 CATCAGGGGTTCTCAAAGTGTGG - Intronic
1026914617 7:74112362-74112384 CATCTGGGGGCCACAGAGTGGGG + Intronic
1029401404 7:100349151-100349173 ATTCTGGGCTCCCCATATTGGGG + Intronic
1031416269 7:121500087-121500109 AATCAGTGGTTCTCAAAGTGTGG + Intergenic
1033508060 7:142025605-142025627 AATCAGTGCTCCTCAAAGTGTGG + Intronic
1035296654 7:157871189-157871211 AAGCTGTGGTTCTCAAAGTGGGG + Intronic
1040342169 8:46446582-46446604 AATCTGGGAGCCTCCTAGTGAGG - Intergenic
1048977077 8:139679107-139679129 AAACTGGGGTTCTCTTAGTGAGG - Intronic
1050030578 9:1381302-1381324 CATCTGGCATCCACATAGTGTGG + Intergenic
1053257705 9:36632222-36632244 AATCTGTGGTTCTCAAAGTGTGG - Intronic
1053298755 9:36933951-36933973 AAGATGGGGTCCTCACTGTGTGG + Intronic
1058414828 9:104776518-104776540 ATTCTGGTTTCCTCACAGTGAGG - Intronic
1059742496 9:117165597-117165619 ACTTTGGGGTCCTGAGAGTGAGG + Intronic
1060188768 9:121579328-121579350 ACTGTGGGGTCCTCAGGGTGGGG - Intronic
1062093324 9:134689995-134690017 GGTCTGGGGTCCTCGTGGTGTGG + Intronic
1062383454 9:136298720-136298742 ACTCTGGGGACCGCATAGAGTGG - Intronic
1203546291 Un_KI270743v1:130780-130802 AATCTGGGGTCTGCATATGGTGG + Intergenic
1189663579 X:43328814-43328836 ATTCTGGGTTTCTCATATTGTGG - Intergenic
1190107986 X:47572839-47572861 ATTTTGGGGTTCTCAGAGTGGGG + Exonic
1198173759 X:134134241-134134263 ATTCTGGTGTACTCGTAGTGAGG - Intergenic
1201261116 Y:12159935-12159957 AGTCAGGGGTGTTCATAGTGGGG - Intergenic