ID: 1130340836

View in Genome Browser
Species Human (GRCh38)
Location 15:82998367-82998389
Sequence TCTCAGATGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130340826_1130340836 16 Left 1130340826 15:82998328-82998350 CCCAGATGGGGTGGCTGCCGGGC 0: 236
1: 870
2: 3957
3: 4312
4: 3171
Right 1130340836 15:82998367-82998389 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1130340830_1130340836 -1 Left 1130340830 15:82998345-82998367 CCGGGCGGAGAGGCTCCTCACTT 0: 275
1: 2694
2: 8362
3: 5948
4: 4283
Right 1130340836 15:82998367-82998389 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1130340823_1130340836 24 Left 1130340823 15:82998320-82998342 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 1130340836 15:82998367-82998389 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1130340827_1130340836 15 Left 1130340827 15:82998329-82998351 CCAGATGGGGTGGCTGCCGGGCG 0: 278
1: 1047
2: 1380
3: 2469
4: 3112
Right 1130340836 15:82998367-82998389 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130340836 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG Intronic
Too many off-targets to display for this crispr