ID: 1130345688

View in Genome Browser
Species Human (GRCh38)
Location 15:83042784-83042806
Sequence AGTATCTTAGATGATATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130345688 Original CRISPR AGTATCTTAGATGATATACA TGG Intronic
901619778 1:10574490-10574512 AAAAGCTGAGATGATATACATGG - Intronic
905854192 1:41296742-41296764 AGGATATAAGATGATATCCAGGG + Intergenic
909520452 1:76562326-76562348 AGAAGCTGAGATGATAGACAAGG + Intronic
909724190 1:78814046-78814068 AGTATCTTGGATGATAATCTTGG - Intergenic
911683191 1:100742920-100742942 ATTATCTTAGATGCTATATCAGG + Intergenic
915002837 1:152609175-152609197 AGTATCTTAGAAGATCAAGAGGG - Intergenic
917488898 1:175480609-175480631 AGTATTTTACATGACATTCATGG + Intronic
918641623 1:186848011-186848033 AGAATCTTAAATCCTATACAAGG + Intronic
918831371 1:189403585-189403607 AATATCTTAGAAGTTAGACATGG - Intergenic
921800092 1:219392886-219392908 ATTATCTTAGATTATATAAAAGG - Intergenic
921989395 1:221348100-221348122 AGTATTTTAGGTGGTATACCTGG + Intergenic
1063891135 10:10629533-10629555 TTTATCTAAGATGATATAAAGGG - Intergenic
1067766063 10:49088368-49088390 TGTATCTTAGATCACATGCAAGG - Intronic
1068944122 10:62711465-62711487 AATATCTTAGATGACTTCCATGG - Intergenic
1069018495 10:63459753-63459775 AGTATGTTAACTGATATACATGG - Intronic
1071806119 10:89123029-89123051 AGTATCCTAGATTATATAGGTGG - Intergenic
1077483938 11:2830375-2830397 GATATCTTAGATGATCTCCAAGG + Intronic
1077941147 11:6844913-6844935 AGAATCTTAAATGATATAAAAGG - Intergenic
1078980464 11:16526896-16526918 AGTATCTTAGAAGATGTCCGGGG - Intronic
1081140111 11:39488267-39488289 AGTATATTAAATGAAAGACAAGG + Intergenic
1089235844 11:117024452-117024474 ACTATCTTGGAAGATAAACAGGG + Intronic
1089376108 11:117995921-117995943 AGTAGCTCAGATGAGACACATGG + Intronic
1090510739 11:127372069-127372091 AGTTTCTTAGAAGACATAGAGGG - Intergenic
1091767925 12:3133958-3133980 AGTTTCTTTGATTATAAACAGGG + Intronic
1093323234 12:17740035-17740057 AGTATCTTGGATCATATGTAGGG - Intergenic
1093379272 12:18471945-18471967 AGTATCTAATTTGATATAAATGG - Intronic
1094084168 12:26571201-26571223 AAAATCTAACATGATATACATGG + Intronic
1094463582 12:30725928-30725950 AAAATCTTAAATGATATTCATGG - Intronic
1094876655 12:34653678-34653700 AGTATCTGAGAAGAGATATATGG + Intergenic
1097893483 12:64801497-64801519 AGTTTCTTAGTTCATAAACATGG + Intronic
1099772825 12:87084336-87084358 AGTATCTTATATGAAATTTATGG - Intergenic
1100134587 12:91539387-91539409 AATATATTAGATGAAATAAAAGG - Intergenic
1107855785 13:44614320-44614342 AGTATCTTACATCCTATATAGGG - Intergenic
1109962706 13:69652772-69652794 ATTATTTTAGATGAGAAACAAGG - Intergenic
1110594139 13:77300124-77300146 AGCATTTTAGAGGATTTACAAGG - Intronic
1110684043 13:78350956-78350978 AGTATCTTATAAGTTATACAGGG + Intergenic
1110883529 13:80603355-80603377 AGAATTTGAGATGATGTACAAGG + Intergenic
1111847593 13:93530997-93531019 AGTATCTGAGATATTATAAACGG - Intronic
1112852289 13:103721101-103721123 ATTATCTAAGAGGTTATACATGG + Intergenic
1114995633 14:28348546-28348568 AGAATCTTACATGTTATACTAGG - Intergenic
1116135363 14:40916174-40916196 AGGCTCTTAGATCAGATACAGGG - Intergenic
1117024236 14:51603959-51603981 AGTCCCTAAGATGAAATACATGG + Intronic
1119081037 14:71693751-71693773 AGAATCCTAGTTGATATACATGG + Intronic
1119922835 14:78462217-78462239 ACCATCTTAGAAGATATCCATGG - Intronic
1122510462 14:102262735-102262757 AGCATCATAGATGATTTAGATGG - Intronic
1129512001 15:76131065-76131087 AGTATTTTACATGCTACACAAGG - Intronic
1130345688 15:83042784-83042806 AGTATCTTAGATGATATACATGG + Intronic
1134854896 16:17510277-17510299 AGTATCTTGGATGCTGTACTTGG + Intergenic
1135924443 16:26680184-26680206 AGTATCTTATCTGATATAGATGG + Intergenic
1138991955 16:62401275-62401297 AGTATCTAGGAAGATATAGATGG + Intergenic
1141052204 16:80779606-80779628 AGTATATTAGATTTTATACTTGG - Intronic
1141332320 16:83122781-83122803 AGTATCTAAAAAGATATTCAAGG + Intronic
1148289858 17:46435569-46435591 AGAATCTAAGAGGATCTACATGG - Intergenic
1148312026 17:46653141-46653163 AGAATCTAAGAGGATCTACATGG - Intronic
1149248329 17:54738239-54738261 AGTTTCTTAGATGGAAAACATGG - Intergenic
1149474534 17:56948504-56948526 AGTAACATAGATAAAATACAAGG - Intronic
1150436352 17:65157304-65157326 AGCATCTCAGAAGATAGACAAGG - Intronic
1151907414 17:77057519-77057541 AGTAGCTGAGATTATAGACATGG - Intergenic
1152053967 17:78007198-78007220 AGTATTTTAGAGGATATAGAAGG - Intronic
1159523757 18:69561187-69561209 AGTGTCTTAGCTGATAAAGAAGG - Intronic
926454797 2:13054055-13054077 ATTATATTAGATAATATATAAGG - Intergenic
930271939 2:49267570-49267592 AGTATATTTCATAATATACATGG - Intergenic
933223780 2:79721645-79721667 ATTTTATTAGATGATATTCAGGG - Intronic
933414808 2:81973260-81973282 AGTATCCCAGCTGCTATACAAGG - Intergenic
934583172 2:95463847-95463869 AATATCTTGGATTATAAACAAGG - Intergenic
934596278 2:95612867-95612889 AATATCTTGGATTATAAACAAGG + Intergenic
935086075 2:99846458-99846480 AGAATATTAGATCATATAAATGG - Intronic
941598645 2:167510638-167510660 AGTATCAAAGATGATTTTCAGGG + Intergenic
943831713 2:192472339-192472361 AGTGTCTGAGCTGATATCCAAGG - Intergenic
943875016 2:193055788-193055810 AGTATCTGAGTTGATATAGTGGG + Intergenic
944037035 2:195307658-195307680 ATTTTCTTAGCTGATATGCAGGG + Intergenic
944329745 2:198451663-198451685 AGTCTCTTAGATGAGAAATATGG - Intronic
945498126 2:210534824-210534846 AGTAACTTAGATCATCTATAAGG - Intronic
1171322275 20:24256699-24256721 ATTATCTTAGATAATTTTCAGGG - Intergenic
1173049459 20:39545398-39545420 AGGATCTTAGAAGACATGCATGG + Intergenic
1181215691 22:21327839-21327861 TATATCATATATGATATACACGG - Intergenic
952573768 3:34748961-34748983 AGTATCCTAGAGGATACATATGG + Intergenic
953068947 3:39500844-39500866 AGTATCTTAGATCTTATTAAAGG - Intronic
953249643 3:41232868-41232890 AGTATGTCAGATGATATTAAAGG - Intronic
953761464 3:45690427-45690449 GGTATTTTAGCTCATATACAGGG - Intronic
953761783 3:45693983-45694005 GGTATTTTAGCTTATATACAGGG - Intronic
956709266 3:72025491-72025513 AGTGTCTGAGATGGTCTACAGGG - Intergenic
957479729 3:80775974-80775996 AGTATCTTATATTATACTCATGG - Intergenic
960826261 3:121788061-121788083 AGTATAGTAAATGATGTACAAGG + Intronic
962880869 3:139575229-139575251 AGTCTCTGAGATGATCTAGAAGG - Intronic
964546656 3:157841408-157841430 AGCATCTGAGATGAAATTCAGGG + Intergenic
964785700 3:160393742-160393764 AAAATTTTAGATGATAAACAGGG + Intronic
966081682 3:176012066-176012088 AATATCTTTGTTGAGATACAAGG - Intergenic
966438027 3:179910691-179910713 ATTAGCTTAGATGATATCCATGG + Intronic
967294740 3:187953981-187954003 AGGAACTGAGATAATATACAAGG + Intergenic
967647305 3:191941097-191941119 AATATCTTAGATGTTAGACTTGG - Intergenic
973049123 4:45573313-45573335 AGTATGATAGATGAAATATATGG - Intergenic
973895830 4:55411989-55412011 ATTATTTTAGAGGATACACAAGG - Intronic
974175123 4:58311941-58311963 AGTATCTTCAATGAGTTACAAGG + Intergenic
975764566 4:77654288-77654310 AGTTTCTTAGATGATCGTCATGG + Intergenic
976192606 4:82502488-82502510 AGTATCTGAAATGATAAAGATGG + Intronic
978821101 4:112967489-112967511 AGTAACTTAAATGATAAAAATGG + Intronic
980454091 4:133016551-133016573 AATATCTTAGAACATATAAATGG - Intergenic
980719243 4:136672124-136672146 AGGAGCTGAGATGATATGCATGG + Intergenic
980924407 4:139120255-139120277 ATTATCTTACATGACATATAAGG - Intronic
981206644 4:142048748-142048770 AGTATTATACATGATATACTTGG + Intronic
981872187 4:149499620-149499642 GTTATCTTAGATGATAAATAAGG - Intergenic
982098911 4:151949505-151949527 AGTATCTTGGATGATCTGGATGG + Intergenic
983599428 4:169508851-169508873 AGTACATTAAATGATAAACAGGG - Exonic
983902977 4:173156249-173156271 ATTGTCTTAGGTGATGTACATGG - Intergenic
984453480 4:179934952-179934974 ATTATGTTAGATGATGTAAAAGG + Intergenic
987557297 5:19470261-19470283 AGCATCCAAGATTATATACAGGG + Intergenic
993962393 5:94315585-94315607 AGTATGTTAGTCGAAATACAAGG + Intronic
995613237 5:113933452-113933474 AATATCTTAGCTTTTATACAAGG - Intergenic
996247726 5:121284977-121284999 AGTATGTTTGATGTTATACCTGG + Intergenic
1000168712 5:158680307-158680329 AGTCTTTTAGATCATGTACACGG + Intergenic
1000168913 5:158682312-158682334 AGTCTTTTAGATCATTTACATGG - Intergenic
1000587184 5:163114807-163114829 AGTATCTGAGATCTTATACTAGG - Intergenic
1000966768 5:167667020-167667042 AGTGTCTTACATTATTTACAGGG - Intronic
1004987079 6:21094386-21094408 TGGTTCTTAGATCATATACATGG + Intronic
1008186862 6:48403878-48403900 ATTATCTCAAATGATATTCATGG + Intergenic
1008284623 6:49632969-49632991 AGTATCTCAGGGGATATTCATGG + Intronic
1008812687 6:55523648-55523670 TATATCTTATATGATATACTGGG - Intronic
1009631424 6:66205910-66205932 AGGATCTGAAATGATACACAGGG - Intergenic
1011339240 6:86294264-86294286 AGTACCTAATATGATACACATGG - Intergenic
1011506604 6:88051194-88051216 GGTATATTACATGGTATACAAGG - Intronic
1012638320 6:101576573-101576595 AATATCTAAGGTGATACACATGG + Intronic
1012894520 6:104933335-104933357 GGTATCTTAAGTGAGATACATGG - Intergenic
1016466556 6:144331284-144331306 CCTATCCTAGATGATTTACAAGG - Intronic
1024903091 7:54344655-54344677 ATTAAGTTAGATGATATACATGG - Intergenic
1025598678 7:62966173-62966195 AGAATCTGAGAAGAGATACAAGG + Intergenic
1028208436 7:88043936-88043958 AGTATCTTTGATGCTAAAAATGG - Intronic
1028227640 7:88267438-88267460 AGTATCTTAAAAGATATAGGTGG + Intergenic
1028738573 7:94246564-94246586 GCTATCTAAGATGATTTACATGG + Intergenic
1030642686 7:112024106-112024128 TGTATCTTTGAGGAGATACAAGG + Intronic
1030961767 7:115931811-115931833 TGTTTCTTAAATGATATACGTGG + Intergenic
1031280832 7:119797520-119797542 AGTATCGAAGATGCTAGACAAGG + Intergenic
1032123599 7:129174667-129174689 AGTATCTTAGATTATGCAGATGG - Intergenic
1032914944 7:136479229-136479251 AGGATCTCAGATGCTAAACAAGG - Intergenic
1035974798 8:4297286-4297308 AGTATCTTATGTAAGATACAAGG - Intronic
1040929666 8:52720686-52720708 TGTATCTTAGATGCCAGACATGG + Intronic
1045536491 8:103033711-103033733 AGCATCTTATATATTATACAAGG - Intronic
1046105864 8:109665715-109665737 AGTTTCTTAGAATATGTACATGG - Intronic
1047171259 8:122495284-122495306 GGTATATTAAATGATAAACAAGG - Intergenic
1048035590 8:130674296-130674318 AGTATCTTGGAAGATTAACATGG - Intergenic
1049972519 9:833774-833796 AGTATCTCACTTCATATACATGG + Intergenic
1051406182 9:16740039-16740061 AGTATCTCAGGGGATATCCATGG + Intronic
1053456451 9:38236672-38236694 AGTATCTTAGTTGAGAAACCTGG - Intergenic
1054800359 9:69342073-69342095 AGTATTTCAGTTTATATACAGGG - Intronic
1055894037 9:81155217-81155239 ATTATCTTGGATGATATGAATGG - Intergenic
1058384924 9:104424395-104424417 AGTATTTTAGATGATACCTAGGG - Intergenic
1059928051 9:119231722-119231744 AGAATCTTGGATGTTATATAAGG - Intronic
1187121705 X:16414425-16414447 AAGAACTTAGATCATATACATGG - Intergenic
1187351421 X:18521341-18521363 AGTGTGCTAGATGATGTACAAGG + Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187831271 X:23384080-23384102 AGAATGTTAGATGATGTAGAAGG + Intronic
1192817656 X:74611470-74611492 AGTTTATCAAATGATATACAAGG + Intronic
1198162876 X:134025068-134025090 ATTATATGAGATGATATAAAGGG - Intergenic
1201344195 Y:12965213-12965235 AGGATCCTGGATGACATACATGG + Intergenic