ID: 1130346440

View in Genome Browser
Species Human (GRCh38)
Location 15:83051108-83051130
Sequence GAAAAAGGAGGTATGATGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130346437_1130346440 19 Left 1130346437 15:83051066-83051088 CCAAGTTAAACTCAAGCAAGATT 0: 1
1: 0
2: 2
3: 14
4: 157
Right 1130346440 15:83051108-83051130 GAAAAAGGAGGTATGATGATAGG 0: 1
1: 0
2: 0
3: 34
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130346440 Original CRISPR GAAAAAGGAGGTATGATGAT AGG Intronic
902062085 1:13653828-13653850 GAAAAAAGGGGTATCATTATAGG + Intergenic
902799481 1:18820328-18820350 GAAGCAGGAGGAATGATGAATGG - Intergenic
903313842 1:22484613-22484635 GAAATAGAAGGTATACTGATTGG - Intronic
904913740 1:33954497-33954519 GGAGAAGGAGGTATGTTCATAGG + Intronic
904960804 1:34331363-34331385 GAAAAGGGAGGAATGATGGCTGG - Intergenic
905335785 1:37243748-37243770 GTTAAAGGAGGTCTGAAGATGGG - Intergenic
905994573 1:42370274-42370296 GGAAGAGGAGAAATGATGATAGG - Intergenic
907686625 1:56618056-56618078 GAGAAATGTGGTATGATGGTTGG + Intronic
908800125 1:67871501-67871523 GAAAAGGAAGGAATGGTGATGGG - Intergenic
909237433 1:73171534-73171556 AAATAAGGAGATATGATCATGGG - Intergenic
910417010 1:87012142-87012164 GAAAAAGGTGAAATGCTGATGGG - Intronic
911180199 1:94853698-94853720 GAAACAGGAGGTAAGATCATGGG + Intronic
911481252 1:98443847-98443869 TAAAAAGGGGGTATCATTATAGG + Intergenic
913012417 1:114697433-114697455 GAAAAAGGAAATATGTGGATAGG + Intergenic
914832064 1:151177444-151177466 GAAAAAGGAGGCAGGGTGTTGGG + Intronic
915097577 1:153474277-153474299 GAAAATGCAGGTAAGATGAGAGG - Intergenic
915148397 1:153809387-153809409 GAAGAAAGAGGTATGAAGATGGG - Exonic
916016848 1:160757350-160757372 GGAAAAGGAGGTGGGAAGATGGG + Intergenic
916572952 1:166042893-166042915 GGAAAAGGAGGGTTGATGAGAGG - Intergenic
917378140 1:174373355-174373377 CAGAAAGGAGATATTATGATTGG + Intronic
918091323 1:181297554-181297576 AGAAAAGGAAGCATGATGATAGG - Intergenic
918110696 1:181452872-181452894 GAAAAAGGTGGTAGGGTGTTGGG - Intronic
918437245 1:184528294-184528316 GAAAAATGTGTTGTGATGATAGG - Intronic
919126952 1:193406485-193406507 TAAGAAGGAGGGATGATGAAGGG - Intergenic
919516964 1:198537686-198537708 GGGAAAGGAGGCATGATGACAGG - Intronic
919598007 1:199588655-199588677 TGAAAAGGAGGAATGATGAAAGG - Intergenic
920886536 1:209934717-209934739 GAAAAAGGAGGTAAAATAATGGG - Intergenic
921468480 1:215520528-215520550 GAAAAGGGATTTATGCTGATGGG - Intergenic
922595872 1:226812518-226812540 GGAAAAGGAGGGATCATGAAGGG - Intergenic
922959312 1:229632561-229632583 GAAAAAGGATGTAATATTATTGG + Intronic
924304778 1:242676354-242676376 GAAATAGGAAGTATCATGACAGG - Intergenic
1063852526 10:10209216-10209238 AAAAAAGAAGGAATGATGATGGG - Intergenic
1064347085 10:14541892-14541914 GCAATAGGAGGTAAGATGAGAGG - Intronic
1064527288 10:16270449-16270471 GAAAAATTTGATATGATGATTGG - Intergenic
1064803668 10:19106473-19106495 GAAAATGGAGCTATTATGACTGG - Intronic
1065277585 10:24100480-24100502 GAAAAAGGGCCTATTATGATAGG - Intronic
1066146883 10:32569245-32569267 GAAACAGGAGATATCATTATTGG + Intronic
1066405018 10:35110204-35110226 GAACAAGGAGGTATAATTGTTGG + Intergenic
1067843962 10:49703701-49703723 GAGGAAGGAGTTATGATGAGAGG - Intronic
1067899461 10:50223815-50223837 GAACAAGGTGATATGAAGATGGG + Intronic
1069125705 10:64629697-64629719 GAAAAAGGAGTTATTATCACAGG + Intergenic
1069427823 10:68305254-68305276 AAAAAAGGAGGACTGATGAGCGG - Intronic
1070324763 10:75381034-75381056 GAAAAAGAAGGAATGGAGATTGG - Intergenic
1070446576 10:76510463-76510485 GAAAAATGAGCCATGATGATTGG + Intronic
1070861914 10:79675969-79675991 GAATAAGTAGGTAAAATGATGGG + Intergenic
1070875229 10:79798616-79798638 GAATAAGTAGGTAAAATGATGGG - Intergenic
1071049318 10:81427501-81427523 GAAGAAGGAGGTAAGATGTTAGG - Intergenic
1071642158 10:87320789-87320811 GAATAAGTAGGTAAAATGATGGG - Intergenic
1071976641 10:90962440-90962462 GAAAAAGGCAGTATGAGTATTGG + Intergenic
1072002078 10:91206241-91206263 GAAAAAGCAGGTTTGATTAAAGG + Intronic
1073997486 10:109332581-109332603 GATAAAGGAGAGAGGATGATAGG - Intergenic
1074141288 10:110675283-110675305 AAAAAAATAGGTAGGATGATGGG + Intronic
1074997531 10:118770675-118770697 GAAGAAGGAGGTTAGCTGATGGG - Intergenic
1076238708 10:128886091-128886113 GAAAAAGGAGGGATGAGTGTGGG - Intergenic
1076581260 10:131513490-131513512 GAAAATGGAGGTTTGGTGATCGG - Intergenic
1078756731 11:14218238-14218260 GGAGAAGGAGGTATGATATTTGG - Intronic
1079222280 11:18573682-18573704 GCAAAAGGAGGTATCATGGTGGG + Intronic
1079348384 11:19672499-19672521 CATAAAGGGGGTATCATGATAGG + Intronic
1081248941 11:40805188-40805210 GAAAAAGGATGTTTGCTGAGTGG + Intronic
1081455559 11:43219059-43219081 GAAAGAGGAGGGATGGTGGTGGG - Intergenic
1081688100 11:45056619-45056641 GCAAATGGAGGTCTGAGGATGGG - Intergenic
1082197911 11:49325895-49325917 GAAGAAGGAGGAATGATGGGTGG + Intergenic
1083479521 11:62934564-62934586 GAAACAGGAGGTAAGAAGAAAGG - Intergenic
1084762056 11:71280183-71280205 GGAAAAGGAGGCATGATGGGAGG - Intergenic
1085633373 11:78138649-78138671 GAAAAAAGAGGAAGGATGAAGGG + Intronic
1087539071 11:99491769-99491791 GACAAAGCAGCTATGATCATAGG - Intronic
1087738447 11:101860484-101860506 GAAAAAGTAGGTGATATGATAGG - Intronic
1087913611 11:103781948-103781970 GTAAAAGAAGGTATGAAGCTAGG + Intergenic
1088539705 11:110901141-110901163 GAAAAAGGAGGGGACATGATGGG - Intergenic
1088920139 11:114254706-114254728 GAAGGAGGAGGTATGATGGGAGG - Intergenic
1090764943 11:129868458-129868480 GAAACAGGAGGCGTGCTGATGGG + Intronic
1093321057 12:17715978-17716000 GAAAAAGGAAGAAGGAAGATAGG - Intergenic
1093537581 12:20240419-20240441 GAAAAAGGAGGCGTAATGGTGGG + Intergenic
1094417042 12:30228041-30228063 GAAAATGTAGGTAAGATTATGGG - Intergenic
1097845080 12:64358040-64358062 GTAAAAGGAGGGATGATGACAGG + Intronic
1098394114 12:70000423-70000445 GAAAAAGAAGGTAACATGAGAGG - Intergenic
1098980484 12:76950785-76950807 GAACAAGTAGGTTTGATGAATGG - Intergenic
1099824816 12:87761524-87761546 AAAAAAGGAGGTGAGAAGATGGG + Intergenic
1100012780 12:89973248-89973270 GAAAATGGAGGTGGGATGGTGGG + Intergenic
1101100177 12:101383615-101383637 AACAAAGGAGCTATGATCATTGG - Exonic
1101423913 12:104571742-104571764 GAAAAAGGAGCTATTAGGAGTGG + Intronic
1102052107 12:109870168-109870190 GAAAAAGAAGGTATTAGGCTGGG + Intronic
1102822634 12:115921315-115921337 CAAAAAGGAGACATGATGATTGG + Intergenic
1103327337 12:120130314-120130336 GAAAAGAGAGGTATTAAGATGGG + Intronic
1103812804 12:123629205-123629227 GCAAAAGGACGTATGCTGGTGGG + Intronic
1106160183 13:27194509-27194531 GAAAAAGGAGATGAGATGGTAGG - Intergenic
1106846328 13:33741600-33741622 GAAGAAGGAGGTATCAGGAATGG - Intergenic
1106852097 13:33804880-33804902 GAAAAAGGAGGGATGCTGAGAGG - Intergenic
1107019034 13:35732613-35732635 TAAAAAGGAGGTCTAATTATTGG - Intergenic
1107781323 13:43905892-43905914 GAAATAAGAGGTAGGATAATAGG - Intergenic
1108896078 13:55330568-55330590 GAAATAGGAGGGATAATGAGAGG + Intergenic
1109797101 13:67329797-67329819 AAAAATGTAGGTATGAGGATGGG - Intergenic
1110084884 13:71365332-71365354 GAAAAAGGCTGTATTGTGATTGG - Intergenic
1110200975 13:72850434-72850456 GTGAAAGGAGGTATGATTAGCGG - Intronic
1111350814 13:87028465-87028487 GAAATACGTGATATGATGATTGG + Intergenic
1111682263 13:91458315-91458337 GAAACAGGAGTTTTTATGATAGG + Intronic
1111734658 13:92122520-92122542 GAAAAAGCATATATGATGGTTGG - Intronic
1113237432 13:108295042-108295064 GAAAATGGAGGTATTATTAATGG - Intronic
1113405426 13:110034458-110034480 GAAAGAGGAGGTTTGATGAAGGG + Intergenic
1115682886 14:35761392-35761414 GTAAAAGGAGGAATGGTTATGGG + Intronic
1116298544 14:43144389-43144411 AAAAAAGGAGGTATAATAATTGG - Intergenic
1116689818 14:48091118-48091140 GAGAAAGGAGGTGTGATGTAAGG + Intergenic
1117053245 14:51883569-51883591 TAAAAAGGAGGTTTCATGTTTGG + Intronic
1117553189 14:56856709-56856731 TAACAAGAAGGTATAATGATTGG - Intergenic
1117609911 14:57472281-57472303 GAAAGAGGAGGAACGGTGATGGG - Intronic
1120811236 14:88805862-88805884 GAAAGAGGAGATGTGATAATTGG + Intergenic
1121205334 14:92160261-92160283 AAAAATGGAGGTATGACTATTGG - Intronic
1122069001 14:99193570-99193592 GAAAAAAGAGGTAAGAGGATTGG - Intronic
1123431862 15:20224794-20224816 TAAAAAGGAAGTAAGATGGTTGG - Intergenic
1123673750 15:22687991-22688013 GAAAAAGCATATATGATGGTTGG - Intergenic
1124325753 15:28760982-28761004 GAAAAAGCATATATGATGGTTGG - Intergenic
1125249995 15:37690238-37690260 GTAGAGGGAGGTATGATGAAAGG - Intergenic
1125347915 15:38738147-38738169 GAAATAAGAGGTATAAAGATTGG + Intergenic
1125633707 15:41169681-41169703 GAACAAGGAAGTGAGATGATCGG - Intergenic
1128548890 15:68584998-68585020 CAAAAAGGAGGGATGAGGAAGGG - Intronic
1128996533 15:72300892-72300914 GAAAAAGAAGCAATTATGATAGG + Intronic
1130346440 15:83051108-83051130 GAAAAAGGAGGTATGATGATAGG + Intronic
1131326484 15:91452074-91452096 GGAAAAGGTGGTATTGTGATGGG + Intergenic
1131531209 15:93193711-93193733 ACAAAAGGAGGTATAGTGATTGG + Intergenic
1133337532 16:5015662-5015684 GAAGAAGGAGGAAGGATGCTGGG + Exonic
1134611790 16:15614931-15614953 GAAAAATCAGGCATGATGGTGGG - Intronic
1134647982 16:15885860-15885882 GACAAAGCAGTTATGATCATGGG + Intronic
1135833990 16:25806364-25806386 GAAAATGGAGGCACGAGGATTGG - Intronic
1136852777 16:33626345-33626367 TAAAAAGGAAGTAAGATGGTTGG + Intergenic
1137346133 16:47661904-47661926 GAAAAAGAAGGTTTAATGAAAGG - Intronic
1138266981 16:55666654-55666676 AGAAAAGGAGGGAAGATGATGGG - Intronic
1139312216 16:66037153-66037175 GACACAGGAGGAATGCTGATGGG + Intergenic
1139330505 16:66185740-66185762 GAAACAGGAGGTATAAGGATTGG - Intergenic
1139831140 16:69799290-69799312 GCAAAAGTACGTATGATGAAGGG + Exonic
1140073311 16:71672122-71672144 GAAAAAGGAGAAAGGATGAATGG - Intronic
1140278287 16:73530638-73530660 GAAAATTGAGGAATGTTGATAGG - Intergenic
1141773377 16:86105207-86105229 GAAACAGGAGGAATGAAGATTGG + Intergenic
1142417798 16:89952558-89952580 GAAGAAGGAGGAGTGATGTTGGG + Intronic
1203114379 16_KI270728v1_random:1474813-1474835 TAAAAAGGAAGTAAGATGGTTGG + Intergenic
1142908762 17:3069093-3069115 GAATAAGGAGGTCTGAGGAAAGG + Intergenic
1142925805 17:3235152-3235174 GAATAAGGAGGTCTGAGGAAAGG - Intergenic
1143177772 17:4966517-4966539 GAGAAAGGAGGAAGCATGATGGG - Intronic
1144182800 17:12768556-12768578 GAAAAGGGGAGTATAATGATGGG + Exonic
1145105470 17:20111755-20111777 GAAAAAGGTGGGAGGAGGATCGG + Intronic
1146542785 17:33712007-33712029 GAGAAAAGGGGGATGATGATTGG - Intronic
1149400149 17:56287677-56287699 GAAAAAAGATCTAAGATGATTGG - Intronic
1151050959 17:70978402-70978424 GAAAAAAGAGGGATGGGGATGGG + Intergenic
1152841451 17:82571303-82571325 GAAAAATGAGGTATCAGGCTGGG + Intronic
1153166620 18:2268942-2268964 TACCAAGGAGTTATGATGATGGG - Intergenic
1153423389 18:4934278-4934300 GAAAAGTGAGGTATCATGATGGG + Intergenic
1155026623 18:21946468-21946490 AGAAAAAGAGGCATGATGATGGG - Intergenic
1156028859 18:32689553-32689575 GAAAGTGGAGGTAAGAGGATAGG + Intronic
1156553542 18:38042853-38042875 GAAAAAGGAGGTAAGGAGAGAGG - Intergenic
1156565979 18:38191349-38191371 GAAATAAAAGGTATGCTGATTGG + Intergenic
1156652300 18:39238634-39238656 GAAAATGGAGGTATTAAAATAGG + Intergenic
1156832799 18:41515051-41515073 GAAAAGGGAGGTATCATTTTAGG + Intergenic
1157468184 18:47966615-47966637 GAAAAAGGAGATGTGTTGCTTGG - Intergenic
1157500917 18:48190084-48190106 GAAGAGGGACGGATGATGATAGG - Intronic
1157532687 18:48435012-48435034 GAAACAGGAGGTTTCATGATTGG + Intergenic
1158088417 18:53681844-53681866 GAAAAAGGAGAAATGATTACTGG + Intergenic
1158339425 18:56449382-56449404 GACAAAGGAGGAATAATGAAAGG - Intergenic
1158367898 18:56760285-56760307 GAAGAGGAAGGTATGATGATTGG - Intronic
1158405495 18:57156020-57156042 GAAAAATGTGGTTTTATGATTGG - Intergenic
1159907725 18:74112680-74112702 GAAATAGAAGGTATCCTGATTGG + Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
925589493 2:5495308-5495330 GAAGAAAGAGGAATGTTGATAGG - Intergenic
927050831 2:19326953-19326975 GAAACAAGAGGTATTTTGATAGG - Intergenic
928042801 2:27895304-27895326 GACTAAGGAGACATGATGATTGG - Intronic
931393833 2:61868181-61868203 GGAAAAGGAATTAGGATGATAGG + Exonic
932294142 2:70610219-70610241 GAAACAGGGGGTATGAAGCTAGG - Intronic
932923826 2:75947129-75947151 GAAAAAGGAGGCATGAACCTAGG + Intergenic
938285121 2:130106600-130106622 GAAAAAGTAGGTATGATTTAAGG - Intronic
938335767 2:130495149-130495171 GAAAAAGTAGGTATGATTTAAGG - Intronic
938430482 2:131232292-131232314 GAAAAAGTAGGTATGATTTAAGG + Intronic
939230013 2:139412416-139412438 GAGAGAGGAGATATGATGATGGG + Intergenic
940397975 2:153214434-153214456 GCAAAAAGAATTATGATGATGGG - Intergenic
940624160 2:156151134-156151156 GAAGAAGGCAGTGTGATGATGGG + Intergenic
941554844 2:166964802-166964824 GAAAAAAGAGGTATATTGAGTGG - Intronic
942046780 2:172103698-172103720 GAAAAAGGAAATAGGATAATAGG + Intergenic
942633026 2:177972568-177972590 CAAAAAGGATGTTTTATGATAGG + Intronic
943766190 2:191664993-191665015 GAAATGGGATGTATGATGCTTGG + Intergenic
943828118 2:192422087-192422109 GAGATAGGAGGTGTGATAATTGG + Intergenic
943859471 2:192842487-192842509 GAAAAAGGTGATATAATGATAGG + Intergenic
944153726 2:196589973-196589995 GAAATAGGAGGAAGGAAGATAGG - Intronic
944369450 2:198964546-198964568 GAAAAACGTGGTATAATTATTGG - Intergenic
946300180 2:218818656-218818678 GAGAAAGGAGCTAAGCTGATGGG + Intergenic
946369303 2:219270910-219270932 GAAAAGAGGGGTATGATGGTGGG - Intronic
1169632607 20:7649617-7649639 GAAATGGGAAATATGATGATAGG + Intergenic
1172191468 20:33064389-33064411 GAAATAGGGGCTATTATGATTGG + Intronic
1172551956 20:35807989-35808011 GAAAAAGGAGATAATATGAAGGG + Intronic
1172968464 20:38856156-38856178 GAAGAAGCAGGTAAGGTGATGGG + Intronic
1173399641 20:42713057-42713079 GAAAAAGAAGATAATATGATGGG + Intronic
1173416044 20:42856836-42856858 GAAAGAAGAGGGATGAAGATAGG + Intronic
1173871441 20:46344517-46344539 AAAAGAGGAGGTATCCTGATAGG - Intergenic
1173932845 20:46836048-46836070 CAAAGAGGAGGTGAGATGATGGG - Intergenic
1174020864 20:47527162-47527184 GAAAAAAAAGGTATGCTGACTGG - Intronic
1174548617 20:51344926-51344948 GGAAAATGAGGCAGGATGATGGG - Intergenic
1177471577 21:21566593-21566615 GAAAAATCAATTATGATGATGGG - Intergenic
1177944891 21:27455822-27455844 GAAAAAGGAGATAAGAAAATGGG - Intergenic
1178803319 21:35817483-35817505 CAAAAAGGAGGTCTGGTGTTTGG - Intronic
1179263491 21:39779861-39779883 GAAACAGGAGGTAGAATGGTGGG + Intronic
1181928671 22:26381231-26381253 GAAAAAGGAGGTGCCATGTTTGG + Intronic
1182006642 22:26965826-26965848 GAAAAAGGAAGGATGATAATAGG + Intergenic
1184999418 22:48235315-48235337 GAAAAAGGAGGGATAATGAATGG - Intergenic
949157069 3:841717-841739 GCAAAAGGAGCTTTGAAGATGGG + Intergenic
949621280 3:5814494-5814516 GAAAAAAGAGGTAATTTGATTGG - Intergenic
949627475 3:5883407-5883429 AAAAAAGGAGACATCATGATGGG + Intergenic
952080666 3:29753735-29753757 CAAAAAGGAAATATGATTATGGG - Intronic
952243153 3:31555088-31555110 CAAAAACCAGGTATGCTGATGGG - Intronic
952916865 3:38253031-38253053 GGAAAAGGAGGAATGATGGCAGG - Exonic
955515583 3:59723291-59723313 GAGAAAGTAGGTATGTTTATTGG + Intergenic
955747629 3:62155814-62155836 GAAGGAGGAGGTATGAGGCTTGG + Intronic
955773500 3:62409622-62409644 AGAAGAGGAGGTAGGATGATAGG - Intronic
957662687 3:83182045-83182067 GTAGAAGCAGGTCTGATGATGGG - Intergenic
958686547 3:97405386-97405408 GAAACAGAAGGTATGAGGCTAGG - Intronic
958990712 3:100841239-100841261 GAAAAAGAAGCTATAAAGATTGG + Intronic
959627672 3:108471136-108471158 GAAAAAGGAGGAAAGGAGATGGG + Intronic
959918530 3:111845785-111845807 GAAAAGAGAGGTACCATGATTGG - Intronic
960884319 3:122379132-122379154 AAAAAGGGAGGTAAAATGATTGG + Intronic
961437414 3:126928944-126928966 GAAATGGGAGGTGTGAGGATGGG - Intronic
961577701 3:127851619-127851641 GAAAAAGATGATATGATGAAGGG + Intergenic
962491821 3:135901943-135901965 GAAAATAGAAGTATGATCATGGG + Intergenic
962922452 3:139963385-139963407 GGAAAAGGAGGTAATGTGATTGG - Intronic
962994645 3:140613676-140613698 GAAAAATGCGGTGTGCTGATTGG - Intergenic
964303725 3:155318338-155318360 GGAAAAGGGTGAATGATGATTGG + Intergenic
964318182 3:155465902-155465924 GAAAAAGGAGGGAAGAGGAGTGG + Intronic
964553221 3:157908392-157908414 GAAATAGGAGGTAGGATGTAGGG - Intergenic
965523524 3:169692600-169692622 GGAAAATGAGATATGTTGATTGG + Intergenic
967110160 3:186286002-186286024 GAGAAAGCAGGCATGATGAAGGG - Intronic
969739671 4:9015285-9015307 GGAAAAGGATGTGTGATGAAAGG + Intergenic
970310263 4:14775607-14775629 GAAGAAGGAGGTTTGAAGTTTGG - Intergenic
970934004 4:21546932-21546954 TAAAGAGAAGGTATGATAATAGG + Intronic
971546079 4:27889287-27889309 GAAAAAGGAAGAAAGATGAAAGG - Intergenic
971712921 4:30140129-30140151 GTAAAAAGAGGTATTATGAATGG + Intergenic
971933893 4:33121606-33121628 AAAAAAGTATGTAAGATGATAGG - Intergenic
976038546 4:80854764-80854786 GAAAAAGAAACTATGATGACTGG - Intronic
976110040 4:81662838-81662860 GAGTAAGGAAGTATGCTGATTGG + Intronic
976545545 4:86331136-86331158 GAAAAGGGAAGTATGAGGACAGG + Intronic
976647002 4:87397144-87397166 GAAACAGGAGGCCTGATTATGGG + Intergenic
976798899 4:88965703-88965725 GAAAAAGGAGATATGTTTAATGG - Intronic
977270170 4:94908518-94908540 GAAAAAGAAGAGATGTTGATAGG - Intronic
978277371 4:106968045-106968067 GAAAACGGAGGAATGAAGAAAGG + Intronic
979483665 4:121246898-121246920 CAAAGAGGAGGTATGCTGAAGGG + Intergenic
980952875 4:139398990-139399012 GAATAAGGAGGTTTGAGGAGAGG + Intronic
981203980 4:142017263-142017285 GAAAAAGGAAGAAAGATCATGGG + Intergenic
985215391 4:187647938-187647960 GAAAAAGTAGGTATGAGGTGAGG + Intergenic
985340228 4:188943538-188943560 GAAAAGGGAGGAATGAGAATTGG + Intergenic
987545680 5:19308107-19308129 GAAGAGGGATGTGTGATGATGGG + Intergenic
988058307 5:26130968-26130990 GATGAAAGAGGTATGCTGATCGG + Intergenic
988620012 5:32813342-32813364 GAAAAAGGAGATTTGTTGAATGG - Intergenic
992348925 5:75909698-75909720 GAAAAAGGAGTTAAAATGAAAGG - Intergenic
994345405 5:98679738-98679760 GAAAAATGATGAATGATGCTGGG + Intergenic
994735803 5:103554336-103554358 GAAAAATCAGGAAGGATGATAGG + Intronic
994808621 5:104484079-104484101 GAAAAAGGAGGTTTCTTGCTAGG - Intergenic
995251234 5:109995387-109995409 GAAAAAAGAGGAATGATTTTTGG + Intergenic
999426052 5:151488515-151488537 GAAGGAGGAGGCATGATGAGGGG - Exonic
999598540 5:153234099-153234121 GGAGAAGGAGGTGGGATGATAGG - Intergenic
1000616628 5:163434836-163434858 GGAGAAGAAGGTATGAGGATAGG + Intergenic
1001099743 5:168804383-168804405 GAAATAGGAGGAATGATGGAAGG + Intronic
1002313099 5:178326621-178326643 GAAAAAGGAGGTCTGAGGGAGGG - Intronic
1002558977 5:180067737-180067759 GAAAAAGGATATATGATCATGGG - Intronic
1004125686 6:12870733-12870755 GGAAATGGAAGTATGAGGATGGG - Intronic
1004691747 6:17998159-17998181 GAAACAGAAGGTAGGATCATAGG - Intergenic
1004820714 6:19365242-19365264 GAAAAAGGAGACATGGTGGTGGG - Intergenic
1005285890 6:24326559-24326581 TAAAAAGCATGTATGATGAGCGG + Intronic
1005475876 6:26207325-26207347 TAAAAAGCAGGTATTATGACTGG + Intergenic
1005811933 6:29523435-29523457 GAAAAAGAAGATAAAATGATTGG - Intergenic
1006973904 6:38078496-38078518 CAAAAAGCATTTATGATGATTGG + Intronic
1006979556 6:38136056-38136078 AAAAATGGAGGTGTGATGGTGGG + Intronic
1007242127 6:40433797-40433819 GAAGAAGGAGGTGTGATGGGAGG + Intronic
1007275852 6:40673097-40673119 GAGAAAGAAGGTAGGATGATGGG - Intergenic
1007419228 6:41709507-41709529 GAAAAAGTAGATATAATGGTTGG + Intronic
1007776443 6:44226925-44226947 GAAGGAGGAGGAAAGATGATGGG - Intronic
1008402492 6:51079744-51079766 GGATAAGGAGATATGATGACTGG + Intergenic
1009248281 6:61267553-61267575 GAAAAAGGAGGCAGGAAGAGAGG + Intergenic
1012987927 6:105895031-105895053 GAAAAAGAAGCAAAGATGATTGG + Intergenic
1013068316 6:106704901-106704923 GAAAAACTAGGAATGTTGATGGG - Intergenic
1013643068 6:112107111-112107133 GAAAAAGTAGGTAAGAAGTTTGG - Intergenic
1014131262 6:117836928-117836950 AAAAAAGGAGGTGTGAAGAAAGG - Intergenic
1014382910 6:120766198-120766220 CATAAAGGAGTTATGATGGTAGG + Intergenic
1014399572 6:120971057-120971079 GAAAAAGCAGGTGTGTTGACCGG + Intergenic
1014920570 6:127210788-127210810 AAAATAGCAGGTGTGATGATAGG + Intergenic
1016299555 6:142614946-142614968 GCAGAAGGAGGTGTGATGATGGG - Intergenic
1016466152 6:144327525-144327547 GAAAAAAGAGCTTTGATGAGAGG - Intronic
1017293843 6:152771871-152771893 GAAACAGGAGATACTATGATGGG + Intergenic
1017598989 6:156060578-156060600 GTTAAAGAAGGAATGATGATGGG - Intergenic
1017600402 6:156074314-156074336 GAAAACTGAGGATTGATGATAGG - Intergenic
1018634952 6:165852983-165853005 GGAAAAGCAGGTATGATCATCGG - Intronic
1018969272 6:168514864-168514886 GACAAAGGAGGGAGGATGGTTGG + Intronic
1020704072 7:11520856-11520878 GAAAAAGTAAGTTTGATGACAGG + Intronic
1021196348 7:17678765-17678787 GAAAATGCAGGTCTGATGCTCGG + Intergenic
1021214369 7:17898814-17898836 GTAAAAGAAGGTATGATTAATGG - Intronic
1021323974 7:19244480-19244502 AAAAAAGGGGGAATAATGATTGG + Intergenic
1021547989 7:21837569-21837591 GTAAAAGGAGGGAGGATGGTGGG + Intronic
1021607991 7:22428512-22428534 GAGAAAGGAGGAAAGATGAACGG + Intronic
1022425464 7:30264805-30264827 AAAAAAGGATTGATGATGATGGG - Intergenic
1022702792 7:32777263-32777285 GAAATAGGAGGTACAATGAGAGG - Intergenic
1023047666 7:36224951-36224973 GAAGAAGGAGATGTGATGATAGG + Intronic
1023860256 7:44214038-44214060 GAAAATGGAGGTATGAATTTGGG + Exonic
1024484094 7:49896692-49896714 AAAATAGGAGGTATGATTACAGG + Intronic
1027917646 7:84346555-84346577 GAATAAGGAGGTCTGAGGAAAGG + Intronic
1028916353 7:96263586-96263608 GAAACAAGAGGTATGCTGAGTGG - Intronic
1028931519 7:96418435-96418457 GAAAAAGTAGATTTGATGACTGG + Intergenic
1030476494 7:110040285-110040307 CATAAAGGAGGTATTAGGATTGG - Intergenic
1031648743 7:124259768-124259790 GAAAAGGTAGATATGAAGATGGG + Intergenic
1031901733 7:127418417-127418439 GAGAAAGGAGGGATGAAGAGAGG + Intronic
1032705433 7:134417698-134417720 TGAAAAGGAGGTATGAGAATGGG - Intergenic
1034021453 7:147647892-147647914 GAAAATTGAGGTATGGTGAATGG + Intronic
1035214179 7:157352475-157352497 GAATGAGGTGGTATGAAGATGGG + Intronic
1035866506 8:3089020-3089042 GAAAGAAGAGGTATGTTGAGGGG - Intronic
1036025940 8:4909308-4909330 GTAAAAGGAGGTATTTTGCTGGG - Intronic
1037648019 8:20811380-20811402 GAAAAGGGAGGAATGGGGATGGG - Intergenic
1040451162 8:47548666-47548688 GAAAAAGTAAGAATGATGAAAGG + Intronic
1040867022 8:52058268-52058290 GAAAATGGATTTTTGATGATTGG + Intergenic
1040889442 8:52301803-52301825 AAAAAAGGAGGAAGGATGAAAGG - Intronic
1040956717 8:52987538-52987560 GGGAAAGGAGGGATGATGAAAGG - Intergenic
1041572707 8:59355405-59355427 GAGAAGAAAGGTATGATGATAGG + Intergenic
1042621042 8:70704495-70704517 AATGAGGGAGGTATGATGATTGG + Intronic
1044078944 8:87860103-87860125 GAAAAAAGAGGTAATATGAAAGG + Intergenic
1044760190 8:95509855-95509877 GAGAATGGAGGTATGAAGTTTGG + Intergenic
1045805088 8:106149855-106149877 AATAGAGGAGGTATGAAGATAGG + Intergenic
1047131435 8:122024856-122024878 TAAGAAGGATGTATGTTGATTGG - Intergenic
1048126576 8:131642170-131642192 GAAAAGGGAGGAATGATGTAGGG - Intergenic
1050454066 9:5815864-5815886 GGAAAAAGAACTATGATGATGGG + Intronic
1051860433 9:21618799-21618821 GAAAAAGAGGGTATTATGAAGGG - Intergenic
1051924343 9:22305570-22305592 CAAAAAGCAGGTAAGATGTTTGG + Intergenic
1052109047 9:24557389-24557411 GAAAGAGGAGAAATGATAATAGG + Intergenic
1053580532 9:39399408-39399430 GAAAGAGGAAGGATGATGAGAGG - Intergenic
1053845028 9:42227486-42227508 GAAAGAGGAAGGATGATGAGAGG - Intergenic
1054102119 9:60958213-60958235 GAAAGAGGAAGGATGATGAGAGG - Intergenic
1054584240 9:66948650-66948672 GAAAGAGGAAGGATGATGAGAGG + Intergenic
1054863878 9:69980124-69980146 GAAAGTGGAGGTATCACGATGGG - Intergenic
1058727776 9:107819604-107819626 GGAAAAGGGTGTATGATCATAGG - Intergenic
1059678096 9:116559534-116559556 GAAGTAGGAAGTATGATGATGGG + Intronic
1059989949 9:119855491-119855513 GCCATAGGAGGTGTGATGATGGG + Intergenic
1060310145 9:122452424-122452446 GCAAGAGGAGGTATGTTTATGGG - Intergenic
1062680395 9:137776085-137776107 AAAAAAGGATGTTTGAAGATGGG - Intronic
1185517095 X:708259-708281 GAAAATGGAGGAATGAAGGTAGG - Intergenic
1186361686 X:8848956-8848978 GAAAAAGAAGACATAATGATGGG + Intergenic
1186759572 X:12709321-12709343 GAAAAAGCAGATATGAAGAGAGG - Intronic
1187714956 X:22093401-22093423 GAAAAGAGAGGAACGATGATAGG - Intronic
1188895708 X:35665878-35665900 GAAAAAAGAGGTAGGAGGATAGG - Intergenic
1190401675 X:50042453-50042475 GAAGTAGGAGGTATCATTATTGG + Exonic
1191742027 X:64446540-64446562 CAGAAAGCAGGTATGATGATAGG + Intergenic
1191914936 X:66191405-66191427 GAAACTTGAGGTATGATGAAGGG - Intronic
1192267045 X:69546132-69546154 AATAAAGGAGACATGATGATAGG + Intergenic
1194198805 X:90930324-90930346 GGAATAGAAGGTAGGATGATGGG - Intergenic
1194322250 X:92463038-92463060 CCAAAAGGAGTTATTATGATTGG + Intronic
1195806279 X:108770780-108770802 GAAATAAAAGGTATTATGATTGG + Intergenic
1196134447 X:112192230-112192252 GAAATAGGAGTTATGTAGATTGG - Intergenic
1196185732 X:112743151-112743173 GAAAAATGAGGCATGGAGATAGG - Intergenic
1196636888 X:118012476-118012498 GGAAAAGGAGATGTGATGATGGG - Intronic
1197427911 X:126321069-126321091 GCAAAAGGAAGAATGATAATTGG + Intergenic
1199480711 X:148295910-148295932 GAAAAAGGCTGTATCATTATAGG + Intergenic
1200544802 Y:4506746-4506768 GGAATAGAAGGTAGGATGATGGG - Intergenic
1200630407 Y:5576515-5576537 CCAAAAGGAGTTATTATGATTGG + Intronic
1200807953 Y:7451918-7451940 GAAAAAGGAGAAATGAGGTTGGG - Intergenic
1201241687 Y:11963052-11963074 TAAAAAGTAGGTATGTTGATAGG + Intergenic
1201894293 Y:18977165-18977187 GAAAAAGGAGGCCTGATGAATGG + Intergenic