ID: 1130348017

View in Genome Browser
Species Human (GRCh38)
Location 15:83066898-83066920
Sequence GGTCGCGGCGCCGCCGCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130348017_1130348023 26 Left 1130348017 15:83066898-83066920 CCAGCGGCGGCGGCGCCGCGACC 0: 1
1: 0
2: 4
3: 59
4: 319
Right 1130348023 15:83066947-83066969 TCAGCAGCTCCGAGTTGAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 115
1130348017_1130348024 30 Left 1130348017 15:83066898-83066920 CCAGCGGCGGCGGCGCCGCGACC 0: 1
1: 0
2: 4
3: 59
4: 319
Right 1130348024 15:83066951-83066973 CAGCTCCGAGTTGAAGAGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130348017 Original CRISPR GGTCGCGGCGCCGCCGCCGC TGG (reversed) Exonic
900109377 1:999139-999161 GCTCGCGCCGCCGCTGCTGCCGG - Exonic
900117279 1:1034041-1034063 GGACCCGGCGCGGCCTCCGCAGG + Intronic
900135703 1:1116097-1116119 GGGCGCGGCGCCACCGCCTGAGG - Exonic
900249299 1:1658929-1658951 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
900349560 1:2228188-2228210 GGCCGCGTCGCGCCCGCCGCCGG - Intergenic
900786927 1:4655223-4655245 GGCCGGCGCGCCGCCGCCGTTGG - Exonic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
901272289 1:7961753-7961775 GGCCGGGGCGCCGCGTCCGCAGG + Intronic
902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG + Intronic
902793384 1:18784417-18784439 GGGCTCGGCGCCGCGGCCGACGG + Intergenic
903016786 1:20366680-20366702 GGTCGCGGCGCGGCGTCCGCGGG - Intergenic
903476017 1:23619640-23619662 GGTGGCGGCGTCGGCGCGGCGGG + Intronic
904181396 1:28668986-28669008 GTGCGTGCCGCCGCCGCCGCCGG + Intronic
904199789 1:28812278-28812300 GGCCGCGGCCCCGACGCCGCCGG - Exonic
904769085 1:32870961-32870983 GGGCGGGGCGCCCCCGCTGCGGG + Intronic
905223406 1:36464290-36464312 GGCCGCGGCGCGGGCCCCGCGGG - Exonic
905569332 1:38991446-38991468 GGGCGCAGCGCCGCCGCTTCGGG - Exonic
905648287 1:39639709-39639731 GGTGGCGGCGCCCCCGAGGCGGG - Exonic
906365421 1:45205971-45205993 GGCCCCGGCGCCGGCGCTGCTGG - Exonic
906614591 1:47225673-47225695 TCTCGCGGCGCCGCCCCCACCGG + Exonic
907429936 1:54405913-54405935 AGTGGCGGCCGCGCCGCCGCCGG - Intronic
908131842 1:61082375-61082397 GCTCGCGCCGCCGCCGCGGGGGG - Intronic
914902360 1:151717486-151717508 GGCCGCGGAGGCGGCGCCGCGGG + Intronic
915070490 1:153261674-153261696 GCTCCCGCCGCCCCCGCCGCTGG - Exonic
918423702 1:184387508-184387530 GGTCGTGGCGCTGCCTGCGCGGG + Intronic
919847042 1:201648817-201648839 GGCCATGCCGCCGCCGCCGCCGG - Exonic
920367761 1:205457042-205457064 AGCTGCGGCGCCGCCGCCGGAGG + Intergenic
920556636 1:206909358-206909380 GATCGCGGCGGCGGCGGCGCGGG + Intronic
921909080 1:220528284-220528306 GGATCGGGCGCCGCCGCCGCTGG + Intronic
922513165 1:226186512-226186534 GGTCGCGGCCCGGGCGCCTCAGG - Exonic
923191777 1:231626902-231626924 GCTCACGCCGCCGCCGCCGGCGG - Exonic
1063664100 10:8051507-8051529 GATGCCGCCGCCGCCGCCGCAGG - Intergenic
1064230947 10:13528951-13528973 GGTCGCGGCGGCGGCGGCGGCGG + Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1065687773 10:28302981-28303003 GGGCTCGGCACCGCCGCGGCGGG + Intronic
1069594708 10:69663127-69663149 GGTGGCAGCGCCCCCACCGCTGG - Intergenic
1070610163 10:77927082-77927104 GGCCACAGCCCCGCCGCCGCCGG + Intergenic
1070768311 10:79068816-79068838 CGCCGCGCCGCCGCCGCTGCCGG - Intergenic
1070768402 10:79069216-79069238 GGACGCGCCGCCGCCACCGCCGG - Exonic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1071966588 10:90858087-90858109 GGACGCGGCGCGGCTGCCGCAGG - Intergenic
1072903579 10:99430663-99430685 GGCCGCGGGCCCGCCCCCGCCGG - Intergenic
1076372405 10:129963982-129964004 CTTCGAAGCGCCGCCGCCGCCGG - Intergenic
1076554275 10:131311787-131311809 GCCCGCGCCGCCGCCGCCCCCGG + Intergenic
1076721775 10:132396322-132396344 GGTCGGGGAGCCCCTGCCGCGGG + Intergenic
1076895406 10:133308986-133309008 GGCAGCGGCTCCGCCGCCCCGGG - Exonic
1077049659 11:560988-561010 GGTTGCGGCGGCGCCGGAGCGGG + Intronic
1077076818 11:705904-705926 GGGCGCAGGGCCGCCTCCGCGGG - Intronic
1077285535 11:1763732-1763754 GGTCGCGGCGCCGAGGTCCCGGG - Intronic
1079297068 11:19242706-19242728 GGTCGCAGCGCAGCAGCTGCCGG + Intergenic
1079362005 11:19777290-19777312 GGTCGCCTCGCCCCCGCCCCGGG - Intronic
1080386258 11:31812880-31812902 GGCCGCGTCGCCGCAGCCCCTGG + Intronic
1080802141 11:35618788-35618810 GGGCGCGGGGCCGCCGCTCCGGG - Exonic
1081773764 11:45664736-45664758 GGGAGCGGCGCCCCCGCCTCCGG + Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083160806 11:60853006-60853028 GGTTGCAGCACCGCGGCCGCCGG - Exonic
1083246221 11:61429982-61430004 GGTCCCGCCCCCCCCGCCGCCGG + Intronic
1083448511 11:62726998-62727020 GGGCCCGGCCCCGCCGCCGCCGG + Exonic
1083753872 11:64778577-64778599 GGCCCCGGCCCCGCCGCCCCCGG - Intronic
1083965735 11:66042672-66042694 GGCCGGGCCGGCGCCGCCGCCGG + Exonic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1083999582 11:66288914-66288936 GGGCGCGGCGCGGCCGGCGGGGG - Intronic
1084128768 11:67118441-67118463 GGCCCCGGCGCCGCCGCCACGGG - Intergenic
1085205829 11:74731361-74731383 CGCCGCGCCGCCGCCGCTGCTGG - Intronic
1085641578 11:78196323-78196345 GGAGGCGGCGCGGCAGCCGCTGG + Exonic
1088522141 11:110711936-110711958 GGAGGCGGCGGCGCTGCCGCTGG + Intronic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1090699313 11:129279631-129279653 AGGCGCGCCGCCGCGGCCGCGGG + Intergenic
1090978386 11:131695026-131695048 GGGAGGAGCGCCGCCGCCGCCGG + Intronic
1092843326 12:12562905-12562927 GGCCGCGGGGCCGCCTCCTCCGG - Intergenic
1096154974 12:49336684-49336706 GGGAGCGGCACCGCCGCGGCTGG - Exonic
1096482414 12:51951585-51951607 GGCCGCGGCGCCGGCTCCGCCGG + Intergenic
1096983708 12:55743322-55743344 GCTCGCGGCCCCGCTGCTGCTGG + Exonic
1097057428 12:56258302-56258324 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1098550373 12:71755140-71755162 CGCCCCGCCGCCGCCGCCGCCGG - Exonic
1101466797 12:104957967-104957989 GCTCCCCGCGCCCCCGCCGCCGG + Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1101935359 12:109052621-109052643 GCTACCGCCGCCGCCGCCGCCGG - Exonic
1101970453 12:109309130-109309152 CCTCGCGGGGCCGCCGCTGCCGG + Exonic
1102256491 12:111418464-111418486 GGCCCCGGCCCCGCCGCCCCTGG + Exonic
1102289302 12:111685867-111685889 GGTGGCGGCGCTGCCGGCCCCGG - Exonic
1102853861 12:116277232-116277254 GGCCGGGCCGCCGCCGCCGCCGG + Exonic
1103362349 12:120361697-120361719 GATCGAGGGGCCGCCGCCGAGGG - Intronic
1103433025 12:120904103-120904125 GGAGCCGCCGCCGCCGCCGCGGG - Exonic
1103595358 12:122021826-122021848 AGCCGCGCCGCCGCCGCCGCCGG - Exonic
1103649636 12:122422629-122422651 TGACGCGCCGCCGCCGCCGCGGG + Intronic
1103764427 12:123270995-123271017 GGTCGCGGGGCCGCCGGGACTGG - Intronic
1104841629 12:131828592-131828614 GGGCGCGGCGCAGCCCCCGCGGG - Exonic
1104854356 12:131895009-131895031 GGTCTCTGTGCCGCCGCGGCCGG - Exonic
1104865326 12:131950103-131950125 GGTCGCGTAGCCGCAGCCGCGGG + Intronic
1105000613 12:132687709-132687731 GCTCGGGGCGCTGCCGCGGCGGG + Exonic
1105407110 13:20142163-20142185 GGGCGCGGCGCCCCTGCTGCTGG - Exonic
1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG + Exonic
1106956362 13:34942771-34942793 AGCAGCGGCGCTGCCGCCGCCGG - Exonic
1107534076 13:41311277-41311299 GGAACCGCCGCCGCCGCCGCTGG + Exonic
1110706213 13:78603437-78603459 GCTGGCGGCGGCCCCGCCGCGGG + Exonic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1114461107 14:22886717-22886739 GGTTTCGGCCCCGCCGCAGCCGG - Exonic
1116950153 14:50872083-50872105 GGGCGCGGTGCCGCCGGGGCGGG + Intronic
1117675609 14:58152152-58152174 GCTACCGCCGCCGCCGCCGCAGG - Exonic
1118339100 14:64879831-64879853 GGTGGCGGCGGCGGCGGCGCAGG + Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121074925 14:91060230-91060252 GGGCGCGGGGCCGCAGCCGTGGG - Intronic
1121342700 14:93115038-93115060 GGACGCGGCGCCGGCGCCCGGGG - Intronic
1122517663 14:102319954-102319976 GGACGCGGCGCGGCGGCTGCGGG + Exonic
1122635323 14:103127042-103127064 GGAGGCGGCGCGGCCGCTGCTGG + Exonic
1124340422 15:28886423-28886445 GGCTGCGGGGCGGCCGCCGCTGG + Intronic
1124527581 15:30471287-30471309 GGTGGCGCCGCCGCAGCCGTGGG - Intergenic
1124771078 15:32536415-32536437 GGTGGCGCCGCCGCAGCCGTGGG + Intergenic
1125516460 15:40323833-40323855 GCCAGCGCCGCCGCCGCCGCCGG - Intergenic
1125717455 15:41827429-41827451 GGGCCCGCCCCCGCCGCCGCGGG - Exonic
1127606343 15:60591947-60591969 GGTCGGGGAGGCGCCGCGGCCGG - Intronic
1128067776 15:64775358-64775380 GAGCGCGGCGCCGGCCCCGCGGG + Exonic
1128119182 15:65133394-65133416 GCCTGAGGCGCCGCCGCCGCCGG - Exonic
1128153540 15:65377852-65377874 GGCCCCGGCGCCGGCCCCGCGGG - Exonic
1128344128 15:66842820-66842842 GGCGGCGGCGGCGCCGGCGCGGG + Intergenic
1128622477 15:69161540-69161562 GGGCGCGGCTCCGCAGGCGCTGG + Intronic
1129644692 15:77419720-77419742 GCTCCCGGGGCCGCCGCCGAGGG + Intronic
1130023619 15:80251846-80251868 GGTCTCCTCGCCGCCGCGGCAGG + Intergenic
1130076511 15:80695031-80695053 CCGCGCGGCGGCGCCGCCGCTGG - Intronic
1130224554 15:82046979-82047001 GAGCGCCGCGCCGCCACCGCGGG + Intergenic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132365127 15:101251566-101251588 GGCAGCGCCGCCGCCGCCGCGGG + Exonic
1132464734 16:72341-72363 GGTCGCGGCGAGGCCCCCCCGGG - Intronic
1132662040 16:1065942-1065964 GGACCCGCCGCCGCGGCCGCAGG - Intergenic
1132842175 16:1983582-1983604 GGGCGCGGCGCGGCCGCAGAGGG - Intronic
1133156581 16:3880501-3880523 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1134849784 16:17470589-17470611 GGTCCCGGCGCTCCCGGCGCGGG + Exonic
1136141858 16:28293269-28293291 GGCCGCGGGGACGCCGCGGCAGG - Exonic
1136452089 16:30359268-30359290 GGTCAATGCGCTGCCGCCGCAGG + Exonic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1137655226 16:50153425-50153447 GGGAGCGACGCCGCCGGCGCCGG + Intronic
1138471961 16:57245143-57245165 GCGCGCGCCGCCGACGCCGCAGG - Exonic
1138619101 16:58197773-58197795 GGTGGCGGCGGCGGCGCGGCGGG + Exonic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1139364827 16:66427040-66427062 GGGAGCCGCGCCGCCGCCGAGGG + Intergenic
1139403007 16:66696854-66696876 GGTGGAGGCGGCGGCGCCGCGGG + Intergenic
1139496933 16:67326766-67326788 GGTCGCGGCGGCGCGCGCGCGGG + Intergenic
1139546741 16:67653200-67653222 GCTGGCGGCGCGGCCGCGGCCGG - Exonic
1139615441 16:68085747-68085769 GGCGCCGGCGCCGCCGCCCCCGG + Exonic
1139806143 16:69566465-69566487 GGTCGCGGCTCAGCCGCCCCCGG - Intronic
1140223112 16:73058194-73058216 CGGCCCCGCGCCGCCGCCGCCGG - Intronic
1141972453 16:87492756-87492778 GGGCGCGGCGTCGCCGCCTGGGG + Intergenic
1141989746 16:87602975-87602997 GGCCGCGGCGCCGGCTCCGGAGG - Exonic
1142336163 16:89490573-89490595 GCTCCCGCCGCAGCCGCCGCTGG - Intergenic
1142374655 16:89700862-89700884 GGTCGCGGGGCCGCCGACCATGG - Intronic
1142631460 17:1229046-1229068 GGGCGCGCAGCCCCCGCCGCTGG - Intergenic
1142708451 17:1710434-1710456 AGCCGCGGGGCCGCCGCCCCCGG + Exonic
1143237938 17:5419372-5419394 GGGCTCTTCGCCGCCGCCGCTGG + Exonic
1143321162 17:6070267-6070289 GGTCGCGGCTCCGCCGGAGGGGG - Intronic
1143513572 17:7408313-7408335 GGTCCCGGCGGCGGCGCCCCGGG + Exonic
1143625984 17:8110360-8110382 GAGCCCGGCGCCGCCGCCCCGGG - Intronic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG + Intronic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1147637599 17:41973624-41973646 GGGCGCGGCTCCCCCGCGGCAGG - Exonic
1147719804 17:42532121-42532143 TGGAGAGGCGCCGCCGCCGCCGG + Intergenic
1147994583 17:44353889-44353911 GGGGGCGGGGCCGCAGCCGCGGG - Exonic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1148406869 17:47423689-47423711 GGTCCCGGCGCCCCAACCGCCGG - Intronic
1148495012 17:48048386-48048408 GGCCTCGCCGCCGCCACCGCCGG - Exonic
1149461541 17:56833696-56833718 GATGCCGGCGCCGCCGCCGCCGG - Exonic
1150904831 17:69326754-69326776 CCTCGCGGAGCCCCCGCCGCAGG + Intronic
1151478544 17:74356879-74356901 CGCCGCGTCGCCGCCGCTGCTGG + Exonic
1151780215 17:76240465-76240487 GGGGGCGCCGCCGCCGCCTCAGG + Intergenic
1152361054 17:79833036-79833058 GGCCGCGGCGCCGGCGCAGGAGG - Intergenic
1152627997 17:81397001-81397023 GGTGGCGGCGTCGCCGCTGCGGG + Intronic
1152823781 17:82450742-82450764 GCGCGCGGCCCCGCCCCCGCCGG - Intronic
1153855180 18:9137479-9137501 GGGCGCGCCCCCGCCCCCGCGGG - Intronic
1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG + Intergenic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1157662750 18:49460267-49460289 GGTCCCTTCGCCGCCGCCCCGGG + Intronic
1157753011 18:50194985-50195007 CGTAGCTGCGCCGCCGCGGCGGG - Exonic
1159511215 18:69400709-69400731 GGTGGGAGCGCCTCCGCCGCCGG - Intergenic
1160162251 18:76482448-76482470 GATCGCGGGGCTGCCGCTGCCGG - Intronic
1160577248 18:79863687-79863709 GGTCCCGCCGCCGCCGCCCGGGG - Exonic
1160719131 19:589895-589917 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160870497 19:1275657-1275679 GGTCACGTTGTCGCCGCCGCCGG + Exonic
1160912177 19:1479571-1479593 GGTCGCGGCGCCTCCACTTCCGG + Intergenic
1160989987 19:1856579-1856601 GGTCGCGGGTCCGCCCCAGCTGG + Intronic
1161101507 19:2424171-2424193 GTTCCCGGCGCCGCAGCCACAGG - Exonic
1161111883 19:2475337-2475359 TGGCGCGGCCCCGCCCCCGCCGG - Intergenic
1161265116 19:3360215-3360237 GAGCGCGCCGCGGCCGCCGCCGG + Intronic
1161333745 19:3700184-3700206 GGTCGCTGCGGGGGCGCCGCCGG - Intronic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161412418 19:4123890-4123912 GCTAGAGGCGCCGCCGCCGCCGG - Exonic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1162535827 19:11262449-11262471 CGTCCCGCCGCCGCCGCCCCGGG + Exonic
1163019239 19:14473801-14473823 GGCCGTGGCGCTGCTGCCGCTGG - Exonic
1163557601 19:18001413-18001435 GGAGGCGGCGGCGCCGCTGCGGG + Intronic
1164834752 19:31349884-31349906 GGGCGCGGCGCCCCCGCGGGCGG - Intergenic
1164834755 19:31349894-31349916 GGGCGCCGCGCCCCCGCCCCCGG + Intergenic
1165424949 19:35740428-35740450 GGTCACGGCTCCGCCGCCGCAGG + Exonic
1165595296 19:37007717-37007739 GGTGGCGGCGCGGCGGCCTCGGG - Intergenic
1167080349 19:47273424-47273446 GGTGGCGGCCCCTCCGCTGCCGG + Intergenic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167456177 19:49597569-49597591 GGTCGCGGCGCCGCAGCAGGTGG - Exonic
1168076325 19:53982545-53982567 GGCGCCGCCGCCGCCGCCGCCGG - Exonic
1168641440 19:58034229-58034251 GGTCTCGGCGCCGCGTCGGCGGG + Intronic
925610424 2:5696924-5696946 GGTCGCGCCCGCGCCGCCGCCGG - Exonic
926090495 2:10045738-10045760 GGTCAGGGCGCCGCGGCCACTGG + Intronic
927156491 2:20224293-20224315 GGGCGCAGCGCGGCCGGCGCGGG - Intronic
927714203 2:25341864-25341886 GGACGCGGCGCCGCGGCACCAGG - Intronic
929604974 2:43227606-43227628 GGGCGCGGCGCCCCCACTGCCGG - Intergenic
930011457 2:46941155-46941177 GGCCGCGGCTCCACCCCCGCGGG - Exonic
930700945 2:54457088-54457110 GGGCGCGGGGCCGCCGCCTCCGG - Intronic
931694232 2:64859896-64859918 CCTCTCGGCGCCGCCCCCGCTGG - Intergenic
932568483 2:72924288-72924310 GGCTGCGGCCCCGCCGCCGACGG - Exonic
932624154 2:73284542-73284564 GGTCCCGGCGCAGCCGCTGCTGG - Intergenic
933666896 2:84971369-84971391 GGTCCCGGCGCTGCCCGCGCCGG - Exonic
934714677 2:96536791-96536813 GGTCTCGGGGCGGGCGCCGCGGG + Exonic
934933208 2:98445107-98445129 GGAGGCGACGCGGCCGCCGCGGG + Intronic
935255718 2:101308265-101308287 GGGCGCGGCCCCTCGGCCGCCGG + Exonic
935396943 2:102619480-102619502 GGGCGCGGCGCCCAAGCCGCAGG - Intergenic
936433199 2:112482046-112482068 GGGCGCGGCGCCGCCGCCCACGG + Intergenic
936433287 2:112482302-112482324 GGCCGCCGGGCAGCCGCCGCAGG - Exonic
936561415 2:113542244-113542266 GGGCGCGGCGGCGGCGCGGCGGG - Intergenic
938058337 2:128233396-128233418 GGTCGCGCGGCCGTCGCCGCCGG - Intergenic
938397858 2:130963978-130964000 GGCCGCCGCACCGCCGCCCCCGG + Intronic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
942947322 2:181684303-181684325 CGACGCGGCGCCTCCGCCCCGGG + Intergenic
943060532 2:183038106-183038128 GCTGGTGCCGCCGCCGCCGCCGG + Exonic
943669985 2:190649500-190649522 GGGCTCCGCGCGGCCGCCGCCGG + Intronic
947418480 2:229921700-229921722 TTCCGCGGCCCCGCCGCCGCCGG + Intronic
947418482 2:229921706-229921728 GGCCCCGCCGCCGCCGGCGCCGG + Intronic
948645349 2:239400806-239400828 GGACGCGGCCACGGCGCCGCCGG + Exonic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1169204568 20:3732602-3732624 GGCCGCGCCGCCTGCGCCGCCGG - Intergenic
1170617818 20:17968518-17968540 GGCCACGGCCCCGCCTCCGCCGG + Intronic
1172587265 20:36093469-36093491 GGTCCAGGCGCCGCCGCCGCTGG + Intronic
1172933449 20:38601894-38601916 GGTCGTGGTGCTGCCGCCGTGGG - Intergenic
1173251603 20:41366696-41366718 CGCCGCGCCGCCCCCGCCGCTGG + Exonic
1174576824 20:51542791-51542813 GGTGGCGGCCCCGCCCCCGCCGG - Intronic
1174804607 20:53594223-53594245 GGGCGCGGCGCGTCCGGCGCTGG + Intronic
1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG + Intergenic
1175846999 20:62064787-62064809 GGCTGCGGCGCCGGCGCCGGGGG - Exonic
1176548359 21:8211520-8211542 CGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176556250 21:8255723-8255745 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176567290 21:8394555-8394577 CGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176575189 21:8438765-8438787 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1178327929 21:31660152-31660174 GGTCCTTGGGCCGCCGCCGCGGG + Intronic
1178513836 21:33229904-33229926 CGCCGCGCCGCCGCCGGCGCGGG - Intronic
1178961793 21:37072866-37072888 GGTCGCGGCGCCCAGGCCCCGGG + Intronic
1180560359 22:16610158-16610180 GGCCGAGGCGCCGGAGCCGCAGG - Intergenic
1180650019 22:17369698-17369720 GGCTGCGGCGCTGCCGCGGCGGG + Exonic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1183149732 22:36028364-36028386 GGGCCCGGCGCCGCCGCCCGGGG - Exonic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1183386742 22:37519385-37519407 GGCGGCGGCTCCGCCGGCGCAGG + Exonic
1183535601 22:38398830-38398852 GGGCGCGGCGCGTCCGGCGCTGG + Intergenic
1183649426 22:39145591-39145613 GCTCGCGGCGCCGGCGGGGCGGG + Intronic
1183683768 22:39350208-39350230 CGCCGCCGCGCCGCCGCCGGGGG - Intronic
1184033987 22:41910066-41910088 GGTCGCGGAGCCCGCGCCGGGGG + Exonic
1184046690 22:41976661-41976683 GGTCCAGGAGCCGCCCCCGCGGG - Intronic
1184439082 22:44497920-44497942 GGGCGCGGGGCGGGCGCCGCGGG - Intronic
1184568887 22:45309930-45309952 GTTTGCGGCGGCGCCGCTGCCGG + Intronic
1184698013 22:46150528-46150550 GGACGCGGCGGCCCCGCGGCGGG + Intronic
1184759690 22:46537443-46537465 GGAGCCGCCGCCGCCGCCGCAGG - Intergenic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
1185258565 22:49849467-49849489 GGTCGCGGCGCCTCCGGGGTGGG + Intergenic
1185313766 22:50170317-50170339 GATCCCGCCGCCGCCCCCGCCGG + Intergenic
1185313826 22:50170435-50170457 GGGCGCTCCGCCGCCGCCCCCGG - Intergenic
1185345015 22:50307302-50307324 GGACGCGCAGCCCCCGCCGCCGG + Intronic
1185398546 22:50604557-50604579 GGTCGAGGCGCGGCGGGCGCGGG - Exonic
1203253238 22_KI270733v1_random:127820-127842 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203261293 22_KI270733v1_random:172901-172923 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
950215321 3:11154584-11154606 GGGAGCGGGGCCGCCGCGGCTGG + Intronic
950683915 3:14603024-14603046 GGCCCCGGCCCCGCCCCCGCCGG + Intergenic
952241279 3:31533136-31533158 CGGCGCGGCGCCGCCGAAGCCGG + Exonic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
953697040 3:45167750-45167772 GGTGGCGGCACCGGCGCTGCAGG - Intergenic
953801086 3:46023126-46023148 GGTCGCGGCGGCGGCGCAGGGGG + Intronic
953947574 3:47163352-47163374 GTCCGAGGCGCCGCCGTCGCGGG + Intronic
953947866 3:47164358-47164380 GGTCGCGGTGCCGCCTCTCCAGG - Intergenic
954882638 3:53846173-53846195 GCGCGGGGCGCCGGCGCCGCCGG - Exonic
954912783 3:54122671-54122693 GCTCTCGTCGCCGCCGCAGCGGG + Exonic
955818800 3:62874863-62874885 GGGGGCGGCGGCGCCGGCGCCGG - Exonic
956678188 3:71754298-71754320 GGCCGCGGCGGGGGCGCCGCCGG + Exonic
958470166 3:94507515-94507537 GGTCGCCCCGCCGCCGACCCCGG + Intergenic
958692113 3:97481553-97481575 GGGCGCGGCGCGTCCGGCGCTGG + Intronic
959591896 3:108090924-108090946 GGGGTCGCCGCCGCCGCCGCAGG + Exonic
962009737 3:131381651-131381673 GGTCGCGGCGCCCCGCCCCCAGG + Intronic
964201452 3:154122397-154122419 GCCTGCGCCGCCGCCGCCGCCGG + Exonic
966696298 3:182793579-182793601 GGACTCGGGGCCGACGCCGCGGG + Exonic
967858259 3:194134283-194134305 GGAGTCGCCGCCGCCGCCGCCGG - Intergenic
967930450 3:194686862-194686884 GGCCGAGGCGCCGCCGCGGCAGG + Exonic
968434125 4:576245-576267 GGTCGCGGCGGCGGCGGCGGCGG - Intergenic
968512957 4:1003348-1003370 GGGCGGGGCGCCGCGGCCACCGG - Exonic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
968835924 4:2964049-2964071 TGTCCTGGCGCCGCCGCCGCCGG - Exonic
968850493 4:3074627-3074649 CGGCGCGGCCCCGCCTCCGCCGG + Intergenic
969669633 4:8582552-8582574 GGTGGCGGCGCCGCTTCTGCTGG - Exonic
971406008 4:26321156-26321178 GCACGCGACGCCGCCCCCGCGGG - Intronic
975118535 4:70705059-70705081 GGGCGAGGCGGGGCCGCCGCCGG + Intronic
979547277 4:121951982-121952004 GGAGGCATCGCCGCCGCCGCGGG - Intergenic
980130399 4:128811709-128811731 GGCCGCTGCGCCCCCGCCCCGGG + Intronic
982042368 4:151409034-151409056 GGCCCCGCCCCCGCCGCCGCCGG - Intergenic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
984734797 4:183099165-183099187 GGTCGCGGCGCCCAGGCTGCCGG - Intergenic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
988734655 5:34008112-34008134 GGGCGCGGCGCCGCGGCTGGGGG - Intronic
990347448 5:54884128-54884150 GGACGCGGGGCCGCCGCGGCGGG - Intergenic
990557755 5:56952210-56952232 GGCCGTGCCGCCTCCGCCGCCGG - Intronic
993901218 5:93585112-93585134 GGCGCCGCCGCCGCCGCCGCGGG - Exonic
996443034 5:123512694-123512716 GGGGGCGGCGCCGCAGGCGCGGG + Intronic
998236396 5:140402048-140402070 GGCCTCGGAGCCGCCTCCGCCGG + Exonic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1002401729 5:178994890-178994912 GCTCGTGGCGCTGCTGCCGCTGG - Exonic
1002524355 5:179807014-179807036 GGCCGCAGCACCGCCGTCGCCGG + Intronic
1002622022 5:180494647-180494669 GGTGGCGGCGCTGCAGCAGCGGG + Exonic
1002785008 6:393500-393522 GGTGGCGTCGCCGGAGCCGCAGG + Intronic
1002927083 6:1610946-1610968 TGAAGCGCCGCCGCCGCCGCAGG - Exonic
1003049232 6:2765352-2765374 GCGCGAGGCGCCTCCGCCGCCGG + Intergenic
1004193871 6:13487270-13487292 GGCTGCGGCGGCGCGGCCGCGGG - Exonic
1007423922 6:41735081-41735103 GGTCGCGGAGAAGCCGCCCCCGG + Intronic
1007424064 6:41735504-41735526 GGCCGCGGCGCCGACGGCGGCGG - Intronic
1007625365 6:43243562-43243584 GGTCGGAAGGCCGCCGCCGCCGG + Intergenic
1007630312 6:43269755-43269777 GCCCGAGGAGCCGCCGCCGCCGG - Intronic
1011470230 6:87701424-87701446 GGACCCGGCCCCGCGGCCGCCGG - Intronic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1013170820 6:107635023-107635045 ACGCGCGGCGCCGCCGCCGAGGG + Exonic
1017146601 6:151240642-151240664 GGCCGAGGGGCCGCCGCCGCTGG - Exonic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017672353 6:156779074-156779096 GCTCGCGGCCCCGCCGCCCCCGG - Exonic
1020238467 7:6374468-6374490 GGGAGCGGCGGCGCCGGCGCGGG + Intergenic
1021451141 7:20784865-20784887 GGACTCGGCCCCGTCGCCGCTGG - Exonic
1021992595 7:26152436-26152458 GGTCCCGGCGCCCCAGCCGCCGG - Exonic
1022427949 7:30285539-30285561 GGCCGCCGCGGCGCCGCCGGAGG - Exonic
1022698007 7:32728685-32728707 GGCCGGGGGGCCGCCGCCGCGGG + Intergenic
1026858377 7:73769524-73769546 GGCCGCGGCGCTGCAGCTGCTGG - Exonic
1027232661 7:76281735-76281757 GGCCGCGGCGCCCCCGGCCCCGG + Exonic
1029814023 7:103075356-103075378 GGTCGCCCCGCCGCCGACCCCGG - Exonic
1030820728 7:114087629-114087651 GGCGGCGGCGCCGGCGGCGCGGG + Intronic
1032117056 7:129126481-129126503 GCTAGAGGCGCCGCCGCCACCGG + Intergenic
1032230626 7:130070683-130070705 GGAGGAGGCGCCGCCGGCGCTGG + Exonic
1032306112 7:130733791-130733813 GGGCGCGGCGCCGCCCGCGCCGG + Exonic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034267975 7:149790332-149790354 GGTCGCAGCGCCAGCCCCGCGGG - Intergenic
1034977915 7:155458676-155458698 GCTCGCGCCGCCTTCGCCGCCGG - Exonic
1035310055 7:157961897-157961919 GGTCCCGGTGCGGCCGCCGCCGG - Intronic
1035751708 8:2001431-2001453 GGACGCGGCGCCCGCGCTGCCGG - Exonic
1036723732 8:11201071-11201093 CGCCGCAGCGCCGCCGCCGACGG - Exonic
1037769201 8:21789116-21789138 GGTGGCGGCGGCGGCGGCGCCGG + Intronic
1037928847 8:22865548-22865570 GGTGCCGGTGCCGCAGCCGCCGG + Intronic
1039618237 8:38974161-38974183 GGCCACGGCGCCGCCTCCGCCGG - Exonic
1042837755 8:73093078-73093100 TGTCGCGTCGCAGGCGCCGCCGG - Exonic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049639333 8:143707569-143707591 GCTGACGGCGCCCCCGCCGCAGG - Exonic
1049762201 8:144336655-144336677 GGGCCCGGCGCCGCCGCCCCCGG - Intergenic
1049891271 9:73096-73118 GGGCGCGGCGGCGGCGCGGCGGG + Intergenic
1049896240 9:113908-113930 GGCCTCTGCGCCGCCGCCCCCGG - Intergenic
1050230920 9:3525588-3525610 CGCTGCGGCGCCGCCGCCGAGGG - Intronic
1053503410 9:38620895-38620917 TGTCCCGGTGCAGCCGCCGCCGG + Intergenic
1054781993 9:69174195-69174217 GCTGACGCCGCCGCCGCCGCGGG + Intronic
1054835654 9:69672553-69672575 GGTGCCGCCGCCGCCGCCGCGGG - Intergenic
1055090997 9:72364836-72364858 GGTGGCGCCGCCGCCGCCGCGGG + Intronic
1056386247 9:86099470-86099492 GGTCGCTCTCCCGCCGCCGCCGG + Exonic
1056992440 9:91424013-91424035 GGTAGTGGCGCCGCCGCGGAGGG - Intergenic
1057934016 9:99221771-99221793 GGACGCGGCGCTGGCGCTGCAGG - Exonic
1058053329 9:100427372-100427394 GGCTGCCGCGCCGCCGCTGCAGG + Intronic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG + Exonic
1061095902 9:128456630-128456652 GGTCGGGGCGATGCCGCCGACGG - Intronic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1061961632 9:133991840-133991862 GGTCGCGCCGCCGCCGCCCGCGG - Intronic
1061975958 9:134068150-134068172 GGGCGCGGCGCCGGCGGGGCCGG - Intronic
1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG + Intronic
1062560407 9:137139195-137139217 GGAGCCGCCGCCGCCGCCGCCGG + Intronic
1062626038 9:137441841-137441863 GGTCCCGGGGCCGCCGCCGTCGG + Intergenic
1203469640 Un_GL000220v1:110967-110989 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203477461 Un_GL000220v1:154939-154961 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1187173087 X:16870392-16870414 GGTCTCGGCGCCGGAGCCGTTGG - Intronic
1187419543 X:19122527-19122549 GGGGGCGGCGCCGAGGCCGCGGG - Exonic
1188003526 X:25002647-25002669 CGCCACGCCGCCGCCGCCGCCGG - Intergenic
1189988458 X:46573940-46573962 ACTCTCGGCGTCGCCGCCGCCGG - Exonic
1190114895 X:47619947-47619969 GGTCGCGTCCGCGCCGCCGCCGG - Intergenic
1193654991 X:84187991-84188013 GGTCGCGGCGGCGGCGGCGGCGG - Intergenic
1194666821 X:96685068-96685090 GCTCCCGACGCCGCCGCCCCGGG - Exonic