ID: 1130348026

View in Genome Browser
Species Human (GRCh38)
Location 15:83066978-83067000
Sequence GCGCTCCTTCAGCGACGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130348025_1130348026 -1 Left 1130348025 15:83066956-83066978 CCGAGTTGAAGAGGAAGGCGAAG 0: 1
1: 0
2: 3
3: 18
4: 184
Right 1130348026 15:83066978-83067000 GCGCTCCTTCAGCGACGCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1130348022_1130348026 29 Left 1130348022 15:83066926-83066948 CCAGTACGAAGCGCACATCGCTC 0: 1
1: 0
2: 0
3: 2
4: 12
Right 1130348026 15:83066978-83067000 GCGCTCCTTCAGCGACGCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1130348021_1130348026 30 Left 1130348021 15:83066925-83066947 CCCAGTACGAAGCGCACATCGCT 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1130348026 15:83066978-83067000 GCGCTCCTTCAGCGACGCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130348026 Original CRISPR GCGCTCCTTCAGCGACGCCT TGG Exonic
900549590 1:3247578-3247600 GCGCCCCTTCAGCTTCGCCCTGG + Intronic
901020679 1:6253804-6253826 GCGCTCCTCCATCGATGGCTCGG - Exonic
902149988 1:14435337-14435359 GCTCTCCTTCAGCCACACATAGG + Intergenic
910276726 1:85457320-85457342 TCGCTCCTTCTGGGAAGCCTTGG + Intronic
915162416 1:153929849-153929871 GGGCTCCTTCAGCAACGTCAGGG + Exonic
1069581942 10:69572471-69572493 TCGCTCCTCCAGCGACGCGGCGG + Exonic
1077202405 11:1317518-1317540 GCTCTCTTTTAGCGAGGCCTTGG + Intergenic
1078129900 11:8604810-8604832 GCTCTGCTTCAGGGACACCTGGG - Intergenic
1080385760 11:31810331-31810353 GCGCTCCCTCGGCGAGTCCTCGG + Intronic
1083741620 11:64714271-64714293 CAGCTCCTTGAGCGAGGCCTGGG + Intronic
1084636851 11:70398604-70398626 GCGCTCGCTCACCGCCGCCTGGG - Exonic
1103500701 12:121399862-121399884 GCGCGCCTTCCGCCACGCCCAGG + Intronic
1122483598 14:102063659-102063681 CCGCCCCTGCAGCCACGCCTGGG + Intergenic
1124612111 15:31215888-31215910 GCGCTCCTGCCGCCGCGCCTGGG + Intergenic
1128457557 15:67840673-67840695 GCGCGCCTTCAGCTTCCCCTCGG + Intergenic
1130348026 15:83066978-83067000 GCGCTCCTTCAGCGACGCCTTGG + Exonic
1137398198 16:48131916-48131938 GCGCTCTGTCAGCCAGGCCTGGG - Intronic
1144786727 17:17836363-17836385 GCGGAGCTTCGGCGACGCCTGGG + Intronic
1149423188 17:56530459-56530481 GGTCTCCTTCTGCGACCCCTGGG - Intergenic
1164727757 19:30478053-30478075 GAGCTCCTTCAAGGACGCCGAGG - Intronic
925304380 2:2838093-2838115 GCCCTCCCTCAGCGAAGCCCAGG + Intergenic
932779271 2:74549698-74549720 CCGCTCTCTCAGCGCCGCCTCGG - Intronic
937208565 2:120252818-120252840 GCGCGCCTCCGGCGTCGCCTAGG - Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948468366 2:238162800-238162822 GAACTCCTTCAGCAGCGCCTCGG - Exonic
948850081 2:240701544-240701566 GCGCTGCTCCAGCGGCTCCTGGG + Intergenic
1169345173 20:4823391-4823413 GGGCTGCTTCAGCTGCGCCTCGG + Intronic
1174658673 20:52192087-52192109 GCGCTGCTCCCGGGACGCCTGGG + Intronic
1175872776 20:62216336-62216358 GCGCTTCTCCAGCGAGGCCGAGG + Exonic
1176296039 21:5073669-5073691 GCTCACCTTCAGCCACGTCTCGG - Intergenic
1179861010 21:44188452-44188474 GCTCACCTTCAGCCACGTCTCGG + Intergenic
1180082063 21:45491471-45491493 GCCCTCGGTCAGAGACGCCTGGG + Intronic
1180229278 21:46416755-46416777 GCGCTGCTGCAGACACGCCTGGG - Exonic
1181013827 22:20057128-20057150 GGGCCCCTCCAGGGACGCCTGGG - Intronic
1182413894 22:30208800-30208822 GCCCTGCGTCAGCGAAGCCTTGG - Intergenic
1184511970 22:44939248-44939270 ACGCTCCTTCACCCACGGCTGGG + Intronic
950436534 3:12983638-12983660 CAGCTCCTTCAGGGACGCCTGGG + Intronic
950517992 3:13480032-13480054 GCGCCCCTTCCGCGAGGCCGGGG + Intronic
959664124 3:108902615-108902637 CTGCTCCTTCAGTGAAGCCTGGG - Intergenic
961017604 3:123479747-123479769 GGGCTCCTTCAGCCCCTCCTAGG - Intergenic
961536837 3:127575762-127575784 GCGCTCCTTCAGCGGGGTCTTGG + Exonic
963827572 3:149971207-149971229 GCGATCCTTCCGCGGCGCCCGGG + Intronic
968907990 4:3463380-3463402 GCCCTCCACCAGCGCCGCCTCGG - Exonic
986510042 5:8495373-8495395 GTGCTTCTTCAGCAACACCTGGG + Intergenic
999134601 5:149310119-149310141 ACGCACCTTCAGCCACTCCTCGG - Exonic
1001193829 5:169653923-169653945 CCCCTCCTTCAGCCAGGCCTGGG - Intronic
1006078266 6:31548256-31548278 GCCCTCCTCCAGCGACACCCAGG + Exonic
1006748404 6:36361246-36361268 GAGCTCCCTCAGTGACACCTCGG - Intronic
1013301512 6:108808912-108808934 GGGCTCCGTCAGAGAGGCCTGGG + Intergenic
1019681973 7:2355371-2355393 GCCCTCCTTCAGCGACCCCGAGG + Exonic
1024489128 7:49957502-49957524 GGCCTCCTTCAGCAACACCTGGG - Intronic
1039947268 8:42140585-42140607 GCGCGCATCCAGGGACGCCTTGG - Intergenic
1049158900 8:141084781-141084803 GCCCACCTTCAGCGTGGCCTGGG - Intergenic
1057262642 9:93594095-93594117 CAGCTCCTTCAGGGAGGCCTGGG - Intronic
1059873145 9:118600901-118600923 TCTCACCTTCAGAGACGCCTCGG + Intergenic
1061515460 9:131087480-131087502 CCGCTCCCTCAGCAAGGCCTTGG - Exonic
1061929407 9:133824713-133824735 GGGCTCCTTTAGCCACCCCTGGG + Intronic
1062112493 9:134789799-134789821 CCGCTCCTGCAGGGAGGCCTGGG - Intronic