ID: 1130353035

View in Genome Browser
Species Human (GRCh38)
Location 15:83107908-83107930
Sequence CCGCGCCTGGCCAGACTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130353027_1130353035 -10 Left 1130353027 15:83107895-83107917 CCGCAGGGGCTCCCCGCGCCTGG 0: 1
1: 0
2: 1
3: 34
4: 966
Right 1130353035 15:83107908-83107930 CCGCGCCTGGCCAGACTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 136
1130353023_1130353035 11 Left 1130353023 15:83107874-83107896 CCGCGGGACAGAGGTTCGTGGCC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1130353035 15:83107908-83107930 CCGCGCCTGGCCAGACTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 136
1130353020_1130353035 18 Left 1130353020 15:83107867-83107889 CCGTCCGCCGCGGGACAGAGGTT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1130353035 15:83107908-83107930 CCGCGCCTGGCCAGACTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 136
1130353021_1130353035 14 Left 1130353021 15:83107871-83107893 CCGCCGCGGGACAGAGGTTCGTG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1130353035 15:83107908-83107930 CCGCGCCTGGCCAGACTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130353035 Original CRISPR CCGCGCCTGGCCAGACTAGG GGG Intronic
901077169 1:6562456-6562478 CCGCGCCTGCCCAGGCCACGGGG + Intronic
901467417 1:9431326-9431348 CCGCACCTGGCCATACTTTGTGG + Intergenic
902232949 1:15039784-15039806 CAGCGGCTGGTCAGACTTGGGGG - Intronic
902574865 1:17371409-17371431 CAGCGCCTGCCTAGACTAGGTGG - Intergenic
902856393 1:19209694-19209716 CCGCTCCGGCCCAGGCTAGGAGG + Intronic
903481991 1:23660504-23660526 CTGTGCCTGGCCAGACTTTGAGG + Intergenic
905672109 1:39798661-39798683 CCATGCCTGGCCAGAGCAGGTGG - Intergenic
905768631 1:40623501-40623523 CCTCGCCTGACCAGAGGAGGTGG + Exonic
906141504 1:43536512-43536534 CAGCGCCTGGCCAGCTTGGGGGG + Intronic
909289431 1:73863946-73863968 CCGCGCCCGGCCAGAAGAGAGGG - Intergenic
909822441 1:80083527-80083549 CCGCGCCCGGCCAGTCTAGCTGG - Intergenic
912922830 1:113885750-113885772 CCGCGCCTGGCCCATCTGGGCGG - Intronic
915581164 1:156814167-156814189 CCGCGCCGGGCGACACAAGGCGG - Intronic
915909552 1:159905162-159905184 CAGCGCCCGGCCCAACTAGGTGG + Intergenic
918048378 1:180954549-180954571 GCGCGCCGAGCCAGACTGGGAGG + Intergenic
1069333167 10:67317712-67317734 CCGCGCCTGGCCATCATCGGGGG + Intronic
1076711471 10:132338023-132338045 CCGCGCCTGGCCAAAGTTGCTGG - Intronic
1077024198 11:432120-432142 CTGGGCCTGGCCAGACCAGAGGG - Intronic
1077352827 11:2100737-2100759 CAGGGCCAGGCCAGCCTAGGAGG - Intergenic
1077914673 11:6603656-6603678 CCGCGCCTGGCTAAACTCGATGG - Intergenic
1078821974 11:14891877-14891899 CCGCCCCTGGGCCGACTAGTCGG - Intronic
1081583147 11:44366073-44366095 CGGCGCCTGGCCAGGGGAGGAGG + Intergenic
1084054930 11:66625889-66625911 CTGTGCCTGGCCTGACTAGCAGG - Intronic
1084558976 11:69892138-69892160 CCGGGCCTGGCCAGAGAAGAGGG + Intergenic
1085745519 11:79111253-79111275 CGGCGCCTGGCCAGAAAAAGAGG - Intronic
1090457972 11:126866289-126866311 CCCTGCCTGGCCAGGCCAGGTGG - Intronic
1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG + Exonic
1096522287 12:52191285-52191307 GCACCCCTGGCCACACTAGGTGG + Intronic
1097155078 12:57006466-57006488 CCGTGCCCGGCCCGACGAGGAGG + Intergenic
1100833560 12:98542569-98542591 CTGCACCTGGCCAGAGTAAGTGG - Intronic
1101388612 12:104279772-104279794 CCGTGCCTGGCCAGACTTTTTGG - Intronic
1103320270 12:120088645-120088667 CCGCGCCTGGCCACACTTTATGG + Intronic
1103703823 12:122861004-122861026 CTGCTCCTGGCCTGACTTGGTGG - Exonic
1104862662 12:131932294-131932316 CTGCGCCCGGACAGACAAGGTGG + Exonic
1105853395 13:24355336-24355358 CCACGCCTGGCCTGGCTCGGAGG + Intergenic
1105999830 13:25711293-25711315 CCGCGCCTGGCCAGTCCTGTAGG + Intronic
1107712513 13:43164228-43164250 CCGCGCCTGGCCAGACGTTTAGG + Intergenic
1111312083 13:86502191-86502213 CCGCGCCTGGCCAGGAGAGTTGG + Intergenic
1111483455 13:88863960-88863982 CCGCGCCTGGCCTAAATGGGTGG - Intergenic
1118188650 14:63560305-63560327 CCGCGCCTGGCCAGATCACAGGG + Intergenic
1121174037 14:91877131-91877153 CCGTGCCTGGCCTGCATAGGAGG + Intronic
1122996549 14:105268386-105268408 CCGGGCCTTGCCAGACTCAGTGG + Intronic
1123719579 15:23049319-23049341 CCACACCTGGCCAGACTTGCCGG + Intergenic
1123719872 15:23050329-23050351 CCGCGCCTGGCCAGAGGTGCTGG + Intergenic
1125449712 15:39795692-39795714 TGGCCCCTGGCCAGACTTGGAGG - Intergenic
1130353035 15:83107908-83107930 CCGCGCCTGGCCAGACTAGGGGG + Intronic
1132369055 15:101280565-101280587 CCACGCCTGGCCAAACTCAGGGG - Intergenic
1136622904 16:31442208-31442230 CCGCGCCAGGCGAGGCTTGGTGG - Intronic
1137640644 16:50025487-50025509 CCGTACCTGGCCAGACGCGGGGG + Intronic
1137686302 16:50389378-50389400 CTGCCCCTGGCCTGAGTAGGTGG - Intergenic
1138537013 16:57665776-57665798 CCTCCCCTGGCCACTCTAGGGGG + Intergenic
1142757279 17:2023906-2023928 CCGCGCCTGGCCCGGCCAGGAGG - Intronic
1143526067 17:7473400-7473422 CCGGGCCTGGCCAGGCGCGGTGG - Intronic
1145868190 17:28254023-28254045 CCGCTCCTGGCCAGGCATGGTGG + Intergenic
1145956275 17:28856999-28857021 CTGCGCCTGGCCAGGAAAGGGGG + Intronic
1149541898 17:57473741-57473763 CGGCACCTGTCCAGACAAGGTGG - Intronic
1151715350 17:75828221-75828243 CCGCGCCAGCCCAGCCCAGGAGG + Intronic
1152193181 17:78900963-78900985 CCTCACCTGGCCATGCTAGGAGG + Intronic
1155287582 18:24306964-24306986 CCGAGCCTGGCCAGAGTATGGGG - Intronic
1156473944 18:37394212-37394234 TCGCGCCTGTCCAGAGTGGGAGG - Intronic
1160559855 18:79749410-79749432 CCGAGTCTGGCCCCACTAGGAGG + Intronic
1160972748 19:1776670-1776692 CCGCGGCCGGCCAGTCTCGGAGG - Exonic
1160982708 19:1823606-1823628 CCGCCCCTGGCGAGAAGAGGAGG - Exonic
1162014883 19:7840033-7840055 CCAGGCCTGGCCAGAGTGGGTGG + Intronic
1162140066 19:8580394-8580416 CCTCCCCTGACCTGACTAGGGGG - Exonic
1162154090 19:8664806-8664828 CCCCTCCTGCCCAGACTTGGGGG - Intergenic
1162427061 19:10603043-10603065 AGGCGGCTGGCCAGACTCGGTGG - Intronic
1162550447 19:11355517-11355539 CCGCGCCGGGGCAGTCTAGGCGG + Exonic
1163493825 19:17633062-17633084 CCCAGCCTGGCCACACCAGGTGG - Intronic
1163587472 19:18171958-18171980 CAGTGCCTGGCAAGGCTAGGGGG - Intronic
1166630793 19:44405622-44405644 CCGCGCCCAGCCTGAATAGGAGG - Intergenic
1167597133 19:50433683-50433705 CCGAGCCCGGCCAGACTGGGAGG + Intronic
929174280 2:38960741-38960763 CGGGGCCGGGCCAGGCTAGGGGG + Intronic
930679033 2:54235638-54235660 CCGCGCCTGGCCAACCTATAGGG + Intronic
930931125 2:56885402-56885424 CTGCGCCCGGCCAGAATTGGTGG - Intergenic
937292261 2:120788782-120788804 CCACCCCTGGCCACACTGGGAGG + Intronic
940909178 2:159195405-159195427 CAGCTCCTGGCCAGACGTGGTGG - Intronic
943951387 2:194134952-194134974 CCTAGCCTGGCCTGGCTAGGAGG + Intergenic
946999968 2:225442865-225442887 CCGTGCCTGGCCAGAAAAAGAGG + Intronic
947215647 2:227747623-227747645 CCACGCCTGGCCAGAATACCTGG - Intergenic
947463239 2:230321205-230321227 CATGGCCTGGCCAGACCAGGTGG + Intergenic
948856821 2:240734144-240734166 CCTCACCTGGCCAGGCCAGGAGG - Intronic
1168799213 20:633736-633758 CCACGCCTGGCAAGAGGAGGCGG - Intergenic
1172255451 20:33513649-33513671 CCGCACCTGGCCAGATTAGCTGG + Intronic
1174870121 20:54174071-54174093 CCCCGGCTGGCCAGACTCCGAGG + Intergenic
1179545029 21:42107964-42107986 CCTCGCCTGGCCAGCCCGGGAGG + Intronic
1183547364 22:38461620-38461642 CCGCGGCTGGCCAAACGAGGAGG - Intergenic
950536283 3:13580874-13580896 CCACGCCTGGCCAGGTTAGCAGG - Intronic
953088966 3:39704775-39704797 CCACTCCTGGCCAGGCGAGGTGG - Intergenic
956730754 3:72194524-72194546 CGGGGCCAGGCCAGACTGGGAGG + Intergenic
956898599 3:73689650-73689672 CTACTCCTGGCCAGACTGGGTGG + Intergenic
961469213 3:127100915-127100937 CCACGCATGGCCAAACCAGGAGG + Intergenic
961602114 3:128070400-128070422 CTGAGCCTGGCCAAGCTAGGTGG + Exonic
961762848 3:129184127-129184149 CCGGGCCCGGCCAGACTGGGTGG + Intergenic
966832370 3:184020681-184020703 CCGCGCCCGGCCAGAATTGTGGG + Intergenic
970532633 4:16999336-16999358 CCTAGCTTGGCCAGGCTAGGAGG - Intergenic
972494798 4:39624531-39624553 CTGCGCCTGGCCAAACTAATAGG - Intronic
973292930 4:48488090-48488112 CCGCGCCTGGCCAGAAAAGCTGG + Intronic
974078618 4:57190829-57190851 CAGGGCCTGGCTAGACTTGGAGG - Intergenic
975892011 4:79040911-79040933 CTGCGCCTGGCCAAAATAGAGGG - Intergenic
977129224 4:93213061-93213083 CCGTGCCTGGCCAGTTTGGGGGG + Intronic
982274072 4:153622059-153622081 TTGCGACTGGCCAGACTGGGGGG - Intronic
984612502 4:181856847-181856869 CAGCACCTGGACAGAGTAGGAGG + Intergenic
985550970 5:533493-533515 CCGAGCCCTGCCAGTCTAGGCGG - Intergenic
994611359 5:102045345-102045367 CTGCGCCTGGCCTGACGATGGGG - Intergenic
997369411 5:133348556-133348578 CTGCACCTGGCCAGACTTGGGGG - Intronic
997758704 5:136424081-136424103 CTGTGTCTGGCCAGACAAGGAGG + Intergenic
999163824 5:149530675-149530697 CCGCGCCTGGCCTGAGTAGCTGG - Intronic
1001415372 5:171541770-171541792 CGGGGCCTGGCTAGACTTGGGGG - Intergenic
1002007656 5:176249551-176249573 CAGCTCCTGGCCAGACATGGTGG + Intronic
1002168068 5:177360255-177360277 TTGTGCCTTGCCAGACTAGGGGG - Intronic
1002218721 5:177661074-177661096 CAGCTCCTGGCCAGACATGGTGG - Intergenic
1004253908 6:14045388-14045410 CCGCGCCTGGCCAGAGGTGCGGG + Intergenic
1005381258 6:25236593-25236615 CTTCACCTGGCCAGAGTAGGAGG - Intergenic
1006637197 6:35469145-35469167 CCGCGCCTGCCCGGAGCAGGGGG - Intronic
1011159690 6:84374991-84375013 CCCAGCCTGGCCAGACAAAGAGG + Intergenic
1013012701 6:106134589-106134611 CCCCGCCAGGCCAGACCGGGTGG - Intergenic
1014016111 6:116532189-116532211 CCTCTTCTGGACAGACTAGGAGG + Intronic
1015063351 6:128995612-128995634 CCGCACCTGGCCCCAGTAGGTGG + Intronic
1016016423 6:139191127-139191149 CCGCGCCTGGCCAGATAAACTGG - Intergenic
1019274028 7:166554-166576 GCACGCGTGGCCAGACAAGGAGG + Intergenic
1025994650 7:66520278-66520300 CCGCGCCTGGCCACACTTGGGGG + Intergenic
1026777433 7:73239392-73239414 CCTCTCCTGGCCAGGCTTGGTGG + Intergenic
1027018284 7:74792764-74792786 CCTCTCCTGGCCAGGCTTGGTGG + Intergenic
1027069743 7:75153154-75153176 CCTCTCCTGGCCAGGCTTGGTGG - Intergenic
1031398889 7:121307549-121307571 CACTCCCTGGCCAGACTAGGTGG + Intergenic
1031591466 7:123597542-123597564 CCTCCCCTGGCCAGACGTGGTGG + Intronic
1033030275 7:137819598-137819620 CCGCGCCCAGCCAGACTACAAGG + Intronic
1033632535 7:143173437-143173459 CCACGCCTGGCCAGGTTGGGAGG - Intergenic
1035069111 7:156127886-156127908 CCGCAGCTGGCCAGGCTTGGTGG + Intergenic
1035200459 7:157261010-157261032 CCGCACCTGGCCAGTCTATTTGG - Intronic
1037711186 8:21356724-21356746 CCGCGCCCGGCCAGAAAAAGAGG + Intergenic
1041185246 8:55293042-55293064 CCGCACCTGGCCAAACTATATGG - Intronic
1047390081 8:124443508-124443530 CCGCGCCTGACCCTACTTGGTGG - Intergenic
1049095926 8:140548023-140548045 CCGCGCCCGGCCAGTGTAAGTGG - Intronic
1049624133 8:143612547-143612569 CTGGGACTGGCCAGGCTAGGGGG + Intergenic
1049778570 8:144417360-144417382 CCACGCCAGGCCAGCCTGGGTGG + Intergenic
1050068823 9:1789181-1789203 CCTCTCCTGGCCAGACTGGGTGG - Intergenic
1061038207 9:128125165-128125187 CAGAGCCAGGCCAGGCTAGGGGG + Intronic
1061087786 9:128409341-128409363 CCGCGCCTGGCCAGGGCTGGGGG - Intergenic
1061286146 9:129624082-129624104 CTGCGCCTGGCCTAACTAGATGG + Intronic
1061576746 9:131512173-131512195 TCTCGCCTGGCCAGGCCAGGAGG - Intronic
1061739936 9:132695047-132695069 CCGGGCATGGGCAGACAAGGAGG + Intergenic
1190906896 X:54736754-54736776 CCCCGCCTGGCCAAAGTGGGGGG + Intergenic
1192241687 X:69335903-69335925 CCGAGACTGGCCAGGCTTGGTGG + Intergenic
1195554115 X:106201703-106201725 CTGTGCCTGGCCAGTCTTGGGGG + Intronic
1195687433 X:107599557-107599579 GCGGGCCTGGCCAGATGAGGAGG + Intronic
1196272775 X:113731887-113731909 CCGCGCCCGGCCTGACAATGGGG + Intergenic
1197217398 X:123879603-123879625 CCGCGCCTGGCCAGAAAGAGAGG + Intronic
1197770978 X:130089110-130089132 CAGGGCCTGGCCAGACAGGGAGG + Intronic
1198375989 X:136040829-136040851 CCACGCCTGGCCAGAATGGAAGG - Intronic