ID: 1130361909

View in Genome Browser
Species Human (GRCh38)
Location 15:83196878-83196900
Sequence AACAATTTGCTGAAAATGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 608}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130361905_1130361909 16 Left 1130361905 15:83196839-83196861 CCTGTTGGCATCTATTTTCTCTA 0: 1
1: 0
2: 2
3: 31
4: 242
Right 1130361909 15:83196878-83196900 AACAATTTGCTGAAAATGAGGGG 0: 1
1: 0
2: 3
3: 45
4: 608

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130361909 Original CRISPR AACAATTTGCTGAAAATGAG GGG Intronic
900810326 1:4796935-4796957 ACCATTTTGCTGAAGGTGAGCGG - Intergenic
901486136 1:9563290-9563312 AGCAATTAGATGAAAAAGAGTGG - Intronic
901717168 1:11165210-11165232 AACACTTTGTTGAATAGGAGTGG - Intronic
901959645 1:12815032-12815054 AACACTTTGTTGAATAGGAGTGG + Intergenic
902133892 1:14287708-14287730 AACACTATGTTGAATATGAGTGG + Intergenic
902284991 1:15402023-15402045 AACAGTTTGCTAAAGATGACAGG - Intergenic
903401579 1:23055438-23055460 TACAATTTGTTAAAAATGAGAGG + Intronic
903897706 1:26619751-26619773 TACAAATTTCTCAAAATGAGGGG - Intergenic
905641215 1:39591225-39591247 AAAAATTGGCTGAGAATGAGGGG + Intergenic
906660961 1:47581329-47581351 AACAATTTGCTGCAAATTTATGG + Intergenic
906957881 1:50391081-50391103 AATACTATGCTGAAAATAAGTGG + Intergenic
907572466 1:55496097-55496119 AACACTATGCTGAATAGGAGTGG + Intergenic
907961725 1:59290030-59290052 AGCAACTTGGTGAACATGAGGGG + Intergenic
909036253 1:70597147-70597169 AACACTATGTTGAAAAGGAGTGG + Intergenic
909124538 1:71649579-71649601 AACAGTATGCAGAAAATGTGTGG + Intronic
909380327 1:74990575-74990597 AACAATATGTTGAATAGGAGTGG - Intergenic
909552437 1:76913805-76913827 AACACTATGTTGAAAAGGAGTGG - Intronic
909770735 1:79418248-79418270 AACAATATGTTGAATAGGAGTGG - Intergenic
909811821 1:79940419-79940441 AACACTATGTTGAAAAGGAGTGG + Intergenic
909989754 1:82209250-82209272 AACAATTTGCTGCAAAAGAGGGG - Intergenic
910319193 1:85924784-85924806 AACACTATGCTGAATAAGAGTGG - Intronic
911033457 1:93513882-93513904 AACACTATGTTGAAAAGGAGTGG - Intronic
911356277 1:96824912-96824934 GACAATTTGCTGAAAATTTGAGG + Intergenic
911362643 1:96898097-96898119 AACACTATGTTGAAAAGGAGTGG + Intergenic
911465524 1:98248053-98248075 ATCAATTGGCTGTAAATGTGTGG + Intergenic
912053456 1:105563143-105563165 AACAATTGACTGTAAATGTGTGG + Intergenic
912076355 1:105880861-105880883 AACACTTTGTTGAATAGGAGTGG + Intergenic
913045967 1:115073704-115073726 AATAATTTTCTGAAAAAGCGTGG + Intronic
913258691 1:116978835-116978857 AACAATATGTTGAATAGGAGTGG - Intronic
913263770 1:117024799-117024821 AGTAATTTGCTAAGAATGAGGGG + Intronic
913424006 1:118706449-118706471 AACAATATGTTGAATAGGAGTGG + Intergenic
913549341 1:119902351-119902373 AACGTCTTGTTGAAAATGAGAGG + Intergenic
913940863 1:125103536-125103558 AACAAATTGGGGAAGATGAGTGG + Intergenic
913943845 1:125138370-125138392 AACAAATTGGGGAAGATGAGTGG - Intergenic
914219674 1:145668600-145668622 AACACTATGCTGAATAAGAGTGG + Intronic
914391763 1:147230038-147230060 AACAATATGTTGAATAGGAGTGG + Intronic
914403567 1:147347061-147347083 AACAATATGTTGAATAGGAGTGG - Intergenic
915183444 1:154083410-154083432 ATTAATTTGCTGAAGTTGAGAGG - Intronic
915365501 1:155313185-155313207 AACAATTGGCTGAAGCTGAGTGG + Intronic
915611007 1:156992731-156992753 GACAATCAGCTGAAAATGAGTGG + Intronic
916397198 1:164403840-164403862 AAAAATTTGCTGAGAATCTGAGG - Intergenic
918159737 1:181887135-181887157 AACACTATGTTGAAAAGGAGTGG + Intergenic
919382877 1:196880216-196880238 AACACTATGCTGAATAGGAGTGG + Intronic
919494798 1:198250909-198250931 AACACTATGTTGAATATGAGTGG + Intronic
921562075 1:216670862-216670884 AACAATTTTCTGTCAGTGAGAGG - Intronic
921628624 1:217406072-217406094 AATAATTTGATGAAAATCTGTGG + Intergenic
921824002 1:219651012-219651034 AACAATGTCCTTAAAATGAAAGG - Intergenic
922347929 1:224712130-224712152 AACAATGTCGTGAAAGTGAGTGG - Intronic
923222584 1:231909199-231909221 AACACTATGCTGAATAGGAGTGG + Intronic
923433339 1:233945534-233945556 AACAATTTGCTCAAAATCATAGG - Intronic
924450435 1:244174090-244174112 ATCACATTGCTGAAAATGATGGG - Intergenic
1063020737 10:2125225-2125247 AACAAATTACAGAAAATCAGTGG + Intergenic
1063793869 10:9487221-9487243 AACACTATGCTGAATAGGAGTGG - Intergenic
1063811095 10:9708493-9708515 CTGAATTTGCTGACAATGAGTGG + Intergenic
1064041969 10:11974406-11974428 AACACTATGCTGAATAGGAGTGG + Intronic
1064057987 10:12113997-12114019 AGTATTTTGTTGAAAATGAGTGG + Intronic
1064237930 10:13593830-13593852 AGTCATCTGCTGAAAATGAGGGG + Intronic
1064508213 10:16057616-16057638 AACAATTTGAGGAAAAACAGTGG + Intergenic
1064639476 10:17400892-17400914 AACACTTTGTTGAATAGGAGTGG - Intronic
1065564778 10:26997565-26997587 AACATTTTTCTGAGACTGAGAGG + Intronic
1066032250 10:31440519-31440541 AACAATATGTTGAATAGGAGTGG - Intronic
1066483031 10:35815741-35815763 AACACTATGCTGAATAGGAGTGG + Intergenic
1067193720 10:44095019-44095041 AACATTATGCTGAATAGGAGTGG - Intergenic
1068240008 10:54292434-54292456 AACACTATGTTGAAAAGGAGTGG - Intronic
1068376213 10:56184552-56184574 AACCCTATGCTGAAAAGGAGTGG + Intergenic
1068409649 10:56638437-56638459 AACACTATGTTGAATATGAGTGG + Intergenic
1068575887 10:58683903-58683925 AACACTTTGTTGAATAGGAGTGG + Intronic
1068802197 10:61154098-61154120 ATGAAATTGCTGAAAATGAAAGG - Intergenic
1069353349 10:67555783-67555805 AACACTATGTTGAAAAGGAGTGG + Intronic
1069371837 10:67755997-67756019 TACATGTTGCTGCAAATGAGAGG - Intergenic
1070696481 10:78567582-78567604 AACAAGTTGGTGAAAATCAGGGG + Intergenic
1071039870 10:81294227-81294249 ATCAATAAGCTGTAAATGAGTGG + Intergenic
1071085523 10:81864355-81864377 AACAATTTGATGAAAATCTCTGG - Intergenic
1071385845 10:85120524-85120546 AATAATTTGCTAAATATGATAGG - Intergenic
1071386849 10:85129850-85129872 AACACTATGTTGAAAAGGAGTGG - Intergenic
1072020957 10:91400977-91400999 AACAATTGACTTTAAATGAGTGG - Intergenic
1072406117 10:95154997-95155019 AACACTTTGTTGAACAGGAGTGG - Intergenic
1072774690 10:98179091-98179113 AACAATTTGTTGAATAGGAGTGG + Intronic
1073019531 10:100431535-100431557 ACCAATTTAAGGAAAATGAGTGG - Intergenic
1074017647 10:109550403-109550425 AACAATATGTTGAACAGGAGTGG - Intergenic
1074236308 10:111587895-111587917 AACAATATGTTGAATAGGAGTGG - Intergenic
1074485565 10:113874500-113874522 AACAAACTGCTGAAAATCAAAGG - Intronic
1074909210 10:117892243-117892265 GACAATTGGCTGAAGATGGGTGG - Intergenic
1075508677 10:123050443-123050465 AACAATTTCCTGCAAATAACAGG - Intronic
1077818822 11:5715454-5715476 AACAATATGTTGAATAGGAGTGG - Intronic
1078598904 11:12713812-12713834 AGCCATTTGCTGAACATGAGAGG - Intronic
1080704716 11:34679570-34679592 AGCACTCTGTTGAAAATGAGTGG - Intergenic
1081037416 11:38166028-38166050 AACACTATGCTGAATAGGAGTGG + Intergenic
1081165257 11:39800563-39800585 AACACTATGCTGAATAGGAGTGG - Intergenic
1081185908 11:40042141-40042163 AACACTATGCTGAATAGGAGTGG - Intergenic
1081972227 11:47207407-47207429 AACCAGTTACTGTAAATGAGTGG - Intergenic
1082269357 11:50152953-50152975 AACACTATGTTGAAAAGGAGTGG - Intergenic
1082303881 11:50547017-50547039 AACACTATGCTGAATAGGAGTGG - Intergenic
1082924996 11:58535632-58535654 AACACTATGTTGAATATGAGTGG - Intronic
1083707700 11:64527600-64527622 AGCAATTTGTTGAACCTGAGGGG + Intergenic
1083795909 11:65016582-65016604 AACCATTTGCTGAGATGGAGAGG + Intronic
1084099688 11:66938436-66938458 AACAATTTTTTGGAAAAGAGGGG + Intronic
1084949994 11:72659619-72659641 AACAATTCCCTGAAAAGAAGGGG - Intronic
1085427616 11:76418797-76418819 TACATTTTGCTGCAAATGACAGG - Intergenic
1085694280 11:78690632-78690654 AATATTTTGCTGAAAATGCCTGG - Intronic
1087217551 11:95510334-95510356 AAGAATTTCCTGAAGATGATGGG - Intergenic
1087274462 11:96146929-96146951 CACTCTTTGCTGAAAATGAAAGG + Intronic
1087357672 11:97115672-97115694 AAAAATTTTTTAAAAATGAGTGG + Intergenic
1087748498 11:101978368-101978390 AACGAATTGCTGAAACTAAGCGG + Exonic
1087864972 11:103214102-103214124 TATACTTTGCTGAAAATCAGTGG + Intronic
1087884945 11:103468999-103469021 CACACATTGCTGAAAATAAGAGG - Intronic
1088309879 11:108448746-108448768 AACACTATGCTGAATAGGAGTGG - Intronic
1090433496 11:126666401-126666423 AACCATTTCCTGAAAAATAGAGG + Intronic
1091700543 12:2656774-2656796 ATCAACTGGCTGTAAATGAGTGG - Intronic
1091799831 12:3317835-3317857 AACTAATTTCTGAAAATGAGGGG - Intergenic
1092327895 12:7553293-7553315 AACACTATGTTGAAAAGGAGTGG - Intergenic
1092596730 12:10014224-10014246 AACAATTTCATGAAAATGAGTGG + Intronic
1092601630 12:10072452-10072474 AAAGATTTGCTGAAAATGTAAGG - Intronic
1093078721 12:14784941-14784963 TATAATTTTCTGAAAATTAGTGG - Exonic
1093160701 12:15742874-15742896 AACACTATGCTGAATAGGAGTGG - Intronic
1093271368 12:17066527-17066549 AGTTGTTTGCTGAAAATGAGGGG + Intergenic
1093533601 12:20196979-20197001 AAAACTATGCTGAAAAGGAGTGG + Intergenic
1093600776 12:21019403-21019425 TACAAGTTGCTGATAATGAATGG - Intronic
1093618223 12:21254266-21254288 AACACTATGCTGAATAGGAGTGG + Intergenic
1094422611 12:30287372-30287394 ATCAATTGACTGAAAATGAAAGG + Intergenic
1095065393 12:37765806-37765828 AACACTTTGTTGAATAGGAGTGG - Intergenic
1095069634 12:37824935-37824957 AACACTATGTTGAAAAGGAGTGG - Intergenic
1095282095 12:40364605-40364627 CATAATTTCCTGAAAATGAAGGG + Intronic
1096926474 12:55153471-55153493 AACAATATGTTGAATAGGAGTGG + Intergenic
1096948076 12:55432514-55432536 AACACTATGTTGAATATGAGTGG - Intergenic
1097408658 12:59224041-59224063 AACACTATGTTGAAAAGGAGTGG + Intergenic
1097576338 12:61397429-61397451 CTCAAATTGCTGAAAACGAGTGG + Intergenic
1097773058 12:63611978-63612000 AACAAACTGCTCAAAATCAGTGG + Intronic
1097775366 12:63638321-63638343 AACACTATGTTGAAAAGGAGTGG - Intronic
1098686746 12:73432362-73432384 AATAATATGTTGAATATGAGTGG + Intergenic
1098727106 12:73981847-73981869 AACAATATGTTGAATAGGAGTGG - Intergenic
1099058947 12:77881542-77881564 AATAATATGCTGAATAGGAGTGG - Intronic
1099517803 12:83619875-83619897 AGCAATTTGCTGATATTTAGAGG - Intergenic
1099602795 12:84763003-84763025 AACAAGATGCTGAAAATAAGTGG + Intergenic
1100766321 12:97869661-97869683 AACACTATGTTGAAAAGGAGTGG - Intergenic
1100966097 12:100014790-100014812 AACACTTTGTTGAATAGGAGTGG - Intergenic
1101621002 12:106388038-106388060 AACAATTGGCTGAAAGTGACAGG + Intronic
1103217119 12:119210424-119210446 AAATATTTGATGGAAATGAGGGG - Intronic
1106148047 13:27069467-27069489 AAGTATTTGGTGAAAATGTGGGG + Intronic
1106337119 13:28793931-28793953 AACAGATTGGTAAAAATGAGAGG - Intergenic
1107234184 13:38148827-38148849 AACAAATGGCTTAAAAGGAGTGG - Intergenic
1107624529 13:42269914-42269936 AACAAATGGCTGAAAAGGAAGGG - Intergenic
1107877857 13:44806454-44806476 AAGTATTTGCTGAAAGTCAGGGG + Intergenic
1108170001 13:47731449-47731471 AACACTATGCTGAATAGGAGTGG + Intergenic
1108175251 13:47785865-47785887 AACACTATGTTGAATATGAGTGG - Intergenic
1108307652 13:49154548-49154570 AACACTATGCTGAATAGGAGTGG + Intronic
1108892136 13:55274596-55274618 AACACTTTGGTGAATAGGAGTGG + Intergenic
1109095056 13:58103577-58103599 AACAATATGTTGAATAGGAGTGG + Intergenic
1109134804 13:58634121-58634143 AACAACTTGCAGAAAATTTGTGG - Intergenic
1109398044 13:61786671-61786693 AAAAATTGCCTGAAAATTAGGGG + Intergenic
1109895260 13:68678745-68678767 CACGATTTGATGAAAATAAGAGG + Intergenic
1109950640 13:69499106-69499128 AGAAATTTGATGAATATGAGGGG + Intergenic
1109964241 13:69670837-69670859 AACACTATGTTGAAAAGGAGTGG - Intergenic
1110254562 13:73418286-73418308 AACAATTGGCTGAAGCTAAGGGG - Intergenic
1110438756 13:75504591-75504613 AACAATATTCTGAGAATGAGAGG - Intergenic
1110768143 13:79304023-79304045 AACAGTATGCTGAATAGGAGTGG - Intergenic
1110912769 13:80984156-80984178 AACACTATGCTGAATAGGAGTGG + Intergenic
1111943985 13:94644239-94644261 AAAAATTTGCTGAAAACACGTGG + Intergenic
1112126669 13:96476057-96476079 AACAATAACCTGAAAATAAGAGG + Intronic
1112624586 13:101089595-101089617 AACAAATAGCTCAAAGTGAGTGG + Intronic
1112891361 13:104236357-104236379 TACACTTAGCTGAAAAAGAGTGG + Intergenic
1113027776 13:105959841-105959863 AACAATTCGCTCAAGAAGAGTGG + Intergenic
1113429151 13:110234183-110234205 AACAACTTGGTGAAAAACAGTGG + Intronic
1113590721 13:111498139-111498161 AACACTATGCTGAATAGGAGTGG + Intergenic
1114246022 14:20914688-20914710 AACAATATGTTGAATAGGAGTGG - Intergenic
1114765556 14:25366799-25366821 AACAATATGTTGAATAGGAGTGG + Intergenic
1115141407 14:30175507-30175529 AACAATATGTTGAATAGGAGTGG + Intronic
1115475463 14:33809106-33809128 TTCAATTTTCTGAAAATAAGTGG + Intergenic
1115828501 14:37306657-37306679 AAATATTTGAAGAAAATGAGTGG - Intronic
1116323187 14:43496151-43496173 AACACTATGTTGAAAAGGAGTGG - Intergenic
1116327204 14:43545648-43545670 CATAATTTGTTGAAAATAAGTGG - Intergenic
1116938786 14:50770012-50770034 GACCATCTGCTGAGAATGAGGGG + Intronic
1117394883 14:55299139-55299161 AAGAATTTGCTGGAAGTCAGTGG + Intronic
1117771340 14:59137177-59137199 AATCATCTGCTGAAATTGAGAGG + Intergenic
1117834059 14:59783540-59783562 ATCTCTTTGCTGAAAATCAGAGG - Intronic
1118137188 14:63043427-63043449 AACAGTTTGGGGAAAATGTGTGG - Intronic
1119854746 14:77891141-77891163 GACCATCTGCTGAGAATGAGGGG + Intronic
1119874802 14:78049666-78049688 AACACTTTGCTGACATTAAGTGG + Intergenic
1123811836 15:23934845-23934867 AACAACAGGCAGAAAATGAGTGG - Intergenic
1124340816 15:28888139-28888161 AACATTTTGTTGAAAAAAAGAGG - Intronic
1125396795 15:39257769-39257791 AACACTATGCTGAATAGGAGTGG - Intergenic
1126883604 15:53125669-53125691 AACAATCTACTGAAAAAGAGAGG + Intergenic
1127384556 15:58456754-58456776 AACAAATTGGGGAAAACGAGAGG + Intronic
1127418062 15:58776569-58776591 AAGATTCTGCTGAAAATGACAGG + Intronic
1127418163 15:58777743-58777765 AACTATCTCTTGAAAATGAGAGG - Intronic
1130361909 15:83196878-83196900 AACAATTTGCTGAAAATGAGGGG + Intronic
1130395764 15:83500047-83500069 AGCTATTTGATGATAATGAGGGG + Intronic
1130564192 15:84980817-84980839 AGCACTTTGGTTAAAATGAGAGG + Intronic
1130760598 15:86815468-86815490 AACATTTTGCCAAAAATGATTGG - Intronic
1131628491 15:94149991-94150013 AACACTATGTTGAATATGAGTGG + Intergenic
1132166245 15:99594189-99594211 ATCAATTGGCTGTAAATCAGGGG + Intronic
1133588849 16:7222922-7222944 AAAAAATCGCTGCAAATGAGAGG - Intronic
1135758041 16:25114370-25114392 AATGATTTGATGACAATGAGGGG - Intronic
1136701642 16:32149715-32149737 AACACTTTGTTGAATAGGAGTGG - Intergenic
1136766022 16:32777746-32777768 AACACTTTGTTGAATAGGAGTGG + Intergenic
1136802076 16:33092632-33092654 AACACTTTGTTGAATAGGAGTGG - Intergenic
1137370505 16:47901227-47901249 AACACTATGTTGAAAAGGAGTGG - Intergenic
1137385956 16:48042786-48042808 AACAATTTCCTAAAAAATAGGGG + Intergenic
1137480129 16:48845518-48845540 AATAATTTGCTTAAAATAAATGG + Intergenic
1137828469 16:51520878-51520900 AACACTATGTTGAAAAGGAGTGG - Intergenic
1138761870 16:59554282-59554304 AACAATTCACTGAAATTAAGAGG - Intergenic
1139200506 16:64971688-64971710 AACAATTGGCTGAAAGAGAAAGG + Exonic
1139277963 16:65745475-65745497 TCCCATTTGCTGAAAATGAGTGG + Intergenic
1140631811 16:76862576-76862598 ATCAATTACCTGAAAATGAAAGG + Intergenic
1140926034 16:79584562-79584584 AACTCTTTGCTGAAAATGGATGG + Intergenic
1203068408 16_KI270728v1_random:1039995-1040017 AACACTTTGTTGAATAGGAGTGG + Intergenic
1144894128 17:18515971-18515993 AACAATGTCCTGAAAATGTAAGG + Intergenic
1145198627 17:20919000-20919022 AACACTATGCTGAATAGGAGTGG - Intergenic
1145934118 17:28705140-28705162 AACCAGGTGCTGACAATGAGTGG + Intronic
1148056089 17:44796568-44796590 AACAATTTTTTAAAAATGAGTGG + Intergenic
1148606215 17:48931047-48931069 AATAATATGCTCAAAATGGGTGG + Intronic
1149821749 17:59786640-59786662 AACAGTTTACTGGAAATGAAGGG - Intronic
1150889708 17:69133662-69133684 AAGAATTTGATGAAAATGATGGG - Exonic
1151092703 17:71461027-71461049 AACAAAATGTTTAAAATGAGGGG + Intergenic
1151118717 17:71767976-71767998 AAAAATTTGCTGAAATTGAAAGG + Intergenic
1151530067 17:74698428-74698450 AGCAATATGGTGAAGATGAGGGG + Exonic
1153746889 18:8188710-8188732 TATAATTTTCTTAAAATGAGGGG + Intronic
1154052631 18:10975457-10975479 AACACTGTTCTGGAAATGAGGGG + Intronic
1154364428 18:13693844-13693866 AACACTATGCTGAATAGGAGTGG - Intronic
1155139783 18:23034439-23034461 ACCAATTTACTTATAATGAGAGG - Intergenic
1155570011 18:27183356-27183378 AACATTGTGCTGTAAGTGAGTGG + Intronic
1156112868 18:33748382-33748404 AACAAATTGCTGATAGTGAGAGG + Exonic
1156114604 18:33772826-33772848 AACACTATGTTGAAAAGGAGTGG + Intergenic
1156176630 18:34554403-34554425 AACACTATGTTGAAAAGGAGTGG + Intronic
1156186281 18:34667452-34667474 AACACTATGTTGAAAAGGAGTGG + Intronic
1156280415 18:35631669-35631691 AACACTATGTTGAAAAGGAGTGG - Intronic
1156702845 18:39844887-39844909 AACAATTTGTTGTAAATAATTGG + Intergenic
1156834127 18:41531822-41531844 AACACTTTACTGAAAACCAGAGG - Intergenic
1157059930 18:44276363-44276385 AACACTATGCTGAATAGGAGTGG - Intergenic
1157844881 18:50993933-50993955 CACAATTTTCTGAAAATAACTGG - Intronic
1158838700 18:61359948-61359970 AACAATTTTCTGTAATTGACTGG - Intronic
1159285470 18:66343805-66343827 AACTATATTCTGAACATGAGGGG + Intergenic
1159630156 18:70739945-70739967 AACACTATGCTGAATAGGAGTGG - Intergenic
1159796473 18:72850487-72850509 AACAATTTGCAGACAATTTGAGG - Intronic
1162160866 19:8714725-8714747 CACAATAGGCTGAAAATGAAAGG - Intergenic
1162897773 19:13775709-13775731 AACAATTTGCTCAAGATCACAGG - Intronic
1163165113 19:15491435-15491457 AACATTTTGTTGAATAGGAGTGG + Intronic
1163972446 19:20811783-20811805 AACAATATGTTGAATAGGAGTGG - Intronic
1165658532 19:37554535-37554557 GACAAATTGCTGAAAACTAGTGG - Intronic
1167035460 19:46992745-46992767 AACAATGTGATGAAAATGACTGG - Intronic
925241739 2:2337325-2337347 AATAATTTGCTGAAATAGATGGG + Intergenic
925506655 2:4573065-4573087 AACAATTGGCCGAAAATGTGGGG - Intergenic
925571126 2:5313839-5313861 AAGTATTTGCTGATATTGAGAGG + Intergenic
925861587 2:8182662-8182684 AACACTATGTTGAATATGAGTGG - Intergenic
926885419 2:17594017-17594039 CACTATTTGTTTAAAATGAGAGG + Intronic
927224723 2:20752504-20752526 AACAAATTGCTACAAATGGGTGG + Intronic
927224733 2:20752665-20752687 AACAAATTGCTACAAATGGGTGG + Intronic
927354772 2:22160418-22160440 AACACTATGCTGAATAGGAGTGG - Intergenic
928290206 2:30029970-30029992 AGCAATTTGCTGTAGATAAGAGG - Intergenic
928766618 2:34654077-34654099 AACACTATGCTGAATAGGAGTGG - Intergenic
929294778 2:40234628-40234650 AACAATATGTTGAATAGGAGTGG + Intronic
930431706 2:51285890-51285912 AACAAACTGCTGAAGATGTGAGG - Intergenic
930726446 2:54686489-54686511 TACAATTTGCAGAAAGGGAGTGG - Intergenic
930911312 2:56633267-56633289 AACACTATGTTGAATATGAGTGG + Intergenic
931312452 2:61095247-61095269 TTCAATTTGCTGTAAAGGAGAGG - Intronic
931853824 2:66280883-66280905 GAGCATTTGCTGACAATGAGAGG - Intergenic
932188759 2:69720948-69720970 AACACTTTGGTGAGAATCAGAGG - Intronic
932510599 2:72284588-72284610 AATAATATGTTGAAAAGGAGTGG - Intronic
932828640 2:74966205-74966227 CTCAATTTGTTGAGAATGAGGGG - Intronic
932928503 2:76004984-76005006 TACAAAGTGCTGAAAATAAGGGG - Intergenic
933435378 2:82243078-82243100 AACACTTTGTTGAATAGGAGTGG - Intergenic
933594244 2:84266458-84266480 AACACTATGTTGAAAAGGAGTGG - Intergenic
933796464 2:85924058-85924080 AAGAATTTTCTGAAAATGGCCGG + Intergenic
933854315 2:86398575-86398597 AGTAATTTGCTGAAAATAACTGG - Intergenic
934086255 2:88512501-88512523 AAAAATTAGCTGGACATGAGTGG - Intergenic
934140459 2:89041964-89041986 AAATATTTGCTGAAAATGAATGG + Intergenic
934228779 2:90158572-90158594 AAATATTTGCTGAAAATGAATGG - Intergenic
935091801 2:99901706-99901728 AACAATTTGATAAGAATGAGTGG - Intronic
935257014 2:101319459-101319481 AACACTATGTTGAATATGAGCGG - Intergenic
935819398 2:106878846-106878868 CACACTGTGTTGAAAATGAGAGG - Intronic
935940425 2:108232308-108232330 AACAATTTGCTGCATATGAAGGG + Intergenic
936458686 2:112694717-112694739 AACCATTTGTTTAAAATCAGTGG - Intergenic
936781416 2:116037630-116037652 AACACTATGCTGAATAGGAGTGG - Intergenic
936907417 2:117553229-117553251 AACAATTTGCTGAAATGGACTGG + Intergenic
937041615 2:118825334-118825356 TACAACATGCTGAAAATGACAGG - Intergenic
937456026 2:122042442-122042464 AAAAATTTCTTGAAAAAGAGTGG - Intergenic
937723627 2:125132937-125132959 AATAATATGTTGAAAAGGAGTGG - Intergenic
938857591 2:135330083-135330105 AACAATATGTTGAATAGGAGTGG + Intronic
939101688 2:137901895-137901917 AACATTTTGCTCATAATGATTGG + Intergenic
939793901 2:146617500-146617522 AATAATGTGTTGAATATGAGTGG - Intergenic
941204205 2:162551118-162551140 AACATTTTAGTGAAAGTGAGGGG + Intronic
941480806 2:166008529-166008551 AACATTTTGGTGAAAATTTGAGG + Intronic
942542803 2:177032168-177032190 AAAAATGAGCTGAAAATGAGAGG - Intergenic
943121435 2:183740869-183740891 AACACTATGCTGAACAGGAGTGG + Intergenic
943169026 2:184371935-184371957 AACAATCTACTGAGAATGATGGG + Intergenic
943671586 2:190667318-190667340 AACATCTTACTGAAAATCAGAGG + Intronic
943693336 2:190893084-190893106 AACCATTTGCTGTAAATAATTGG + Intronic
944000174 2:194825126-194825148 AGCAATTTGTGTAAAATGAGAGG - Intergenic
944010979 2:194974772-194974794 AACACTTTGTTGAATAGGAGTGG - Intergenic
944305335 2:198172530-198172552 AATACTGTGCTCAAAATGAGGGG + Intronic
945998315 2:216458795-216458817 AACACTATGCTGAATAGGAGTGG - Intronic
946681853 2:222225632-222225654 AACAATTTGCTTAATATCTGGGG + Intronic
948039919 2:234892363-234892385 AACACTATGTTGAAAAGGAGTGG - Intergenic
1169783423 20:9333082-9333104 AAGAAGTTGCTCAAATTGAGGGG - Intronic
1171195783 20:23198106-23198128 AACAATTTGCTGAATATTTGAGG + Intergenic
1171281082 20:23898880-23898902 AACAATATGTTGAATAGGAGTGG + Intergenic
1171466699 20:25333920-25333942 AACACTGTGTTGAATATGAGTGG - Intronic
1171525704 20:25808763-25808785 AACACTTTGTTGAATAGGAGTGG - Intronic
1171551123 20:26047121-26047143 AACACTTTGTTGAATAGGAGTGG + Intergenic
1171814420 20:29771809-29771831 AACACTATGCTGAATAGGAGTGG - Intergenic
1172301254 20:33852125-33852147 AAGAATTTGCTGGAAATCAGTGG + Exonic
1172397401 20:34618479-34618501 AACTATTTACTGAAAATAACAGG + Intronic
1175938085 20:62524310-62524332 AATAATCTACTGAAAATGAGAGG - Intergenic
1176451364 21:6864895-6864917 AACACTATGTTGAACATGAGTGG - Intergenic
1176453557 21:6886580-6886602 AACATTTTGCTCATAATGATTGG + Intergenic
1176700762 21:10047173-10047195 AACACTATGCTGAATATGAGTGG - Intergenic
1176829533 21:13729946-13729968 AACACTATGTTGAACATGAGTGG - Intergenic
1176831732 21:13751628-13751650 AACATTTTGCTCATAATGATTGG + Intergenic
1177143217 21:17380015-17380037 AACACTATGCTGAATAGGAGTGG - Intergenic
1177272899 21:18872106-18872128 AACACTATGTTGAAAAGGAGTGG + Intergenic
1177486683 21:21767290-21767312 AACATTTTTTTAAAAATGAGGGG - Intergenic
1177622777 21:23618279-23618301 AAGAATTTGCTGACAAAAAGAGG + Intergenic
1178080725 21:29061710-29061732 ACAAATTTGGTAAAAATGAGTGG + Intronic
1179324530 21:40328318-40328340 ATCAGTTTGCTGTAAATGTGTGG - Intronic
1179606186 21:42516931-42516953 AATATTTTGCTCAAAATGGGTGG - Intronic
1179839766 21:44063905-44063927 AACAATATACTGAAAATTAAAGG - Intronic
1182517392 22:30866818-30866840 AACAAGTGGCTTAAAATGACAGG + Intronic
949200249 3:1369032-1369054 AACCATGTGCTGAAAATGAAAGG - Intronic
949703788 3:6791695-6791717 ATCAAATTGCTGAAAGTCAGAGG - Intronic
951063915 3:18242199-18242221 ATAAATTTACTAAAAATGAGTGG + Intronic
951967838 3:28407233-28407255 AATAATTTTCTTAAAATAAGAGG - Intronic
952008395 3:28870013-28870035 AGAAATTTTCTGAATATGAGAGG - Intergenic
952169214 3:30787201-30787223 AAAAATTACCTGAATATGAGGGG + Intronic
952939485 3:38431579-38431601 AACACTTTGTTGAATAGGAGTGG + Intergenic
953547502 3:43874421-43874443 AATAATTTGCTAAACATGTGGGG + Intergenic
954488797 3:50881240-50881262 AACACTATGCTGAATAGGAGTGG - Intronic
954521598 3:51232099-51232121 AACAATTGGCAAAAAATGAATGG - Intronic
955269320 3:57481032-57481054 AACACTTTGTTGAATAGGAGTGG - Intronic
955506855 3:59641075-59641097 AACAAAATGCTCAATATGAGAGG + Intergenic
955847989 3:63187703-63187725 ATCAATTGACTAAAAATGAGTGG + Intergenic
955869149 3:63418320-63418342 ACCAAATTGCTGATAATGATAGG - Intronic
955903525 3:63782916-63782938 AACAATTTAATGACTATGAGGGG + Intergenic
957067109 3:75533734-75533756 TACATTTAGCTGAAAATGACAGG - Intergenic
957490717 3:80923411-80923433 AAAAATTTGGAGAAAAGGAGTGG - Intergenic
957680528 3:83427610-83427632 AATAATATGCTGAAAAAGAACGG + Intergenic
958738014 3:98032324-98032346 ATAAATTTCCTGAAAATGATTGG + Intronic
959052458 3:101537238-101537260 AACAATATGTTGAATAGGAGTGG + Intergenic
959111431 3:102127540-102127562 AACACTTTGTTGAATAGGAGTGG - Intronic
959519806 3:107312518-107312540 AACACTTTGTTGAATAGGAGTGG + Intergenic
959845025 3:111022695-111022717 AACACTATGTTGAATATGAGCGG - Intergenic
960766730 3:121138602-121138624 ATCAATTGGCTGTAAATGTGTGG - Intronic
961966534 3:130910476-130910498 AACACTTTGTTGAATAGGAGTGG + Intronic
962064750 3:131967335-131967357 AACACTATGTTGAAAAGGAGTGG - Intronic
962153209 3:132915238-132915260 AATAGTTTGCTGAGAATGATGGG - Intergenic
962219864 3:133555433-133555455 AACACTGTGTTGAAAAGGAGTGG - Intergenic
963032400 3:140991628-140991650 AACAATATGTTGAATAGGAGTGG - Intergenic
963316085 3:143760308-143760330 AACACTATGCTGAATAGGAGTGG - Intronic
963769112 3:149370751-149370773 AAAACTTTGCTGAAAATAAAAGG - Intronic
963871075 3:150414362-150414384 AACAGTCTCCTGTAAATGAGAGG + Intronic
965131504 3:164706586-164706608 AACACTTTGTTGAATAGGAGTGG - Intergenic
965219011 3:165902374-165902396 AACACTATGCTGAATAGGAGTGG + Intergenic
965307906 3:167090920-167090942 AATAATTTACTGAATTTGAGGGG + Intergenic
965607968 3:170515463-170515485 AACAGGTTGCTGAAAGTTAGAGG - Intronic
965800931 3:172493278-172493300 AACACTATGCTGAATAGGAGTGG + Intergenic
965982756 3:174713073-174713095 AATAGTTTGCTGAGAATGATGGG + Intronic
966643080 3:182211961-182211983 GCCAATTTGCTGAAAATTAATGG - Intergenic
967140925 3:186559377-186559399 AAGAATTTGCTGAAAACCTGAGG - Intronic
968379920 4:83746-83768 AATAATTTGCTGAAATGGAAAGG + Intronic
968408989 4:369541-369563 AATAATTTGCTGAAATAGAAAGG + Intronic
969163694 4:5284992-5285014 AACAATTTGTTTAAAATGGTGGG - Intronic
969984828 4:11197451-11197473 AACAATTTGAAGGAAATGAAGGG + Intergenic
970054967 4:11961302-11961324 AACACTATGCTGAATAGGAGTGG + Intergenic
970120986 4:12752242-12752264 AACAATATGTTGAATAGGAGTGG - Intergenic
971387703 4:26156569-26156591 AAAAATTAGCTGGACATGAGTGG - Intergenic
971436497 4:26630966-26630988 TAGAATTTCCTGACAATGAGGGG - Intronic
971620956 4:28853527-28853549 AACACTATGTTGAAAAGGAGTGG + Intergenic
972151982 4:36103878-36103900 AAAAATTTGCTAAAATTAAGGGG - Intronic
973210702 4:47612298-47612320 AACAATTTTCTGGAGCTGAGAGG - Intronic
973315640 4:48757210-48757232 AACACTATGTTGAATATGAGTGG - Intronic
973546395 4:51986435-51986457 AACACTATGTTGAATATGAGTGG + Intergenic
973753295 4:54045762-54045784 AACACTATGTTGAATATGAGTGG - Intronic
973875113 4:55209895-55209917 AACACTATGTTGAAAAGGAGTGG - Intergenic
974091955 4:57320954-57320976 AACAATTCGAAGAAAAGGAGAGG - Intergenic
974502835 4:62728977-62728999 AACACTATGTTGAAAAGGAGCGG + Intergenic
974953461 4:68609051-68609073 AACACTATGCTGAATAGGAGTGG + Intronic
975219104 4:71793684-71793706 AACACTATGCTGAATAGGAGTGG + Intronic
975295955 4:72734669-72734691 AACACTTTGTTGAATAGGAGTGG - Intergenic
975348767 4:73323279-73323301 AACACTATGTTGAAAAGGAGTGG - Intergenic
975500203 4:75076264-75076286 AACACTATGCTGAATAGGAGTGG + Intergenic
976924602 4:90481399-90481421 AACACTATGCTGAATAGGAGTGG + Intronic
977399559 4:96514938-96514960 TACAAGTTGCTGAAAATGACTGG - Intergenic
977455661 4:97256626-97256648 AACACTATGCTGAATAGGAGTGG + Intronic
977469657 4:97426740-97426762 AACACTATGCTGAATAGGAGTGG + Intronic
977495813 4:97774074-97774096 ACCAGTTTGCTTAAAATGGGAGG - Intronic
977496547 4:97782044-97782066 AACACTATGCTGAATAGGAGTGG - Intronic
977538257 4:98281637-98281659 AACACTATGCTGAATAGGAGTGG + Intronic
977771356 4:100864836-100864858 AACACTTTGTTGAATAGGAGTGG + Intronic
977933219 4:102771388-102771410 AACAATTTTATCAAAATGTGTGG + Intergenic
978192850 4:105935413-105935435 CAGAATTTACTAAAAATGAGAGG - Intronic
978210154 4:106125541-106125563 TCCATTTTGCTGAAAATGATAGG - Intronic
978409780 4:108414950-108414972 ATCATTTGGCTGAAAATAAGTGG - Intergenic
979000680 4:115214416-115214438 CAGAGTTTGCTGAAAAAGAGTGG - Intergenic
980154778 4:129091369-129091391 AACATTTTTTTAAAAATGAGTGG - Intronic
980463150 4:133144526-133144548 AACAATGATCTGAAAAAGAGAGG + Intergenic
980542412 4:134211878-134211900 AACACTATGTTGAAAAGGAGTGG - Intergenic
980682721 4:136185218-136185240 AACAGTTTGTTGAATAAGAGTGG - Intergenic
980691753 4:136304272-136304294 AAAAAATTGCTGAATTTGAGTGG - Intergenic
980771829 4:137383380-137383402 ATCAATTGACTGTAAATGAGTGG + Intergenic
980859254 4:138480224-138480246 AACAATATGTTGAATAGGAGTGG + Intergenic
980887738 4:138781646-138781668 AACAATATGTTGAATAGGAGTGG + Intergenic
981507197 4:145515297-145515319 AACAATTTATTAAAAATTAGAGG - Intronic
981828893 4:148977642-148977664 AACACTATGTTGAATATGAGTGG - Intergenic
981861099 4:149357274-149357296 AACACTATGTTGAATATGAGTGG + Intergenic
982661980 4:158218335-158218357 ATCAATTTTGGGAAAATGAGTGG + Intronic
983393145 4:167160003-167160025 AACAATATGTTGAATAGGAGTGG - Intronic
983401461 4:167271550-167271572 AACAATATGTTGAATAGGAGTGG - Intergenic
983451076 4:167912353-167912375 AACACTATGTTGAAAAGGAGTGG - Intergenic
983807162 4:172008953-172008975 AACTATTTGCTGAAAAAGGAAGG + Intronic
983974274 4:173913805-173913827 GACATTTTGTTGAAAATGAATGG - Intergenic
984386239 4:179061978-179062000 AAAAATTTCATGAAAATGAAAGG + Intergenic
986380012 5:7174661-7174683 AACAATATGTTGAATAGGAGTGG - Intergenic
986382180 5:7197746-7197768 AACACTATGCTGAATAGGAGTGG - Intergenic
986957233 5:13167676-13167698 ATCATTTTGCTGAAAATTACAGG - Intergenic
987013774 5:13796162-13796184 AACACTATGTTGAATATGAGTGG - Intronic
987698050 5:21357599-21357621 AACACTATGCTGAATAGGAGTGG - Intergenic
987971417 5:24950276-24950298 AACAAGTGGCATAAAATGAGAGG - Intergenic
988405592 5:30820000-30820022 AACACTATGTTGAAAAGGAGTGG + Intergenic
988735522 5:34016767-34016789 ATCAATCTGCTGAAAATGGGAGG - Intronic
989548514 5:42703351-42703373 ATCAATTTACTGTAAATGTGTGG + Intronic
989614382 5:43324915-43324937 AACACTATGTTGAATATGAGTGG + Intergenic
989838741 5:46031791-46031813 AACAATATGTTGAATAGGAGCGG - Intergenic
990062190 5:51665254-51665276 AACTTTTTTCTAAAAATGAGAGG + Intergenic
990231981 5:53722610-53722632 AACAATTTGGTGAAATTTTGTGG - Intergenic
990687937 5:58328647-58328669 AAAATTTGGCTGAAACTGAGTGG - Intergenic
993097733 5:83499697-83499719 GACAATTTGCTGGGAAGGAGTGG - Intronic
993434922 5:87881001-87881023 AACATTTTTCAGAAACTGAGAGG + Intergenic
993472059 5:88318268-88318290 ATCAATTGGCTGTAAATGTGAGG + Intergenic
993627922 5:90248084-90248106 AACAATTGGTTGAAAAAGACTGG - Intergenic
994374102 5:98998513-98998535 AACATCTGCCTGAAAATGAGAGG - Intergenic
994507431 5:100660048-100660070 AACACTTTGTTGAATAGGAGTGG + Intergenic
994709666 5:103251833-103251855 AACACTATGCTGAATAAGAGTGG + Intergenic
995169898 5:109095557-109095579 AACAAGTTCCTGAAGAGGAGAGG - Intronic
995613096 5:113931271-113931293 AACACTATGTTGAAAAGGAGTGG + Intergenic
995699338 5:114916694-114916716 AACACTATGTTGAAAAGGAGTGG + Intergenic
995736375 5:115304469-115304491 AATAATTTGCTGAAAATGGGTGG + Intergenic
995812708 5:116125890-116125912 AACACTATGCTGAACAGGAGTGG - Intronic
995937066 5:117529627-117529649 AACACTTTGTTGAATAGGAGTGG + Intergenic
996071958 5:119141217-119141239 AATAATATGCTGAATAGGAGTGG - Intronic
996229431 5:121042781-121042803 AACACTATGCTGAATAGGAGTGG + Intergenic
996515254 5:124362351-124362373 AACACTATGTTGAAAAGGAGTGG - Intergenic
996592644 5:125164805-125164827 AACACTATGTTGAAAAGGAGTGG - Intergenic
998769660 5:145527713-145527735 AACAACTTGCTGAAGGTGAGTGG - Intronic
998806665 5:145923569-145923591 AATGATTTGCTGAAATTGAGTGG + Intergenic
999207634 5:149861278-149861300 AACAATTGGCTGAAGCCGAGTGG - Intronic
999927613 5:156396387-156396409 AATATTTTGCTGCTAATGAGAGG - Intronic
1001161256 5:169317026-169317048 AAGTATGTGTTGAAAATGAGTGG - Intergenic
1002013035 5:176299412-176299434 AAAGATTTGCTGAAAGTGAAAGG + Intronic
1202775760 5_GL000208v1_random:69258-69280 AACACTTTGTTGAATAAGAGTGG - Intergenic
1002863016 6:1096732-1096754 ACCAATTTGCAGAAAATAAAAGG - Intergenic
1002997530 6:2300958-2300980 AACACTATGCTGAACAGGAGTGG - Intergenic
1004244454 6:13959753-13959775 AACAATTTGGTGGTAGTGAGAGG + Intronic
1004255664 6:14061494-14061516 AACAATTTGCACAAAATGTTAGG + Intergenic
1004683054 6:17915434-17915456 AATAAATGGCTGAAAATGAGGGG - Intronic
1005193545 6:23256305-23256327 AACACTTTGTTGAATAGGAGTGG + Intergenic
1005764177 6:28994524-28994546 AAAAAATTGCTAAAAATGATTGG + Intergenic
1006549643 6:34811229-34811251 AAAAATCTGCTGAAACTGATTGG - Intronic
1007347650 6:41245022-41245044 AACACTATGTTGAAAAGGAGTGG - Intergenic
1008143838 6:47865365-47865387 AGCAATTTCCTGAAAATTTGTGG + Intergenic
1008190286 6:48447667-48447689 AACAATTTGGTAGAAATGAGTGG - Intergenic
1008345664 6:50423394-50423416 ATCACTTTGCTGTAAATGTGTGG - Intergenic
1008435726 6:51473814-51473836 AAAATTTTGCTTAAAATCAGTGG + Intergenic
1008681000 6:53872221-53872243 ATCAGTTGGCTGTAAATGAGTGG + Intronic
1008769861 6:54965401-54965423 AACACTATGTTGAAAAGGAGTGG - Intergenic
1009051065 6:58277393-58277415 AACACTATGCTGAATAGGAGTGG - Intergenic
1009543654 6:64998680-64998702 AACAATTTGTAGTCAATGAGAGG - Intronic
1009855432 6:69256732-69256754 AACACTATGCTGAATAGGAGTGG + Intronic
1009874144 6:69484301-69484323 AACACTATGCTGAATAAGAGTGG - Intergenic
1010153697 6:72766711-72766733 CACCATTTGCTGGAGATGAGAGG + Intronic
1010605385 6:77883610-77883632 GACACTTTGCTGCAAATGACAGG + Intronic
1010640737 6:78323357-78323379 AACAATTTTGTGTAAAGGAGCGG - Intergenic
1011604829 6:89092861-89092883 AACAAATTGTTAAAAATTAGCGG - Intergenic
1011673491 6:89707971-89707993 AACAAGTAGGTGAAAATGGGAGG + Intronic
1012093319 6:94927907-94927929 AACAATATGCTGAACAGGAGTGG + Intergenic
1012190091 6:96269144-96269166 AACAATTTGCTCACTTTGAGAGG + Intergenic
1012481544 6:99672819-99672841 AACACTATGCTGAATAGGAGTGG + Intergenic
1012777664 6:103518783-103518805 ATAAATTTGGAGAAAATGAGGGG - Intergenic
1012860434 6:104552604-104552626 ATCAATTGACTGTAAATGAGTGG - Intergenic
1013083294 6:106831949-106831971 AACAACTTGCTTCAAATCAGTGG - Intergenic
1013092972 6:106917801-106917823 AACATTTTGCTAAAGATTAGGGG - Intergenic
1013261041 6:108442840-108442862 AACAATCCCCTGGAAATGAGGGG - Intronic
1013391909 6:109693774-109693796 AACCATTTGCTGAAACAAAGAGG - Intronic
1013393180 6:109707199-109707221 AACAATCTGTTAAAAATGATGGG - Intronic
1013453913 6:110312533-110312555 AACATGTTGCTGCAAATGACAGG - Intronic
1013460708 6:110372563-110372585 AATCATTTGCTGATAATGGGTGG - Intergenic
1013885067 6:114953745-114953767 AATACTGTGCTGAAAATGAATGG + Intergenic
1014070756 6:117178954-117178976 AACACTATGTTGAAAAAGAGTGG - Intergenic
1014306490 6:119748964-119748986 AACAATATGTTGAATAGGAGTGG - Intergenic
1014483371 6:121966546-121966568 ATCAATTTACTGTAAATGTGTGG + Intergenic
1014861782 6:126477752-126477774 GACAATTTGCTGAAATTTGGGGG - Intergenic
1016103543 6:140133187-140133209 ATCAATTGGCTGAAAATATGTGG - Intergenic
1016220086 6:141656981-141657003 AACACTTTGATGAAATTAAGTGG + Intergenic
1016252003 6:142054835-142054857 AACAAGTTGTTGCAAATGACAGG - Intergenic
1016655282 6:146511685-146511707 AACACTATGCTGAATAGGAGTGG + Intergenic
1017522769 6:155216458-155216480 AACCATTTGCAGAAATTGCGGGG - Intronic
1017653923 6:156608787-156608809 AACACTATGCTGAATAGGAGCGG - Intergenic
1017672749 6:156781901-156781923 AACAAAATACTGAAAATGATTGG - Intronic
1017901512 6:158722007-158722029 AATAATCTGATGAAAATGAGAGG - Intronic
1018286948 6:162250618-162250640 AACAATTAGATGAAAGTGAATGG - Intronic
1018597618 6:165500129-165500151 AAAAGTTTACTGAAAAGGAGTGG - Intronic
1019012825 6:168855976-168855998 ATCAAATTGCTGAAAACGGGTGG + Intergenic
1020345905 7:7163428-7163450 AACAATATGTTGAATAGGAGTGG - Intronic
1020950303 7:14667616-14667638 AACGATTTGCTTTAAATGAAGGG + Intronic
1020996676 7:15274151-15274173 AACACTATGTTGAAAAGGAGTGG + Intronic
1021143124 7:17052581-17052603 AACACTATGCTGAACAGGAGTGG + Intergenic
1021190638 7:17615772-17615794 AAAAAGATGGTGAAAATGAGTGG + Intergenic
1022365161 7:29706627-29706649 AACAAACTGCTCAAAATCAGTGG - Intergenic
1022409710 7:30129641-30129663 AACAAGTTTCTAAAAATGTGAGG - Intronic
1022583956 7:31587101-31587123 AACACTATGTTGAAAAGGAGTGG - Intronic
1022712174 7:32862379-32862401 AACAACTGGCTAAAATTGAGGGG + Intergenic
1022745773 7:33170565-33170587 AACACTATGCTGAATAGGAGTGG - Intronic
1022845110 7:34202265-34202287 AACACTATGTTGAAAAGGAGTGG + Intergenic
1022911702 7:34905004-34905026 AACAGTTGGCTGAAGTTGAGGGG - Intergenic
1022932624 7:35135685-35135707 AACAAACTGCTCAAAATCAGTGG + Intergenic
1023063068 7:36347813-36347835 TAGAATTTTCTGAAAAGGAGAGG - Intronic
1023858264 7:44199783-44199805 AACACTATGTTGAAAAGGAGTGG + Intergenic
1024892724 7:54222212-54222234 AACACTTTGTTGAATAGGAGTGG - Intergenic
1024901192 7:54320175-54320197 AACACTTTGTTGAATAGGAGTGG + Intergenic
1025474230 7:60899998-60900020 AACAAAATGGTGAAGATGAGTGG - Intergenic
1025480393 7:60976069-60976091 AACAAAATGGTGAAGATGAGTGG - Intergenic
1025512773 7:61589876-61589898 AACAAAATGGTGAAGATGAGTGG + Intergenic
1025717179 7:63970634-63970656 AACAATAGACTGAAAATGGGAGG + Intergenic
1027612773 7:80382853-80382875 ACCAAGTTTCTGAATATGAGTGG + Intronic
1028270130 7:88777862-88777884 AAAAAATTGCAGAAACTGAGAGG + Intronic
1028502981 7:91539477-91539499 AACAAAGTACTAAAAATGAGGGG + Intergenic
1029791787 7:102851031-102851053 AACAGTTTTATGAAAATGAAAGG - Intronic
1029828549 7:103228464-103228486 AACAAACTGCTCAAAATCAGTGG + Intergenic
1030550335 7:110950668-110950690 ATCAACTTACTGACAATGAGGGG + Intronic
1031733876 7:125332154-125332176 AACACTATGTTGAATATGAGTGG - Intergenic
1031827575 7:126585793-126585815 AACACTATGTTGAAAAGGAGTGG - Intronic
1031847870 7:126827740-126827762 AACACTATGTTGAAAAGGAGTGG + Intronic
1031862998 7:127004011-127004033 AAAAATTTACTGAGAATGAAGGG - Intronic
1032005170 7:128296107-128296129 AACACTATGCTGAATAGGAGTGG - Intergenic
1032441167 7:131944191-131944213 AACATCATGCAGAAAATGAGAGG + Intergenic
1032689891 7:134274525-134274547 AACAAGTTGATAAAAATAAGAGG - Intergenic
1033902610 7:146161313-146161335 AACAATATGTTGAATAGGAGTGG - Intronic
1034910127 7:154989554-154989576 AATAATTTGTTTAAAATTAGTGG - Intronic
1035002933 7:155630063-155630085 ATCAAATTGCTAAAAATCAGGGG - Intronic
1035480956 7:159184399-159184421 AACCAATTTCTGAAAATGAAGGG - Intergenic
1035587624 8:787889-787911 ATCAATTTGGTGAAAATTAGAGG - Intergenic
1035975748 8:4309152-4309174 AACAACTTTCTGAAGATGTGTGG + Intronic
1036886681 8:12561994-12562016 CCCAATTAGCTGAAAATGACAGG - Intergenic
1037033661 8:14140282-14140304 AACAGTATGTTGAATATGAGTGG - Intronic
1037572883 8:20173320-20173342 AACAATATTCTGAACAGGAGTGG - Intronic
1038861190 8:31390660-31390682 AAGAATTTCCTGAAAATGGAAGG + Intergenic
1038866435 8:31443487-31443509 AACACTATGCTGAATAGGAGTGG - Intergenic
1038877665 8:31569459-31569481 AACACTATGCTGAATAGGAGTGG - Intergenic
1039205552 8:35149261-35149283 AAAAATTTACTGAAATTGAGAGG - Intergenic
1039334228 8:36572296-36572318 ACCAATTTGTTGGAAAAGAGAGG + Intergenic
1039553018 8:38456886-38456908 AACAATTTTCTGGAAGTCAGAGG + Intronic
1039578938 8:38648239-38648261 ATTAGTCTGCTGAAAATGAGAGG - Intergenic
1039731485 8:40283492-40283514 AACACTTTGCTGACAAACAGAGG - Intergenic
1041221125 8:55652196-55652218 AACACTATGCTGAATAGGAGTGG + Intergenic
1041491973 8:58443148-58443170 AGAAATTTGCTGAGAGTGAGGGG - Intronic
1041622230 8:59985202-59985224 ATCAATTTGCTATAAATGTGTGG + Intergenic
1042581142 8:70280436-70280458 ATCAATTTGCTGAAATTGAAGGG + Intronic
1043351845 8:79371119-79371141 AACACTATGCTGAATAGGAGTGG - Intergenic
1043405037 8:79921811-79921833 AACACTATGTTGAAAAGGAGTGG + Intronic
1043412812 8:80016714-80016736 AACAATTTGCTAATAATAAAAGG + Intronic
1044909434 8:97041513-97041535 AACACTATGCTGAATAGGAGTGG + Intronic
1045587179 8:103551562-103551584 AACACTATGCTGAATAGGAGTGG - Intronic
1045825440 8:106391973-106391995 AATTATTTGCTGAGGATGAGAGG - Intronic
1045991930 8:108317740-108317762 AACAATTTGCAGAAAATAAAGGG - Intronic
1046267442 8:111848584-111848606 ATCAATTGGCTGTAAATGTGTGG + Intergenic
1046325482 8:112639008-112639030 TTAAATTTTCTGAAAATGAGAGG + Intronic
1046496741 8:115024091-115024113 AACAATATGTTGAATAGGAGTGG + Intergenic
1048115957 8:131522743-131522765 AACAATTGACTGTAAATGTGTGG - Intergenic
1048690510 8:136956971-136956993 AAAACTTTGCTGAAAATCAATGG - Intergenic
1050773290 9:9230765-9230787 ATCAATTGGCTGAAAATAAGAGG + Intronic
1050900699 9:10945119-10945141 AACAAATTTGTGAAAATGAATGG + Intergenic
1051090007 9:13395593-13395615 AACAATTTTCTCCAGATGAGAGG + Intergenic
1051409210 9:16771274-16771296 ATCAATTTGCTGAGACTGATAGG + Intronic
1051461931 9:17328436-17328458 AACAATTGGCTGGAGTTGAGCGG + Intronic
1051897234 9:22000210-22000232 AACAATTTTCTGAAATGGAAGGG + Intronic
1052239445 9:26253747-26253769 AACACTTTGTTGAATAGGAGTGG - Intergenic
1052383232 9:27794376-27794398 AACAATATGTTGAATAGGAGGGG - Intergenic
1052485720 9:29096828-29096850 AACATTTTGGTGAATATGAAAGG - Intergenic
1053056722 9:34997381-34997403 AACATTTTCCTGAAAACCAGTGG - Exonic
1053649400 9:40149005-40149027 AACACTATGTTGAATATGAGTGG + Intergenic
1053689134 9:40573348-40573370 AACACTTTTCTAAAAATAAGAGG + Intergenic
1053756348 9:41314879-41314901 AACACTATGTTGAATATGAGTGG - Intergenic
1054165448 9:61722631-61722653 AACACTATGTTGAAAAGGAGTGG - Intergenic
1054274899 9:63057718-63057740 AACACTTTTCTAAAAATAAGAGG - Intergenic
1054300378 9:63374280-63374302 AACACTTTTCTAAAAATAAGAGG + Intergenic
1054399926 9:64707211-64707233 AACACTTTTCTAAAAATAAGAGG + Intergenic
1054433514 9:65191472-65191494 AACACTTTTCTAAAAATAAGAGG + Intergenic
1054496871 9:65830197-65830219 AACACTTTTCTAAAAATAAGAGG - Intergenic
1054535181 9:66227168-66227190 AACACTATGTTGAATATGAGTGG - Intergenic
1054794334 9:69285544-69285566 AATACTATGCTGAAAAGGAGTGG + Intergenic
1054886905 9:70208662-70208684 AACACTATGCTGAATAGGAGTGG + Intronic
1055092748 9:72379339-72379361 AACAAATTGCAGAGTATGAGTGG + Intergenic
1055451001 9:76431368-76431390 AGCAAGTTACTGAAACTGAGTGG - Intronic
1055684740 9:78759467-78759489 ATCAATTGGCTGTAAATAAGTGG - Intergenic
1056239200 9:84627254-84627276 AACACTATGCTGAATAGGAGTGG - Intergenic
1056862402 9:90198045-90198067 GACAGTTTGCTGAGAATGATGGG - Intergenic
1058796938 9:108507934-108507956 AACACTATGTTGAATATGAGTGG - Intergenic
1059786852 9:117595854-117595876 AACAAATTCCTGAAAATGGTGGG - Intergenic
1059792866 9:117659594-117659616 AACACTTTGTTGAATAGGAGTGG + Intergenic
1060020210 9:120123537-120123559 AACACTATGCTGAATAGGAGGGG + Intergenic
1202785773 9_KI270719v1_random:17231-17253 AACACTATGTTGAATATGAGTGG - Intergenic
1203517817 Un_GL000213v1:19622-19644 AACACTATGTTGAACATGAGTGG + Intergenic
1203387538 Un_KI270438v1:69122-69144 AACAATTTGGTGAAGTGGAGAGG + Intergenic
1203354298 Un_KI270442v1:117565-117587 AACACTATGTTGAATATGAGTGG - Intergenic
1203581330 Un_KI270746v1:8724-8746 AACAAAATGGGGAAAATGAGTGG - Intergenic
1186805231 X:13134349-13134371 AACACTATGCTGAATAGGAGTGG + Intergenic
1187640430 X:21282609-21282631 AATACTGTGCTGAATATGAGTGG - Intergenic
1189120674 X:38391115-38391137 AATAGTTTGCTGAGAATGATGGG - Intronic
1189765056 X:44362978-44363000 GATAGTTTGCTGAGAATGAGGGG - Intergenic
1189871553 X:45388579-45388601 ATCAATTTGCTGTAAATGCCTGG + Intergenic
1189886687 X:45553654-45553676 AACAATCTGCTGGCAATTAGTGG - Intergenic
1191266481 X:58399736-58399758 AACACTATGCTGAATAGGAGTGG - Intergenic
1191589572 X:62867469-62867491 AACACTATGCTGAATAGGAGTGG + Intergenic
1191756963 X:64603473-64603495 AACAATATGTTGAATAGGAGTGG + Intergenic
1191776299 X:64817888-64817910 AAAAATATGTTGAATATGAGTGG - Intergenic
1191948946 X:66567189-66567211 AACACTATGTTGAAAAGGAGTGG - Intergenic
1191987369 X:66996660-66996682 AAAAATATGCTTAAAATGAAAGG - Intergenic
1192003867 X:67188489-67188511 AACAATATGTTGAATAGGAGTGG + Intergenic
1192655095 X:72984841-72984863 AACACTTTGTTGAATAGGAGTGG - Intergenic
1192701413 X:73478336-73478358 AACAATATGTTGAATAGGAGTGG + Intergenic
1192789001 X:74362293-74362315 ATCAATTGACTGTAAATGAGAGG - Intergenic
1193038814 X:76982712-76982734 AACACTGTGTTGAAAAGGAGTGG - Intergenic
1193180350 X:78447615-78447637 AACAATATGTTGAATAGGAGTGG + Intergenic
1193280218 X:79640546-79640568 AACACTTTATTAAAAATGAGGGG - Intergenic
1193357847 X:80542766-80542788 AGCAGTTTCCTGAAATTGAGGGG + Intergenic
1193592858 X:83411175-83411197 AACACTATGTTGAACATGAGTGG - Intergenic
1193686972 X:84589146-84589168 ACCCATTTGCTGAAAATAAACGG + Intergenic
1193708145 X:84848226-84848248 AATACTATGCTGAAAAGGAGTGG - Intergenic
1193711087 X:84880789-84880811 AATACTATGCTGAAAAGGAGTGG + Intergenic
1193814967 X:86093924-86093946 AATCAGTTGCTGAAAATAAGAGG + Intergenic
1193928481 X:87521667-87521689 AAGAATTTGAAGCAAATGAGAGG + Intronic
1194191339 X:90840320-90840342 AACACTATGTTGAAAAGGAGTGG - Intergenic
1194286133 X:92012993-92013015 AACACTATGTTGAAAAGGAGTGG - Intronic
1194315404 X:92370016-92370038 AACAATTTTTTGTAAATGATTGG - Intronic
1194697699 X:97075637-97075659 AATAGCTTGCTGAAAATTAGTGG + Intronic
1194785518 X:98079188-98079210 AATAATTTGCTAAAAAATAGTGG + Intergenic
1195486394 X:105412378-105412400 ACCAAGTTGCTGTAAATGACAGG - Intronic
1195661005 X:107378052-107378074 AACACTATGTTGAAAAGGAGTGG + Intergenic
1195915956 X:109935685-109935707 ACCAATTGGCTGAAAATAGGAGG + Intergenic
1196180662 X:112686294-112686316 AACACTATGCTGAATAGGAGTGG + Intergenic
1196734295 X:118971302-118971324 AACTACTAGTTGAAAATGAGGGG + Intergenic
1197464004 X:126781248-126781270 AGGAATTTGCTGAAATTAAGAGG + Intergenic
1197617128 X:128705676-128705698 TCCATGTTGCTGAAAATGAGAGG + Intergenic
1197862136 X:130982371-130982393 CAGAACTTGCTGAAGATGAGAGG + Intergenic
1198643578 X:138782271-138782293 AACACTTTGTTGAATAGGAGTGG - Intronic
1199221665 X:145323176-145323198 AACACTATGTTGAAAAGGAGTGG + Intergenic
1200537990 Y:4422735-4422757 AACACTATGTTGAAAAGGAGTGG - Intergenic
1200623454 Y:5481551-5481573 AACAATTTTTTGTAAATGATTGG - Intronic
1200903310 Y:8455464-8455486 AACAATATGTTGAATAGGAGTGG + Intergenic
1201536066 Y:15049714-15049736 AACACTATGTTGAAAAGGAGTGG + Intergenic
1201545254 Y:15154929-15154951 AACACTATGTTGAAAAGGAGTGG + Intergenic
1201586957 Y:15571677-15571699 AACACTATGTTGAATATGAGTGG + Intergenic
1201698856 Y:16857925-16857947 AACAATATGTTGAATAGGAGTGG - Intergenic
1201923359 Y:19258515-19258537 AACAATATGTTGAATAGGAGTGG - Intergenic
1201933043 Y:19375313-19375335 AACACTTTGTTGAATAGGAGTGG + Intergenic
1202068515 Y:20966144-20966166 AACACTATGCTGAATAAGAGTGG - Intergenic
1202327662 Y:23708578-23708600 AACACTGTGTTGAATATGAGTGG - Intergenic
1202543108 Y:25961474-25961496 AACACTGTGTTGAATATGAGTGG + Intergenic
1202602278 Y:26605878-26605900 AACATTATGCTGAATAGGAGTGG - Intergenic