ID: 1130365251

View in Genome Browser
Species Human (GRCh38)
Location 15:83232188-83232210
Sequence GGTATATAGAGACCACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130365248_1130365251 1 Left 1130365248 15:83232164-83232186 CCCTGATTCTTTTTAGTGGGTAA No data
Right 1130365251 15:83232188-83232210 GGTATATAGAGACCACAATCTGG No data
1130365249_1130365251 0 Left 1130365249 15:83232165-83232187 CCTGATTCTTTTTAGTGGGTAAA No data
Right 1130365251 15:83232188-83232210 GGTATATAGAGACCACAATCTGG No data
1130365245_1130365251 9 Left 1130365245 15:83232156-83232178 CCTAGAAGCCCTGATTCTTTTTA No data
Right 1130365251 15:83232188-83232210 GGTATATAGAGACCACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130365251 Original CRISPR GGTATATAGAGACCACAATC TGG Intergenic
No off target data available for this crispr