ID: 1130370842

View in Genome Browser
Species Human (GRCh38)
Location 15:83284443-83284465
Sequence CGCTGGGCTCCGGCTCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370842_1130370855 25 Left 1130370842 15:83284443-83284465 CCCACGGGAGCCGGAGCCCAGCG 0: 1
1: 0
2: 2
3: 14
4: 144
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1130370842_1130370857 29 Left 1130370842 15:83284443-83284465 CCCACGGGAGCCGGAGCCCAGCG 0: 1
1: 0
2: 2
3: 14
4: 144
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370842_1130370856 28 Left 1130370842 15:83284443-83284465 CCCACGGGAGCCGGAGCCCAGCG 0: 1
1: 0
2: 2
3: 14
4: 144
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370842 Original CRISPR CGCTGGGCTCCGGCTCCCGT GGG (reversed) Intronic
900100768 1:961093-961115 CGCTGCGCCCCTGCTCCCCTGGG - Intronic
901242663 1:7704311-7704333 CGCGGGGCTCCGGGGGCCGTCGG + Intronic
903034884 1:20486761-20486783 CGCTGGACTCCGGCTCCCGCAGG + Intergenic
903876014 1:26473178-26473200 CGCTGGGCTCCGCCTCCGGAGGG + Intronic
906481652 1:46203369-46203391 CGCCGGGGACCGGCTCCCGGGGG - Exonic
906704684 1:47886350-47886372 CACTCGGCTCGGGCTCCCGTGGG + Intronic
914673237 1:149887832-149887854 CGCTGGTCTCCAGTTCCCGGTGG - Exonic
918514065 1:185343086-185343108 CCCTGGGCTCCGTCTCCAGAGGG - Intergenic
922193459 1:223339811-223339833 GGCTGGGCCCCGGCTCCCCCAGG + Intronic
922705597 1:227788586-227788608 CGCGGGGCTCCGGCAGCCGGAGG - Intergenic
1070819666 10:79347556-79347578 CGCTGCGCTGCGGCTCCCGCTGG + Exonic
1072971447 10:100021011-100021033 CGCTGGTCCCTGGCTCCCGCTGG + Intergenic
1075472583 10:122704005-122704027 CCCTGGGCTCTGGCTCCCTCTGG + Intergenic
1076824208 10:132959140-132959162 CGCTGGAATCCCGCTGCCGTGGG - Intergenic
1076827006 10:132974142-132974164 CCCTGGGCTCTCGCTCCTGTGGG + Intergenic
1077027932 11:450010-450032 GGCTGGGCTCCGGGATCCGTCGG + Intronic
1077100340 11:819684-819706 CGCCGGGCCCCGGGTTCCGTGGG - Exonic
1077259563 11:1608663-1608685 CACTGGGCTCCCTCTCCAGTGGG + Intergenic
1077361183 11:2140747-2140769 CGCTCGTCTCCGGCTGCCGCCGG - Intronic
1077374243 11:2198172-2198194 CCCTGGGCTTCAGCTCCCCTGGG + Intergenic
1080383915 11:31799301-31799323 CGCGGGGCCCGGGCTCCCCTGGG - Intronic
1083885199 11:65570119-65570141 CGCTGGCCTCCGCCTCCCCTGGG - Intergenic
1083891810 11:65599394-65599416 CGCGGGGCTCCTCCTCACGTCGG + Exonic
1083903001 11:65652702-65652724 CACGGGGCTCCGGCTCCGGGGGG - Intergenic
1084070148 11:66728422-66728444 CGCAGGCCGCCGGCTCCCGCGGG + Intronic
1084441878 11:69179240-69179262 TGCTGGGCACCAGCTCCCATGGG - Intergenic
1084673091 11:70619078-70619100 GGCTGGGGTCCGCCTCCCCTGGG - Intronic
1085204945 11:74725954-74725976 CTCTGGGCTCTGGCACCCGGTGG + Intronic
1090978527 11:131696091-131696113 CCCTGGGGGCCGGCTCCCTTTGG - Intronic
1093767638 12:22982853-22982875 CGCTAGGCTCCGTCCCTCGTGGG - Intergenic
1102476590 12:113192528-113192550 CGCTGGACTCTTCCTCCCGTCGG + Intergenic
1104034932 12:125091600-125091622 CGCTGCTGTCCGGCTCCCCTGGG - Intronic
1104644331 12:130486278-130486300 CCCTGGACTCTGGCCCCCGTGGG + Intronic
1104747474 12:131219440-131219462 CACTGGGCTCCGACTTCCTTGGG + Intergenic
1106382769 13:29256239-29256261 CACTGGGCACCAGCTCCCCTTGG - Intronic
1113536322 13:111069228-111069250 CGCTGGGTTCAGCCTCCTGTTGG - Intergenic
1123412981 15:20074348-20074370 CCTGGGGCCCCGGCTCCCGTGGG + Intergenic
1123522323 15:21081461-21081483 CCTGGGGCCCCGGCTCCCGTGGG + Intergenic
1127089996 15:55457405-55457427 GTCTGGGCTCAGGCTCCCCTTGG - Intronic
1128455152 15:67827850-67827872 CGCTGGGCTCGGTCTCCTCTTGG - Exonic
1130046707 15:80451323-80451345 CGCTGAGCTCCAGCCCCTGTGGG + Intronic
1130370842 15:83284443-83284465 CGCTGGGCTCCGGCTCCCGTGGG - Intronic
1131160651 15:90102590-90102612 CGCCGGGTCCCGGCTCCCGCGGG - Intergenic
1132408870 15:101561794-101561816 AGCTGAGCTCTGGCTTCCGTGGG - Intergenic
1132552859 16:560517-560539 GGGTGGGATGCGGCTCCCGTGGG - Exonic
1132969271 16:2677658-2677680 CACTGCTCTCCAGCTCCCGTGGG + Intergenic
1136110847 16:28063030-28063052 AGCTCGGCTCCGGCTCCCCCGGG - Intronic
1136933445 16:34437647-34437669 AGCGGGGCTGCGGCTCCCGGCGG + Intergenic
1136971127 16:34974167-34974189 AGCGGGGCTGCGGCTCCCGGCGG - Intergenic
1139576816 16:67847138-67847160 CGCGCGGCTCCGCCTCCCGCCGG + Intronic
1141173611 16:81705507-81705529 CGCTGGCCTTCGGCTCCTGTCGG + Exonic
1144787487 17:17840151-17840173 CTCTGCGCCCCGGCTCCCCTGGG - Intergenic
1145110244 17:20156010-20156032 CGCTGCTCTCCCGCGCCCGTGGG - Intronic
1148086696 17:44997939-44997961 CTCTGGGCTGCGGCTCCCCTGGG - Intergenic
1148740702 17:49890845-49890867 CGCTGGCCTCCTGTTCCCGCTGG + Intergenic
1150060467 17:62065007-62065029 CGCAGGGCGCCGGCTCCGGCTGG + Intronic
1151287878 17:73126428-73126450 CACTGGGCTCTAGCCCCCGTGGG + Intergenic
1151871267 17:76838466-76838488 CTCTGGGCTCCGGCTGTTGTAGG + Intergenic
1156473903 18:37394074-37394096 CGCTGGGCTCCGAGACCCGCGGG + Intronic
1160923116 19:1529750-1529772 CTCTGGCCGCCGGCTCCCCTCGG - Exonic
1161235755 19:3197215-3197237 CGCTGGGCTCCGCATCCCATGGG + Intronic
1161274690 19:3409300-3409322 GGCTGGGCTCCTTCTCCCGCTGG + Intronic
1163441298 19:17323823-17323845 CGCGGGGCTCCGGCTGCGGCGGG + Exonic
1164676113 19:30102878-30102900 CACTGGGCTCCGGCTTCCAAGGG + Intergenic
1165721519 19:38082527-38082549 CGGGGGGCTCCGGCCCTCGTCGG - Exonic
1166290566 19:41860617-41860639 CGCCGGGCTCCGGCTCCTGCGGG - Intronic
1167611789 19:50511258-50511280 CGCCGGACTACGACTCCCGTGGG + Exonic
925349022 2:3188395-3188417 CTCTGGGCTCCATCTCCCTTAGG - Intergenic
925918854 2:8625771-8625793 GGCTGGGCTCGGGCTCCTGGGGG - Intergenic
926061464 2:9807598-9807620 TGCTGGGCTCTGGCTGCAGTGGG - Intergenic
930671993 2:54161060-54161082 CCCTGGGCTCCGGATTCAGTAGG - Intronic
930781042 2:55224977-55224999 AGCTGGACTCCAGCTCCCCTGGG - Intronic
932731106 2:74222534-74222556 CCCTGTGCTCCAGCTCCGGTGGG + Intronic
934710006 2:96508529-96508551 GGCTGGGCTCCCGGTCCCGCTGG - Intergenic
938796048 2:134718938-134718960 CGCGGGGCTGCGGATCCCGGCGG + Exonic
939183707 2:138834684-138834706 CTCTGAGCTCCTGCTCCTGTTGG + Intergenic
941397971 2:164995108-164995130 CGCGGAGCTCCGGTTCCCGCTGG + Intergenic
942116716 2:172735720-172735742 CGCTGCACTGCGGCGCCCGTGGG - Intronic
942284034 2:174395899-174395921 AGCTGGGCTCCGGAGCCCCTCGG - Intronic
946399444 2:219460872-219460894 GGCTGGGCTCCTGCTCCCTGGGG + Intronic
947542755 2:230990279-230990301 CTCTGGGCTCGGGCTTCCGTTGG - Intergenic
948115839 2:235494031-235494053 CGCAGGGCTCCGGCCCACGTCGG - Intergenic
948801345 2:240435044-240435066 CGCTGGGCTCCGGCTCGCACCGG - Intergenic
948854030 2:240721753-240721775 CGCAGGGCTCGGGCTCCCATAGG - Intronic
1169200645 20:3707529-3707551 CTCTGGGCTCCAGTTCCTGTTGG - Intergenic
1174556055 20:51396564-51396586 GGCTGGGCCCAGGCTCTCGTGGG - Intronic
1175364700 20:58444610-58444632 TGCTGGGCTCCAGCTCCCCAAGG - Exonic
1175421771 20:58839470-58839492 AGGTGGGCGCAGGCTCCCGTGGG - Intergenic
1176410231 21:6445769-6445791 CGCTGGGCTCCAGCCACCCTGGG - Intergenic
1178350980 21:31873171-31873193 CGCTGGGCGGCCGCTCCCGCCGG - Intergenic
1178498877 21:33109763-33109785 CCCTGCGCTCCGGCGCCCGCAGG + Intergenic
1179685724 21:43054091-43054113 CGCTGGGCTCCAGCCACCCTGGG - Intronic
1180615060 22:17121204-17121226 CGGCGGGCCCCGGCTCCCCTCGG - Exonic
1181155449 22:20917379-20917401 CGCTGGGCCCCGGCTCCCGGCGG - Intergenic
1183749737 22:39713079-39713101 CTCTGGGCTCCCGCTGCAGTGGG - Intergenic
1184607140 22:45580659-45580681 CCCTGGGCTCCGGCTCTGGGCGG - Intronic
1184710136 22:46244938-46244960 AGCTGGACTCCAGCTCCCCTGGG + Exonic
1184874994 22:47268768-47268790 TGCTGGCCTACAGCTCCCGTTGG - Intergenic
1185300394 22:50076969-50076991 CGCTGGCATCCGGCCGCCGTGGG + Intronic
955228464 3:57079370-57079392 CGCCCGGCTCCGGCGCCCGCGGG - Intergenic
959904430 3:111694741-111694763 AGCTGGACTCCGGATCCCTTAGG - Intronic
961594679 3:128006903-128006925 CCCAGGGCTCCGGCTCCCAGAGG + Intergenic
969330342 4:6470992-6471014 CGCGGGGCTCCGGCTCCGCTCGG + Intronic
969373469 4:6748388-6748410 CACTGGCCTGCGGCTCCTGTGGG + Intergenic
972321682 4:37977782-37977804 TGCTGGGTTCGGGCTCCCGCAGG - Intronic
973279245 4:48341852-48341874 TGCAGGGCGCCGGCTCCCTTGGG + Exonic
975118629 4:70705367-70705389 CGCGGAGCTCCGCCTCCCGCGGG + Intronic
983537860 4:168877759-168877781 CGCCGGCCTCCTGCTCCAGTCGG - Intronic
985619930 5:948883-948905 CGCAGAGCTCTGGCCCCCGTGGG + Intergenic
985950686 5:3219542-3219564 GGATGGTCTCCGGCTCCCATGGG - Intergenic
986673796 5:10166639-10166661 CCCTGGGCTCCAGGTCCCTTTGG + Intergenic
990040396 5:51372201-51372223 AGCTGGGCTCCTGCTGCCTTTGG - Intergenic
992473200 5:77077566-77077588 CGCTGCTCTCCAGCTCCCGCCGG + Exonic
993021337 5:82595202-82595224 CGCTGGTCTGGGGCTCCTGTGGG - Intergenic
997338321 5:133123202-133123224 TGCTGGGCACTGGCTCCCGATGG - Intergenic
997627921 5:135343592-135343614 GGCTTGGCTCCAGCTCACGTTGG - Exonic
998503166 5:142651209-142651231 TGGTGGGTTCAGGCTCCCGTGGG - Intronic
1002454918 5:179340361-179340383 CGCTGGGCTGCAGCTCCTATGGG - Intronic
1005466868 6:26124295-26124317 CGCTGGTCTCCAGTTCCCGGTGG + Exonic
1006398155 6:33800470-33800492 CTCTGGGCGCTGGCTCCCATTGG + Intronic
1007421659 6:41723508-41723530 CCCTGGGCTCCGGCCCCTGGAGG - Intronic
1011470323 6:87701789-87701811 CGCTTGGCTCCTGAGCCCGTCGG - Exonic
1011795396 6:90947338-90947360 CGCTTGTCCCCGGCTCCCGCTGG - Intergenic
1014920927 6:127214012-127214034 CGGTGGGCTCCTGGTCCCGCTGG + Intergenic
1017713574 6:157191210-157191232 TGCTGGTGTCCGGCTCCAGTTGG - Intronic
1018686635 6:166308444-166308466 CGCTGGGCTCCTCCTCCTGCCGG - Intronic
1020193208 7:6016537-6016559 TGCTAGGCTCCGGCTCCCTGAGG - Intronic
1020268425 7:6577469-6577491 CGCTGGGCTCCGGCGCCTCCCGG - Intronic
1022629420 7:32071110-32071132 CGCTGGGCTCCGACCCCGGCCGG + Intronic
1024982614 7:55170390-55170412 AGCTGGGCTCCCGCTCTGGTGGG - Intronic
1027196323 7:76033038-76033060 AGCTAGGCTCGGGCTCCAGTTGG + Intronic
1028622200 7:92836687-92836709 CGCTGGGCTCCGGCCGGCGCTGG + Intergenic
1030033328 7:105388501-105388523 CGCTCGGCTCCTGCCCCCGGCGG - Intronic
1031629688 7:124032342-124032364 CGCCGGGCTCCGGCCGCAGTAGG + Exonic
1033657119 7:143381710-143381732 CGCTGGGCCCCGGGTGCCGGGGG - Exonic
1034274232 7:149817041-149817063 AGCTGGGCCCCGGCTGCCGCTGG - Intergenic
1034302389 7:150028245-150028267 CACAGGGCTCCAGCCCCCGTGGG - Intergenic
1034803672 7:154069073-154069095 CACAGGGCTCCAGCCCCCGTGGG + Intronic
1035221529 7:157409301-157409323 GGCGGGGCTGTGGCTCCCGTGGG + Intronic
1038474629 8:27856528-27856550 CGCAAGGCTCCCTCTCCCGTCGG + Intergenic
1041258659 8:56001184-56001206 CGCTGGCCTCCTGCTCCTGTTGG - Intronic
1049391665 8:142374854-142374876 CGCTGGCCTCGGGCTGCCCTGGG + Intronic
1049475582 8:142795628-142795650 CGCTGGACTCCTGCTCCAGAAGG - Intergenic
1053123200 9:35561026-35561048 CCTTGGGCTCTGGCTCCCGGCGG - Exonic
1055321587 9:75088196-75088218 CGCCGGGTTCCAGCCCCCGTTGG + Exonic
1056315406 9:85384511-85384533 CGCTGGGTTCAGGCTCTCTTGGG + Intergenic
1056768311 9:89459021-89459043 TGCTGGGCTGCAGCTCCCTTGGG - Intronic
1058884429 9:109312806-109312828 CCCTGGGCTCCGGGTTCCTTGGG - Intronic
1058967160 9:110048833-110048855 CTCTGGGCGCCCGCTCCCGGGGG - Exonic
1059739473 9:117135706-117135728 TGCTGGGCTGCGGCTGCGGTAGG + Intronic
1061821372 9:133228678-133228700 AGCTGGGCTCAGGATCCCCTGGG + Intergenic
1061834070 9:133317685-133317707 CGCTGGGCTCAGGATCCCCCGGG - Intergenic
1062111616 9:134785153-134785175 CCATGGCCTCGGGCTCCCGTTGG + Intronic
1062228216 9:135465799-135465821 AGCTGGGCTCAGGCTCCTGGGGG - Intergenic
1062237869 9:135521386-135521408 CGCTGGGCTCAGGGTCCCCCAGG - Intergenic
1062271480 9:135711782-135711804 CGCTGGGCGCCGGCCACCCTGGG + Intronic
1062314776 9:135961276-135961298 CGCCCCGCCCCGGCTCCCGTCGG + Exonic
1192809479 X:74536373-74536395 CGCTGGCCTCCGGCCACCTTGGG + Intergenic
1197980951 X:132217773-132217795 TTCTGGGCCCCGGCTCCCGCGGG + Exonic
1198215306 X:134549730-134549752 CGCTCGGCTCCGGGGCCCGGGGG + Intergenic
1200082811 X:153587509-153587531 GGGTGGGCTCCGGCTCCTGCAGG - Intergenic