ID: 1130370843

View in Genome Browser
Species Human (GRCh38)
Location 15:83284444-83284466
Sequence CCGCTGGGCTCCGGCTCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370843_1130370857 28 Left 1130370843 15:83284444-83284466 CCACGGGAGCCGGAGCCCAGCGG 0: 1
1: 1
2: 0
3: 27
4: 247
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370843_1130370856 27 Left 1130370843 15:83284444-83284466 CCACGGGAGCCGGAGCCCAGCGG 0: 1
1: 1
2: 0
3: 27
4: 247
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370843_1130370855 24 Left 1130370843 15:83284444-83284466 CCACGGGAGCCGGAGCCCAGCGG 0: 1
1: 1
2: 0
3: 27
4: 247
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370843 Original CRISPR CCGCTGGGCTCCGGCTCCCG TGG (reversed) Intronic