ID: 1130370843

View in Genome Browser
Species Human (GRCh38)
Location 15:83284444-83284466
Sequence CCGCTGGGCTCCGGCTCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370843_1130370857 28 Left 1130370843 15:83284444-83284466 CCACGGGAGCCGGAGCCCAGCGG 0: 1
1: 1
2: 0
3: 27
4: 247
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370843_1130370856 27 Left 1130370843 15:83284444-83284466 CCACGGGAGCCGGAGCCCAGCGG 0: 1
1: 1
2: 0
3: 27
4: 247
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370843_1130370855 24 Left 1130370843 15:83284444-83284466 CCACGGGAGCCGGAGCCCAGCGG 0: 1
1: 1
2: 0
3: 27
4: 247
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370843 Original CRISPR CCGCTGGGCTCCGGCTCCCG TGG (reversed) Intronic
900095699 1:939289-939311 ATGCTGGGCCCCAGCTCCCGCGG - Exonic
900100769 1:961094-961116 CCGCTGCGCCCCTGCTCCCCTGG - Intronic
900534542 1:3170498-3170520 ACCTTGGGCTCCGGCTCTCGGGG - Intronic
900998594 1:6136134-6136156 GCGGTGGGCTCCGGCCACCGGGG + Intronic
901080484 1:6581090-6581112 CCTCTGGGCTCCTGATCCCTGGG - Exonic
901205957 1:7496057-7496079 CCGCTCCCCTCCGGCTCCCTGGG - Intronic
901242793 1:7704729-7704751 TCGCGGGGCTCCGGGTACCGCGG - Intronic
902585639 1:17437704-17437726 CGCCTCGGCTCCGGCGCCCGGGG - Intronic
903153248 1:21428110-21428132 CCGCCCGGCCCCGGCTCCCCGGG - Intergenic
903485720 1:23688431-23688453 CCGCCGGCCTCGGCCTCCCGGGG + Intergenic
903876013 1:26473177-26473199 GCGCTGGGCTCCGCCTCCGGAGG + Intronic
903961982 1:27063656-27063678 CCGCCGGCCTCGGCCTCCCGAGG + Intergenic
904252732 1:29236575-29236597 GGGCTGGGCTCGGGCTCCGGGGG + Exonic
904499557 1:30906343-30906365 CCTCTGGGCTCAGACTCCCAGGG + Intronic
905207268 1:36350012-36350034 CCGCCTGGATGCGGCTCCCGGGG - Intronic
905390816 1:37634497-37634519 CCGCCGCGCCCCAGCTCCCGGGG + Intronic
906034821 1:42743746-42743768 CCGCTGGTCTCTGGCGCCCCAGG - Intergenic
906481653 1:46203370-46203392 ACGCCGGGGACCGGCTCCCGGGG - Exonic
906704683 1:47886349-47886371 CCACTCGGCTCGGGCTCCCGTGG + Intronic
907069208 1:51519009-51519031 CAGGGGGGCTCCGGCTCCGGAGG + Intronic
908132047 1:61083325-61083347 CCGTTGGGCGCAGGCACCCGAGG - Intronic
909641262 1:77870836-77870858 CCGCCGGCCTCGGCCTCCCGAGG - Intronic
918514067 1:185343087-185343109 TCCCTGGGCTCCGTCTCCAGAGG - Intergenic
920166566 1:204040507-204040529 CCGCTGGCCTCGGCCTCCCAAGG - Intergenic
921043796 1:211459970-211459992 CCGCCGGCCTCAGCCTCCCGAGG + Intergenic
1063139200 10:3241424-3241446 CAGTTGGGCTCCCGCTCCAGGGG + Intergenic
1063636458 10:7787717-7787739 GCGCGGGGCTGGGGCTCCCGGGG - Intronic
1065993260 10:31032501-31032523 CCCCTGGCTCCCGGCTCCCGCGG + Intergenic
1066126325 10:32346578-32346600 CCGCTGGGCCGCGGCGGCCGGGG + Intronic
1066444655 10:35470725-35470747 CTGCTGGGCTCAGGCTTCCCTGG + Intronic
1072654192 10:97319260-97319282 CGGCAGGATTCCGGCTCCCGCGG + Exonic
1074587886 10:114786738-114786760 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1074780825 10:116800713-116800735 CTGCTGGGCTCAGGCTACCCTGG - Intergenic
1075096289 10:119473772-119473794 CAGCAGGGCTGCGGCTCCCAGGG - Intergenic
1075629750 10:123993955-123993977 CCGCTGGGCTCCGACACCCCTGG - Intergenic
1076827004 10:132974141-132974163 CCCCTGGGCTCTCGCTCCTGTGG + Intergenic
1077100341 11:819685-819707 CCGCCGGGCCCCGGGTTCCGTGG - Exonic
1077252229 11:1565803-1565825 TGGCTGGGGACCGGCTCCCGAGG - Exonic
1077364014 11:2154297-2154319 ACGCTGGGCTCCTGCTTCCAGGG - Intronic
1077374241 11:2198171-2198193 CCCCTGGGCTTCAGCTCCCCTGG + Intergenic
1078514321 11:12009276-12009298 CCGCCGCGCTCCCGCACCCGCGG - Intronic
1080283789 11:30586049-30586071 GGGCTGCGCTCCGGATCCCGGGG + Intronic
1083885200 11:65570120-65570142 CCGCTGGCCTCCGCCTCCCCTGG - Intergenic
1083903002 11:65652703-65652725 CCACGGGGCTCCGGCTCCGGGGG - Intergenic
1083913971 11:65728053-65728075 CAGCTGAGCTCGGCCTCCCGGGG + Intergenic
1084070147 11:66728421-66728443 CCGCAGGCCGCCGGCTCCCGCGG + Intronic
1085266487 11:75240797-75240819 GCGCCGGCCTCCGGCTTCCGCGG - Intergenic
1089262414 11:117232179-117232201 CGCCCGGGGTCCGGCTCCCGCGG + Exonic
1089589493 11:119531390-119531412 CAGCAGGGCTCCTGCTCCCCTGG - Intergenic
1089966253 11:122656561-122656583 CCGCAGGGCCCCGCCTCCCTAGG - Intronic
1092144379 12:6204478-6204500 CAGCTGGGCTCTTGCTCCAGAGG - Intronic
1093547893 12:20369396-20369418 CCGCGGGACTCGGGCTGCCGTGG + Exonic
1093767639 12:22982854-22982876 CCGCTAGGCTCCGTCCCTCGTGG - Intergenic
1096251104 12:50033123-50033145 TCGCTGGGTTCCGCCTCCCATGG + Intronic
1096995045 12:55833176-55833198 CAGCAGGGCTCCGGCACCCAAGG - Intergenic
1101381307 12:104216061-104216083 CCGCCGGCCTCCGTCTCCCGGGG - Intronic
1104029022 12:125050628-125050650 CCGCCGGGCTCTGGTCCCCGTGG - Intergenic
1104747473 12:131219439-131219461 CCACTGGGCTCCGACTTCCTTGG + Intergenic
1104835329 12:131786541-131786563 CCCCAGGGCTGCGGCTCACGCGG - Exonic
1104861550 12:131926818-131926840 CCGCCAGCCTCCGCCTCCCGAGG - Intergenic
1105604221 13:21913405-21913427 CAGCTGGGCTGCAGCTCCCAAGG + Intergenic
1109204590 13:59467212-59467234 CCGCTGGGCTCCAGCCCCATAGG - Intergenic
1113254806 13:108495592-108495614 GGGCTGAGCTCCAGCTCCCGGGG - Intergenic
1113378187 13:109783163-109783185 TCGCTGGGCTCAGGCACCCCGGG - Exonic
1114415312 14:22538909-22538931 CCCCTGGGCTCCAGCACTCGGGG + Intergenic
1115566488 14:34629708-34629730 CCGCTCGGCTCCGATTCCCGGGG - Intronic
1122779699 14:104138503-104138525 GGGCGGGGCTCGGGCTCCCGGGG - Intergenic
1123474437 15:20579907-20579929 CCGCCGGCCTCGGCCTCCCGGGG - Intergenic
1123493255 15:20799542-20799564 ACCCTGGACTCTGGCTCCCGAGG + Intergenic
1123549762 15:21368644-21368666 ACCCTGGACTCTGGCTCCCGAGG + Intergenic
1123643575 15:22420446-22420468 CCGCCGGCCTCGGCCTCCCGGGG + Intergenic
1123753077 15:23373477-23373499 CCGCTCGCCTCGGCCTCCCGGGG - Intergenic
1125664222 15:41417366-41417388 CCGGCCGTCTCCGGCTCCCGCGG - Intronic
1129165726 15:73776193-73776215 CCCCTGGGCTGCAGCTCCCTAGG - Intergenic
1129344198 15:74906489-74906511 CCGCTGGGCCTCGGCCCCGGAGG - Intronic
1129453004 15:75661195-75661217 CATCCTGGCTCCGGCTCCCGTGG - Exonic
1129845888 15:78767551-78767573 CAGCTGTGCTCCAGCTCCTGCGG - Exonic
1130255980 15:82326309-82326331 CAGCTGTGCTCCAGCTCCTGCGG + Intergenic
1130370843 15:83284444-83284466 CCGCTGGGCTCCGGCTCCCGTGG - Intronic
1130428496 15:83822947-83822969 CCGCCAGCCTCCGCCTCCCGAGG - Intronic
1130598974 15:85263677-85263699 CAGCTGTGCTCCAGCTCCTGCGG - Intergenic
1131160652 15:90102591-90102613 CCGCCGGGTCCCGGCTCCCGCGG - Intergenic
1202958093 15_KI270727v1_random:95862-95884 ACCCTGGACTCTGGCTCCCGAGG + Intergenic
1132527855 16:426277-426299 CCGCCGCGCTCCGGCCCGCGGGG + Exonic
1132641835 16:981659-981681 CGGCCGGGCTCCGCCTCCGGGGG + Intergenic
1132719803 16:1309964-1309986 CCGCTGGGCTGCGGCCCGAGCGG + Intronic
1132925379 16:2426548-2426570 CCGCTGGGGGCTGGCTCCCATGG + Intergenic
1132969270 16:2677657-2677679 CCACTGCTCTCCAGCTCCCGTGG + Intergenic
1133015297 16:2936928-2936950 CTGCTGGGGTCCGCCTCCTGAGG - Intronic
1134084192 16:11345506-11345528 CCGCGGGGGTGCGGCTTCCGAGG + Exonic
1136110848 16:28063031-28063053 CAGCTCGGCTCCGGCTCCCCCGG - Intronic
1136408985 16:30065621-30065643 CCTCTGGGCTGCGCCTCTCGGGG + Intronic
1136537844 16:30910703-30910725 GCGCTGGGCCCGGGCTCCCAAGG + Intergenic
1138450940 16:57093050-57093072 CAGCTGGGCTCGGACCCCCGAGG - Intronic
1140473937 16:75229305-75229327 CCCCTGGGCTTCGGCTCCTGAGG + Exonic
1142130823 16:88430786-88430808 CCGCGGGGCCCCGGCTTCAGAGG + Exonic
1142285043 16:89168247-89168269 CTGCTGTGCTCCGGCTCTCTGGG - Intergenic
1142304420 16:89277651-89277673 CGGCTGGGGTCAGGCTCGCGGGG + Intronic
1142913323 17:3113359-3113381 CCGCCGGCCTCGGCCTCCCGAGG - Intergenic
1143024480 17:3933448-3933470 GCGCTGGGGTCCGGGTGCCGTGG + Intronic
1143390531 17:6556720-6556742 CCGCTCCGCTCCGGCCCGCGCGG + Intergenic
1143510995 17:7394841-7394863 CCCCTGGGCTCCTCCTCCCAAGG + Exonic
1144660003 17:17061774-17061796 CTGCTGGGCTCCTGCTTCTGAGG - Intronic
1144703050 17:17351088-17351110 CCCCTGGGCTCAGGCACTCGAGG - Intergenic
1145057597 17:19713800-19713822 GCGCTGGGCTCCGGCTGGGGAGG - Intronic
1145110245 17:20156011-20156033 CCGCTGCTCTCCCGCGCCCGTGG - Intronic
1145782362 17:27571488-27571510 CCGCTGGGCTCTGGCCTCAGAGG + Intronic
1145925771 17:28645379-28645401 CCGCGGGGCTCGGGGACCCGCGG + Intronic
1146048998 17:29533593-29533615 CCGCCAGCCTCCGCCTCCCGAGG - Intronic
1147255813 17:39181335-39181357 CCGCCGGCCTCGGGCTCCCAAGG + Intronic
1147611288 17:41803195-41803217 CCGCTGGGCTCCGGAGCCCAGGG - Intronic
1148086697 17:44997940-44997962 CCTCTGGGCTGCGGCTCCCCTGG - Intergenic
1149392049 17:56201966-56201988 CCTCTGTGCTCTGGCTCCCATGG - Intronic
1150229849 17:63543953-63543975 CCACTGGGCTGCAGCTCCCTGGG + Intronic
1151437135 17:74104820-74104842 CCCCTGGGCCCCTGCCCCCGGGG - Intergenic
1151559158 17:74861537-74861559 CGCCCGGGCTCCGGCGCCCGCGG - Intergenic
1152121342 17:78420442-78420464 CGGGTGGGGTCAGGCTCCCGAGG + Intronic
1152552764 17:81038108-81038130 GCGCTGGGCCCGGGCTCCTGTGG - Intronic
1153027304 18:683429-683451 CAGCAGGGCTGCGGCTCCCAGGG + Intronic
1153051292 18:905469-905491 CCGCCGGACTCCGGTTCCCCGGG + Exonic
1153565446 18:6414193-6414215 TCCCTGGGCTCCCGCTCCCGAGG + Intronic
1154450810 18:14474080-14474102 ACCCTGGACTCTGGCTCCCGAGG + Intergenic
1156411090 18:36828930-36828952 CCGTGGGGCGCCGGTTCCCGCGG + Intronic
1156473902 18:37394073-37394095 GCGCTGGGCTCCGAGACCCGCGG + Intronic
1158662659 18:59402649-59402671 CCGCTGTGCTGAGGCTCCCTGGG + Intergenic
1160719095 19:589827-589849 CCGCGAGGCTCCGCCCCCCGCGG + Intergenic
1161235754 19:3197214-3197236 GCGCTGGGCTCCGCATCCCATGG + Intronic
1161685651 19:5701574-5701596 CCGCCGGCCTCGGCCTCCCGAGG + Intronic
1161794962 19:6381232-6381254 CCAGTGGGCACCGGGTCCCGGGG - Intronic
1162153257 19:8660133-8660155 GCCCTGGGCTCCGGCTGCCCAGG + Intergenic
1162378959 19:10320982-10321004 CCGCAGGGTTCCCTCTCCCGGGG - Intronic
1162929886 19:13952571-13952593 CCGCTTCCCTCCGGCTCCCCCGG - Exonic
1163441297 19:17323822-17323844 GCGCGGGGCTCCGGCTGCGGCGG + Exonic
1164676112 19:30102877-30102899 CCACTGGGCTCCGGCTTCCAAGG + Intergenic
1166290567 19:41860618-41860640 ACGCCGGGCTCCGGCTCCTGCGG - Intronic
1166307077 19:41941002-41941024 CCGCCGCGCTCCGCTTCCCGCGG + Intergenic
1166941987 19:46372898-46372920 CTGCTGGGCTCCTGCTCCTGAGG - Intronic
1167975386 19:53222513-53222535 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1168239444 19:55081871-55081893 CCGCCCGGCGCCGGCTCCTGCGG - Exonic
1168327275 19:55544831-55544853 AAGCTGGGCTCCGGCTCCTACGG - Exonic
925285364 2:2712239-2712261 CCTCCGGGCTCCGGCTCTGGAGG + Intergenic
925918855 2:8625772-8625794 TGGCTGGGCTCGGGCTCCTGGGG - Intergenic
926061465 2:9807599-9807621 CTGCTGGGCTCTGGCTGCAGTGG - Intergenic
927181107 2:20447301-20447323 TCGCTGCGCTTCGGCTGCCGCGG - Exonic
927198787 2:20565815-20565837 CAGCAGGGCTCCGGCTCTCTGGG - Intronic
928009609 2:27594883-27594905 CTGCTCGCCTCCGCCTCCCGAGG - Intronic
928723761 2:34148201-34148223 CCGCTTGTCCCCGGCTCCCCTGG + Intergenic
929777582 2:44938576-44938598 CCGCTGGGCCCCGGAACCCAAGG + Intergenic
930753969 2:54957716-54957738 CTCCTGGGCTGCGGCTCCCCCGG + Intronic
932180549 2:69642976-69642998 GGCCTGGGCTCCGGCTCCAGCGG - Exonic
932605466 2:73162923-73162945 CCGCAGGGCTCTGGATCCCCGGG - Intergenic
932731104 2:74222533-74222555 CCCCTGTGCTCCAGCTCCGGTGG + Intronic
933792447 2:85893874-85893896 CAGCTGTGCTCCAGCCCCCGAGG - Intergenic
935692692 2:105745102-105745124 CCGCTGCCCTCCGGCTCCGCGGG + Exonic
935717267 2:105950278-105950300 CCGCTGGCCTCAGCCTCCCAAGG - Intergenic
936972195 2:118186482-118186504 CCGCCAGGCTCCCGCGCCCGTGG + Intergenic
938073133 2:128318733-128318755 CCGCCCGGCCCCGGCTCCCCGGG + Intergenic
940883259 2:158968350-158968372 CCTCTGGGCACCGGGTCCCCCGG - Intergenic
941603330 2:167564615-167564637 CCGCCGGCCTCGGCCTCCCGAGG - Intergenic
942116717 2:172735721-172735743 CCGCTGCACTGCGGCGCCCGTGG - Intronic
944496092 2:200307591-200307613 CCGCTGGGGTCCGCAGCCCGCGG - Intronic
944676072 2:202034727-202034749 CGGCTGCGCCCCGGCGCCCGCGG - Exonic
944801128 2:203238942-203238964 CCGTTGGTTTCCGGGTCCCGCGG + Exonic
946399443 2:219460871-219460893 AGGCTGGGCTCCTGCTCCCTGGG + Intronic
948455186 2:238101534-238101556 CCGCTGGCCACAGGGTCCCGGGG - Intronic
948481191 2:238251625-238251647 TCTCTGGGCTCCGGCTCACTGGG - Exonic
948893253 2:240917017-240917039 CCACTGGGCTGCTGCTCCCAAGG + Intergenic
1168801399 20:645652-645674 GCGCTGCTCTCCGGCCCCCGCGG - Intergenic
1173922313 20:46755534-46755556 CCACTGTGCTCCAGCTGCCGTGG + Intergenic
1175073999 20:56358795-56358817 GCCCTGGACTCCGGCTCCCGAGG + Intergenic
1175421772 20:58839471-58839493 CAGGTGGGCGCAGGCTCCCGTGG - Intergenic
1176202032 20:63865431-63865453 CCGTTGTTCTCCGTCTCCCGGGG + Intronic
1176307014 21:5128861-5128883 CCTCGCGGCTCCGGCTCCCACGG + Intergenic
1176410232 21:6445770-6445792 CCGCTGGGCTCCAGCCACCCTGG - Intergenic
1176445423 21:6816494-6816516 ACCCTGGACTCTGGCTCCCGAGG - Intergenic
1176823591 21:13681527-13681549 ACCCTGGACTCTGGCTCCCGAGG - Intergenic
1179685725 21:43054092-43054114 CCGCTGGGCTCCAGCCACCCTGG - Intronic
1179850045 21:44133169-44133191 CCTCGCGGCTCCGGCTCCCACGG - Intergenic
1180167081 21:46035885-46035907 GGGCAGGGCTGCGGCTCCCGGGG - Intergenic
1183749738 22:39713080-39713102 CCTCTGGGCTCCCGCTGCAGTGG - Intergenic
1184217739 22:43078872-43078894 GCTCTGGGGTGCGGCTCCCGTGG - Intronic
1184217758 22:43078936-43078958 GCTCTGGGGTGCGGCTCCCGTGG - Intronic
1184217777 22:43079000-43079022 GCTCTGGGGTGCGGCTCCCGTGG - Intronic
1184217831 22:43079192-43079214 GCTCTGGGGTGCGGCTCCCGTGG - Intronic
1185300393 22:50076968-50076990 CCGCTGGCATCCGGCCGCCGTGG + Intronic
1185335732 22:50270186-50270208 CCGGTGGGCTCCGGCGCCTACGG - Exonic
950060701 3:10069705-10069727 CCGCTAGCCTCAGCCTCCCGAGG + Intronic
955228465 3:57079371-57079393 TCGCCCGGCTCCGGCGCCCGCGG - Intergenic
961383438 3:126510484-126510506 GCGCTGGGCTCCGGCTCCCGAGG + Intronic
961605798 3:128094556-128094578 CCTCTGGGCTCAGGTTCCAGTGG + Intronic
963091431 3:141487020-141487042 CTGCTGGGCTCCGCCTCGCCCGG + Intergenic
966852035 3:184170450-184170472 TCGCTGGGCGCCCGCTCCCGCGG - Exonic
969373468 4:6748387-6748409 CCACTGGCCTGCGGCTCCTGTGG + Intergenic
970409111 4:15790419-15790441 CCGCCGGCCTCGGCCTCCCGAGG + Intronic
971265320 4:25091687-25091709 CAGCTGGGCTCTGGCTCTCTGGG + Intergenic
972533137 4:39977851-39977873 GCGCGAGGCCCCGGCTCCCGGGG - Exonic
975118628 4:70705366-70705388 CCGCGGAGCTCCGCCTCCCGCGG + Intronic
975585081 4:75940944-75940966 CCGCATGGCTCGGGCTCCAGCGG + Exonic
976068335 4:81215032-81215054 GCGCTGGGCTCCGGCGCCGCAGG - Exonic
981550559 4:145937597-145937619 CCGCCGGGCGGCTGCTCCCGCGG - Intronic
984226715 4:177044175-177044197 CCGCTGGGCTTCATCTCCCAGGG - Intergenic
984730541 4:183064474-183064496 CAGATGGGCTCCAGCTCCAGAGG + Intergenic
984928273 4:184825707-184825729 CCGGAGGCCTCCGGCTGCCGAGG + Intronic
985345694 4:189002087-189002109 CCGCTGGGCACGGCCTCCCAGGG + Intergenic
985564327 5:607771-607793 CCGCTGGGCTCCTGCCGCCCGGG + Intergenic
992487481 5:77210538-77210560 TCGCCGGGCTCCCGCACCCGCGG - Intronic
992540642 5:77760664-77760686 CCGCCTGCCTCGGGCTCCCGAGG + Intronic
992901565 5:81301850-81301872 CTGTTGGGCTCCGGCTGCTGGGG + Exonic
993021338 5:82595203-82595225 CCGCTGGTCTGGGGCTCCTGTGG - Intergenic
996387618 5:122925348-122925370 CCCCTGGGCTCTAGCTCCCTGGG + Intronic
997297470 5:132777076-132777098 CCGCTGGGCCACGGCGCGCGCGG - Intronic
997977396 5:138448417-138448439 CCCCTGGGTTCCGGCTTCCCGGG - Intergenic
999215653 5:149932851-149932873 CCGCCGCCCTCCGGCTCCCAGGG + Intronic
1002291553 5:178204216-178204238 CCGCTGGTCTCTTGCTCTCGAGG - Intergenic
1003128170 6:3372682-3372704 CGGCTGTGCTCCAGCTCCCTGGG - Intronic
1005841697 6:29748263-29748285 CCCCTGGCCTCCCGCTGCCGGGG - Intergenic
1005989314 6:30893265-30893287 CCTCTGGGCTCCAGCTCTGGTGG - Exonic
1006071259 6:31499208-31499230 CCCCTCGCCTCCGGCTCCGGGGG + Intronic
1006814192 6:36839632-36839654 CCGCTGTGCCCCCGCTCCCTGGG - Exonic
1007573755 6:42911578-42911600 CCTGTCCGCTCCGGCTCCCGCGG - Intergenic
1008430476 6:51410726-51410748 TTGCTGAGCTCCGGCGCCCGCGG - Intergenic
1010752596 6:79631611-79631633 CTGCCGGGCGCGGGCTCCCGCGG - Intronic
1011128873 6:84034193-84034215 CCGCTGGGCCCCAGCGGCCGAGG + Intronic
1013131025 6:107232928-107232950 CCCCTGGGCTCAGCCTCCCAAGG + Intronic
1013232278 6:108169239-108169261 CCTCTGAGCCGCGGCTCCCGGGG - Intronic
1015904959 6:138107458-138107480 CCGCGGGGAGGCGGCTCCCGAGG + Exonic
1016614236 6:146028416-146028438 CGGCAGGGCTCAGGCTGCCGCGG + Intronic
1017146593 6:151240626-151240648 CCGCTGGGCTCGGGCTCAGCCGG - Exonic
1017538330 6:155372519-155372541 ATGCTGGGCTCAGCCTCCCGAGG + Intergenic
1018613600 6:165664223-165664245 CCGGTGTGCCCCGGGTCCCGGGG + Intronic
1020347631 7:7182654-7182676 CCGCTGTGCTGCCGCTGCCGGGG + Exonic
1020498768 7:8890202-8890224 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1020831587 7:13102197-13102219 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1024982615 7:55170391-55170413 CAGCTGGGCTCCCGCTCTGGTGG - Intronic
1025815662 7:64908697-64908719 CTGCTGGGCTCTGCCTCCCAGGG + Intronic
1026481998 7:70787334-70787356 GCGCTGCGCTCCAGCTCCCCTGG - Exonic
1029218613 7:98970256-98970278 TCGCTGTTCTCCCGCTCCCGGGG - Exonic
1029495941 7:100895560-100895582 CCTCTGCGCTCCGATTCCCGCGG - Intronic
1030820199 7:114085022-114085044 CCTCTGGGCTGGGGCTCCGGAGG + Intergenic
1032201609 7:129826118-129826140 CTGCTAGGCTCCGGCCCACGAGG + Intergenic
1032443509 7:131960537-131960559 TCAGTGGGCTCCAGCTCCCGAGG - Intergenic
1033657120 7:143381711-143381733 GCGCTGGGCCCCGGGTGCCGGGG - Exonic
1034638979 7:152586985-152587007 CCGCCGGCCTCGGCCTCCCGAGG - Intergenic
1034781641 7:153887228-153887250 CGGCTCGGCCCCGGCTCCGGGGG - Intronic
1035171371 7:157019198-157019220 CAGCTAGGCTCCGCCTCGCGTGG - Intergenic
1035225082 7:157428329-157428351 CCGCTGGGCGCCCACTCCCCAGG - Intergenic
1036570485 8:9975915-9975937 CCACTGGGCTCTGCCTCCCTCGG - Intergenic
1037273638 8:17156254-17156276 CTGCTGGGCGCAGGCCCCCGGGG - Exonic
1038540484 8:28386281-28386303 CCGCTGGGCGCCGGCTGGCAGGG - Intronic
1048980812 8:139702671-139702693 CCGCTGGGCTCCCGCGCCCCGGG - Intronic
1049372613 8:142274943-142274965 GCCCTGGGCTCAGGCTCCCTGGG - Intronic
1049467340 8:142757612-142757634 CACCTGGGCTCCGGCTCTCCCGG + Intergenic
1049643962 8:143727848-143727870 CCGCTGGGCTCCAGGCCGCGGGG + Exonic
1052997290 9:34557957-34557979 CAGCTGAGCACAGGCTCCCGCGG + Exonic
1053010312 9:34629078-34629100 CCGCTCGGGTCCCGCCCCCGCGG - Intergenic
1056601841 9:88052894-88052916 CCACTGGGCTCTGGCTTCCTTGG - Intergenic
1056685281 9:88754043-88754065 CCGGAGGGCTCCAGCTCCAGAGG - Intergenic
1057600138 9:96450486-96450508 CGGCTGGGCTCCTGCCGCCGCGG - Exonic
1058967161 9:110048834-110048856 CCTCTGGGCGCCCGCTCCCGGGG - Exonic
1060776666 9:126379763-126379785 CCAGTGGGCTCAGGCTCCCCAGG - Intronic
1061221223 9:129253367-129253389 CCGCTGGGCGCTGACTCCTGCGG + Intergenic
1061391642 9:130320278-130320300 CCCATGGGCTCCAGCTCCCCAGG - Intronic
1061821371 9:133228677-133228699 CAGCTGGGCTCAGGATCCCCTGG + Intergenic
1061834071 9:133317686-133317708 CCGCTGGGCTCAGGATCCCCCGG - Intergenic
1061857641 9:133451041-133451063 CCACTGGGCTCCGGACCCCACGG - Intronic
1062218552 9:135402309-135402331 CAGCTGGGCACATGCTCCCGGGG - Intergenic
1062228217 9:135465800-135465822 CAGCTGGGCTCAGGCTCCTGGGG - Intergenic
1062491678 9:136807989-136808011 CTGCTCCGCTCCGGCCCCCGCGG - Exonic
1062644866 9:137542688-137542710 ATGCTGGGGTCCGGCTCCCTGGG + Exonic
1203523772 Un_GL000213v1:68031-68053 ACCCTGGACTCTGGCTCCCGAGG + Intergenic
1185505706 X:631182-631204 CCTTTGCGCTCCGGCTCCAGGGG + Intronic
1190881486 X:54495464-54495486 CCGCTTGGCTCCAGCTCCTGGGG + Exonic
1192809478 X:74536372-74536394 CCGCTGGCCTCCGGCCACCTTGG + Intergenic
1197980950 X:132217772-132217794 TTTCTGGGCCCCGGCTCCCGCGG + Exonic
1198215305 X:134549729-134549751 CCGCTCGGCTCCGGGGCCCGGGG + Intergenic
1200162633 X:154017265-154017287 CTGCTGGGCTTCGGCTCCCAGGG + Intronic