ID: 1130370848

View in Genome Browser
Species Human (GRCh38)
Location 15:83284459-83284481
Sequence AGGCGGCCCGGGACGCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370848_1130370863 30 Left 1130370848 15:83284459-83284481 CCCAGCGGCGTCCCGGGCCGCCT 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370848_1130370857 13 Left 1130370848 15:83284459-83284481 CCCAGCGGCGTCCCGGGCCGCCT 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370848_1130370856 12 Left 1130370848 15:83284459-83284481 CCCAGCGGCGTCCCGGGCCGCCT 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370848_1130370855 9 Left 1130370848 15:83284459-83284481 CCCAGCGGCGTCCCGGGCCGCCT 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370848 Original CRISPR AGGCGGCCCGGGACGCCGCT GGG (reversed) Intronic
900349327 1:2227468-2227490 GGGAGGCCCCGGACGCCTCTGGG - Intergenic
901886942 1:12230099-12230121 GGGCGGCCCGGGACACCGACAGG + Exonic
904769051 1:32870864-32870886 AGGCGGCTCGGGGCGGCGCAGGG - Intronic
910277622 1:85465335-85465357 AGGCGGCCGGGGAAGCAGCGAGG + Intronic
913972021 1:143423163-143423185 AGGCAGCTGGGGACGCAGCTGGG + Intergenic
914066402 1:144248776-144248798 AGGCAGCTGGGGACGCAGCTGGG + Intergenic
914112751 1:144717578-144717600 AGGCAGCTGGGGACGCAGCTGGG - Intergenic
920120203 1:203650536-203650558 GCGCGGCCCGGGAAGCAGCTGGG - Intronic
920600800 1:207321879-207321901 CGGCGGCCGGGGAAGCCCCTGGG + Intronic
1064859841 10:19815799-19815821 AGGCGGCCCGGGAGCCAGGTGGG + Intergenic
1068538592 10:58267757-58267779 AGGGGGCCCATGACGCCGCCGGG + Exonic
1069995736 10:72341070-72341092 AGGCGGCCCGGCACGGCCATGGG - Exonic
1071573721 10:86711493-86711515 AGCCGCCCCCGGACTCCGCTTGG - Intronic
1072426745 10:95336615-95336637 AGCCGGCCCGGCAAGCCCCTGGG - Exonic
1075699811 10:124461992-124462014 GTGGGCCCCGGGACGCCGCTGGG + Intronic
1075801714 10:125159002-125159024 AGGCGACCCGCCACGCCGCTGGG + Intronic
1076554431 10:131312215-131312237 AGGCGGCCCCGGACGCTGCTAGG + Intergenic
1076993765 11:288885-288907 AGCCGCCCCGGGACGCAGCTCGG + Intergenic
1077009356 11:373308-373330 AGGAGGCCCGGGACGACACCAGG - Intronic
1077307835 11:1875871-1875893 AGGCAGCTGGGGACGCAGCTGGG - Intronic
1077378252 11:2215674-2215696 AGGGGACCCGGAAGGCCGCTGGG + Intergenic
1081695202 11:45104851-45104873 AGGAGGCCTGGGAAGCTGCTTGG - Intronic
1083039307 11:59670207-59670229 AGGCTGCCTGGGACTCTGCTAGG + Intergenic
1085332701 11:75667314-75667336 AGGTGGCCTGGGAGGCGGCTGGG + Intronic
1086590404 11:88508808-88508830 AGGCGGCTGGGGACGCGGCCCGG - Exonic
1090830029 11:130414769-130414791 ATGCGGCCCGGGAGGCCTGTGGG + Exonic
1094048671 12:26195719-26195741 CGCCGGCCGCGGACGCCGCTGGG + Exonic
1098893324 12:76031414-76031436 AGGCGGCCGTGGGAGCCGCTGGG - Exonic
1108409713 13:50133753-50133775 TGTGGGTCCGGGACGCCGCTCGG + Intronic
1111951474 13:94712216-94712238 AGGCGGCCCGGGGCGCGGCGTGG - Exonic
1112506612 13:99980000-99980022 GGGCGGACGGGGACGCCGCGGGG + Intergenic
1112752568 13:102597240-102597262 GGGCGGCCGGGGACGCGGGTGGG + Intronic
1115398159 14:32933014-32933036 AGCAGGCGCGGGACGCCGCCAGG + Intergenic
1124340393 15:28886327-28886349 GGGCCGCCCGGGGCGCCGCGAGG + Intronic
1125899245 15:43329962-43329984 AGGAGGCCCTGGGCGCCGCGGGG - Exonic
1127547488 15:60004477-60004499 GGGCGGCACGGGACGCTGCGGGG + Exonic
1127982771 15:64046533-64046555 CGGCTGCCCGGGACGGGGCTCGG + Intronic
1128344154 15:66842882-66842904 GGGCGGCCCGGGGCTCCGCGGGG + Intergenic
1128992500 15:72272541-72272563 GAGCGGCCCGGGACGCCCCGCGG + Exonic
1130370848 15:83284459-83284481 AGGCGGCCCGGGACGCCGCTGGG - Intronic
1131825840 15:96322193-96322215 AGGCTGCGCGGGCCGCCGCGGGG - Intergenic
1132398004 15:101488870-101488892 AGGCGGCCGCGGCCGCTGCTTGG - Intronic
1132734633 16:1379385-1379407 AGGCGGCCCGAGCCCGCGCTGGG + Intronic
1133038126 16:3046117-3046139 GGGCGGGCCGGGACCCCGCGGGG + Intergenic
1133276250 16:4640038-4640060 GGGAGGCCCGGGACGCGGCAAGG - Intronic
1137531604 16:49281883-49281905 AGGCGGGCCGGGAGGCGGCGGGG - Intergenic
1137728556 16:50673384-50673406 AGCCGGCCTGGGACCCCGCAGGG - Exonic
1141132219 16:81444548-81444570 GGGCGGGCCGGGACCCCGCGGGG + Intergenic
1142854982 17:2724349-2724371 GGCCGGCCAGGGACGCAGCTCGG - Intergenic
1142990070 17:3724350-3724372 AGGCGGCCGGAGTCGCGGCTGGG - Exonic
1143582880 17:7836591-7836613 AGTCGGCCCGACACGCCCCTCGG - Intergenic
1144496588 17:15749756-15749778 AGGCTGCCCTGGAGCCCGCTGGG + Intergenic
1144606173 17:16667153-16667175 AGGCTGCGCTGGACCCCGCTGGG + Intergenic
1145881784 17:28357531-28357553 AAGAGGGCCGGGACGCCGCGCGG - Intergenic
1146439028 17:32877248-32877270 CGGCGGCCAGGGCCGCGGCTGGG - Intergenic
1146957266 17:36942862-36942884 GGGCCGTCCGGGACGCCCCTGGG + Exonic
1147864818 17:43545456-43545478 GGGCAGCCCAGGACTCCGCTGGG + Intronic
1148323501 17:46771090-46771112 AGGAAGCCCGGGACCCCTCTTGG + Intronic
1151218117 17:72591762-72591784 TGGCGACCGGGGACGCTGCTGGG - Intergenic
1203162371 17_GL000205v2_random:63602-63624 AGCCGGCCCGAGACGCTGCGTGG + Intergenic
1157405897 18:47422687-47422709 AGCCAGCCCGGGCTGCCGCTGGG - Intergenic
1157794168 18:50559813-50559835 AGGCTACCCGGGACGGGGCTCGG + Intergenic
1157794482 18:50560866-50560888 AGCCGGCCCGGGACCCAGCTGGG - Intronic
1160523630 18:79522898-79522920 TGGCGGCCTGGGGCCCCGCTGGG - Intronic
1160807853 19:1000513-1000535 AGGCGCGCCAGGACGCCGCACGG - Exonic
1160824166 19:1071631-1071653 AGGAGCTCCGGGAAGCCGCTGGG - Intronic
1161148610 19:2694853-2694875 TGGAGGCCAGGGACGCTGCTCGG + Intronic
1161400789 19:4065688-4065710 CGGCGGCCCGGGCGGCCGCGCGG - Intronic
1161802608 19:6424488-6424510 AGGCGGCCCGGGAATCCGCAAGG - Exonic
1162471143 19:10872350-10872372 GGGCGGCCCGGGATCCCTCTGGG + Intronic
1164639216 19:29812249-29812271 GGGCGCCCCGCGACGCCGCCCGG - Intronic
1164952083 19:32345522-32345544 CGGCGGCCCGGGACGCCGGTAGG + Intergenic
1167269686 19:48499809-48499831 TGGGGGCCGGGGAGGCCGCTCGG + Exonic
1167609844 19:50501775-50501797 AGGAGGCCCGGGAGGAGGCTGGG - Intergenic
927964892 2:27262553-27262575 CGGCGGCCTGGGACGCCGGCCGG + Intronic
931671545 2:64653316-64653338 AGGCGCCCCCGCCCGCCGCTCGG + Intronic
932087586 2:68775462-68775484 AGGCGGGCCTGGAGCCCGCTGGG + Intronic
933206420 2:79512933-79512955 CAGCGGCCCGGATCGCCGCTAGG - Intronic
934176720 2:89584100-89584122 AGGCAGCTGGGGACGCAGCTGGG + Intergenic
934287026 2:91658460-91658482 AGGCAGCTGGGGACGCAGCTGGG + Intergenic
934571817 2:95377367-95377389 ACACGGCCCTGGATGCCGCTTGG - Intronic
935697973 2:105786460-105786482 AGGTGGCCCTGGCCGCTGCTGGG + Intronic
937933022 2:127220104-127220126 GGGCGGCCGGGGTCGCCGCCGGG - Intergenic
942302073 2:174572043-174572065 AGGCGGCAGGGGAGGCCGGTTGG + Exonic
1169231143 20:3889549-3889571 AGGCGGCCGGGGACCCCGAAGGG + Exonic
1171346699 20:24470703-24470725 AGGCGGCCAGAGGGGCCGCTTGG + Intronic
1173662903 20:44746235-44746257 AGCCGTCCCGGGGCGCCTCTGGG + Intronic
1174365739 20:50055187-50055209 AGGAGGCCCAGGAGGCCGCCTGG + Intergenic
1175215322 20:57389390-57389412 AGGCGGGCCCGGGCGGCGCTGGG + Intergenic
1175889641 20:62310514-62310536 AGGCTGCACGGGAGGCCCCTGGG - Exonic
1175904236 20:62371856-62371878 AGGGGGCCCGGGACCTCCCTGGG + Intergenic
1178922483 21:36747776-36747798 AGGCCGCCCGGGACGGGGCGCGG + Exonic
1179598677 21:42461085-42461107 AAGCTGCCCTGGAAGCCGCTGGG - Intergenic
1181553862 22:23656258-23656280 GGGTGGCCCAGGACCCCGCTGGG - Intergenic
1182294937 22:29307084-29307106 AGCCGGGCCGGGCCGCCGCAGGG - Exonic
1184254457 22:43279135-43279157 AGGCTGCCCCAGACGCTGCTGGG + Intronic
1185105109 22:48864336-48864358 TGGCGACCCTGGACGCAGCTGGG + Intergenic
1185397538 22:50600622-50600644 ACGCGGCCGGGGACGCTGGTTGG - Intronic
954812310 3:53255801-53255823 CGCCGGCCGGGGACGCGGCTCGG - Intronic
963904581 3:150763088-150763110 TCGGGGCCCGGGACGCCGCCGGG - Exonic
969912157 4:10457062-10457084 TGGGGGCCCGGGCCGCGGCTTGG - Intronic
976569766 4:86594544-86594566 AGTCGGCCGGGATCGCCGCTGGG + Exonic
976600634 4:86934972-86934994 CGGCTGCCCGGGACGCCCCGAGG - Intronic
981061135 4:140427072-140427094 AGGGGGCCCGGGGCGCGTCTGGG - Intronic
982707208 4:158723328-158723350 GGGCGGCCCGGGCGGCCACTAGG - Exonic
985064146 4:186104990-186105012 AGGCGGCCCGGGCCGGGGCGAGG - Intronic
986321206 5:6633720-6633742 AGGCGGCCCGCGCCGGCACTCGG - Exonic
986451421 5:7869281-7869303 AGGCGGCCCGGGGCGGGGGTGGG + Intronic
988564763 5:32312471-32312493 TTGCGGCCCGGAACGCCCCTGGG - Intronic
988595358 5:32585762-32585784 AGGGGGCCGGGGACGCCGAGGGG - Intronic
992249822 5:74866047-74866069 CGGTGGCCCGCGTCGCCGCTCGG + Intronic
1001586015 5:172834357-172834379 AGGCGGGCCGCGGCGCCGCGTGG - Exonic
1002045132 5:176537206-176537228 AGGCGGCGCAGGACGCAGCTGGG + Exonic
1003868852 6:10385916-10385938 AGACGGCCGGCGACCCCGCTGGG - Intergenic
1007400173 6:41598835-41598857 AGGCAGCCCGGGCCTCCCCTGGG + Exonic
1007781589 6:44257580-44257602 CGGCGGCCCGGGGCGCTGCGTGG - Intronic
1013117709 6:107115202-107115224 GGGCGGCCCGGGGAGGCGCTGGG + Intronic
1017842502 6:158232758-158232780 GCGCGGCCGGGGAAGCCGCTCGG - Intronic
1019421913 7:954573-954595 AGGCCGCCCGGGATGGCGCAGGG - Intronic
1020278427 7:6637860-6637882 AGGCGGCTCCGGACGCCCCCTGG + Exonic
1020430231 7:8110849-8110871 AGGCGGCCCGAGGCGTCGGTGGG - Intergenic
1027251325 7:76400549-76400571 AGGCGGCCCCGGCAGCGGCTGGG + Exonic
1029494408 7:100889438-100889460 AGGCGGACAGGGCCGCGGCTCGG + Exonic
1029694050 7:102201654-102201676 AGGAGGCCCAGGACGCCCCCGGG + Exonic
1030347965 7:108455301-108455323 AGGGGGCCGGGGGCGGCGCTCGG + Intronic
1032011789 7:128351964-128351986 CGGCGGGCCGGGGCGCCCCTGGG - Exonic
1034257252 7:149731423-149731445 AGGCGGCTGGGGAGGCAGCTGGG - Intronic
1036664639 8:10730619-10730641 CGGCGGCCCGGGACGCAGGGAGG - Intronic
1038507008 8:28093004-28093026 AGGCGGCCCGTGAGGCCCCTAGG - Exonic
1039921309 8:41896264-41896286 GGGCGGCCCGGGACGCGGTGGGG - Intronic
1040291903 8:46129832-46129854 AGCCTGCCCGGGACACCCCTGGG + Intergenic
1040304070 8:46202994-46203016 AGCCTGCCCGGGACACCCCTGGG - Intergenic
1042787744 8:72567897-72567919 AGGCTGCCCAGGACGCGCCTGGG + Exonic
1043502659 8:80873387-80873409 AGGCGGCGCGGGCGGCCGCGCGG - Intronic
1049163087 8:141110232-141110254 AGGGGGCCCTGCACGCCTCTCGG - Intergenic
1049570622 8:143368818-143368840 GGGCGGCCCGCGGCGCGGCTGGG - Intergenic
1053010287 9:34628981-34629003 AGGCGGCCCTGGCCTCGGCTGGG + Intergenic
1061501893 9:131008965-131008987 AAGAGGCCCGGGTCGCCTCTGGG + Intergenic
1189281202 X:39821215-39821237 ACGCGGCCCCGGGCGCCGCTCGG + Intergenic
1189292756 X:39897479-39897501 AGGCAGCCCAGGACGACCCTCGG + Intergenic
1190114791 X:47619533-47619555 GGGCGGCCGGAGAGGCCGCTGGG + Exonic