ID: 1130370849

View in Genome Browser
Species Human (GRCh38)
Location 15:83284460-83284482
Sequence CAGGCGGCCCGGGACGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370849_1130370863 29 Left 1130370849 15:83284460-83284482 CCAGCGGCGTCCCGGGCCGCCTG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370849_1130370857 12 Left 1130370849 15:83284460-83284482 CCAGCGGCGTCCCGGGCCGCCTG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370849_1130370856 11 Left 1130370849 15:83284460-83284482 CCAGCGGCGTCCCGGGCCGCCTG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370849_1130370855 8 Left 1130370849 15:83284460-83284482 CCAGCGGCGTCCCGGGCCGCCTG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370849 Original CRISPR CAGGCGGCCCGGGACGCCGC TGG (reversed) Intronic
900204684 1:1426953-1426975 CAGGAGATCCGGGACGCAGCAGG - Intronic
901628957 1:10638973-10638995 CTGGCGGCCCTGGGCGCCCCCGG - Exonic
901690313 1:10969031-10969053 CAGCCAGCCCGGGACGCCTTGGG - Intronic
904769052 1:32870865-32870887 CAGGCGGCTCGGGGCGGCGCAGG - Intronic
905995989 1:42380877-42380899 CGAGCGGCCCGGGGCGCCGAGGG + Exonic
906198884 1:43946927-43946949 CAGGCCGGCCGGGACGGGGCAGG - Exonic
908477780 1:64505883-64505905 CGGGCGGCCGGGGACGAAGCGGG - Intronic
908572084 1:65420667-65420689 CAGGCTGCCCGGGCCGTGGCAGG + Exonic
913129653 1:115828319-115828341 CGGGCGGACGCGGACGCCGCAGG - Intergenic
915463184 1:156081724-156081746 GGGGCGGCCGGGGGCGCCGCGGG + Exonic
918041486 1:180916601-180916623 CAGGCGGCCTGGGAAGCCTGGGG - Exonic
920102408 1:203525641-203525663 CAGGAGGCCCAGGAAGCTGCTGG + Intergenic
920600799 1:207321878-207321900 CCGGCGGCCGGGGAAGCCCCTGG + Intronic
920913467 1:210238249-210238271 CAGGCAGCCCGGGAAGTCCCTGG - Intronic
922250645 1:223846010-223846032 CAGGCCGCCGGGCGCGCCGCGGG - Intergenic
923171666 1:231422311-231422333 CCGCCCGCCCGGGTCGCCGCGGG - Exonic
1066240104 10:33525125-33525147 CTGGTGGCCCGGGTCGCGGCTGG + Intergenic
1067235062 10:44440019-44440041 CAGGGGGCCCGGGAAGCCCCAGG + Intergenic
1067499103 10:46786207-46786229 CAGGCGCCCCGCCACGACGCTGG + Intergenic
1068538591 10:58267756-58267778 GAGGGGGCCCATGACGCCGCCGG + Exonic
1068544933 10:58334918-58334940 CAGGCGGGGCGGGGCGCGGCGGG + Intergenic
1069719209 10:70539205-70539227 CAGGGGGCCCAGGCCACCGCAGG - Exonic
1069995737 10:72341071-72341093 CAGGCGGCCCGGCACGGCCATGG - Exonic
1075801713 10:125159001-125159023 CAGGCGACCCGCCACGCCGCTGG + Intronic
1076624429 10:131812805-131812827 CAGGCAGCCCTGGGCGCCTCTGG + Intergenic
1076722103 10:132397201-132397223 GGGGCGGCCTGGGACGCGGCGGG + Exonic
1076770775 10:132663115-132663137 CAGGCAACTCGGCACGCCGCAGG + Intronic
1077465179 11:2730593-2730615 CAGGGGGCCTGGGAGGCCCCAGG + Intronic
1078128683 11:8594011-8594033 CGGGCGGCCCGGGGCGCAGCCGG - Intronic
1078222643 11:9364424-9364446 GAGAAGGCCCGGGACGCCGGCGG + Intergenic
1079035291 11:17014696-17014718 CGGGCGGCGCGGGGGGCCGCTGG + Intergenic
1080283416 11:30584538-30584560 CTGGCGGCCCCGGGCTCCGCTGG + Intronic
1083743511 11:64723089-64723111 CGGGCGGGCGGGGACGCGGCGGG - Exonic
1084204512 11:67584010-67584032 CAGGGGGCCCGGAGCGCCTCGGG + Intronic
1087241716 11:95789157-95789179 CAGGCGGCCCAGGAGGGTGCCGG - Intronic
1089533855 11:119149219-119149241 CCGGCGGCCCGGGCCGGGGCGGG - Exonic
1090596555 11:128327001-128327023 CAGGCGGCCCCAGAGGCCGTGGG + Intergenic
1090830028 11:130414768-130414790 CATGCGGCCCGGGAGGCCTGTGG + Exonic
1094048670 12:26195718-26195740 CCGCCGGCCGCGGACGCCGCTGG + Exonic
1097929709 12:65170113-65170135 CTGGCGGCCAGGGGCGCCGGCGG - Exonic
1098106085 12:67069706-67069728 CAGGCCGCCCGGGGCGCGGAGGG - Intergenic
1098893325 12:76031415-76031437 CAGGCGGCCGTGGGAGCCGCTGG - Exonic
1100978085 12:100142818-100142840 CAGGCCGCCACGGCCGCCGCGGG + Exonic
1101504080 12:105330714-105330736 GACGCGGCCCGGGGCGCAGCGGG - Exonic
1104942940 12:132403356-132403378 GAGGCGGCCAGGGACCCTGCTGG + Intergenic
1105472185 13:20704067-20704089 CAGGCGCCCCGCGCGGCCGCGGG + Exonic
1105502937 13:20988522-20988544 CAGGCGGACCGGGCCGCGGCTGG + Exonic
1112506611 13:99979999-99980021 GGGGCGGACGGGGACGCCGCGGG + Intergenic
1112570376 13:100588571-100588593 GAGGAGGCCTGGGGCGCCGCCGG - Intronic
1112752567 13:102597239-102597261 CGGGCGGCCGGGGACGCGGGTGG + Intronic
1113378895 13:109786023-109786045 CGGGCGGCCCGTGCCGCGGCGGG + Exonic
1114422731 14:22598229-22598251 CAGCTGACCCGGGAGGCCGCGGG - Exonic
1116186510 14:41606579-41606601 CAGGAGGCTGGGGACGCCCCTGG + Intergenic
1116945394 14:50831020-50831042 CAGGCGCCCGGCGCCGCCGCGGG + Exonic
1117883210 14:60331930-60331952 CAGGCTACCCGAGAAGCCGCTGG + Intergenic
1118019463 14:61695871-61695893 CAGGCGGGCGGGGTCGCCGGGGG - Intronic
1122768225 14:104085672-104085694 GAGGAGGCCCGGGGCGCCGGGGG - Exonic
1122978009 14:105178926-105178948 CAGGCAGCCCGAGAGGCCGTGGG + Intronic
1122983564 14:105202208-105202230 CTGACGGCCCAGGAAGCCGCCGG + Intergenic
1124696733 15:31870255-31870277 CCGGTGGCCCGGGAGCCCGCGGG + Intronic
1125899246 15:43329963-43329985 GAGGAGGCCCTGGGCGCCGCGGG - Exonic
1127547487 15:60004476-60004498 CGGGCGGCACGGGACGCTGCGGG + Exonic
1128344153 15:66842881-66842903 CGGGCGGCCCGGGGCTCCGCGGG + Intergenic
1128453877 15:67822201-67822223 CAGGCGGCCCGTCGCGCCCCAGG + Intronic
1129862528 15:78873450-78873472 CAAGCGGCCGGGCGCGCCGCAGG - Intronic
1130370849 15:83284460-83284482 CAGGCGGCCCGGGACGCCGCTGG - Intronic
1131263570 15:90902797-90902819 CCGGCGGCCCGGGGCCCAGCGGG + Intronic
1131825841 15:96322194-96322216 AAGGCTGCGCGGGCCGCCGCGGG - Intergenic
1132251898 15:100341039-100341061 CAGGCCGCCGGCGGCGCCGCAGG + Exonic
1132675815 16:1120870-1120892 CAGGCAGCCCCGGACACCGGCGG - Intergenic
1132717893 16:1301254-1301276 GAGGCGGCCCGGGAGGGGGCGGG - Intergenic
1132734632 16:1379384-1379406 CAGGCGGCCCGAGCCCGCGCTGG + Intronic
1133021712 16:2969769-2969791 CAGGCAGCCCGAGCCGCTGCTGG - Exonic
1133038125 16:3046116-3046138 AGGGCGGGCCGGGACCCCGCGGG + Intergenic
1133073804 16:3264347-3264369 CAGGCAGGCCGGGACCCCGGCGG - Intronic
1136498852 16:30659745-30659767 CTGGGGGCCCGAGACGCCGGCGG + Exonic
1137531605 16:49281884-49281906 GAGGCGGGCCGGGAGGCGGCGGG - Intergenic
1137728557 16:50673385-50673407 GAGCCGGCCTGGGACCCCGCAGG - Exonic
1138658045 16:58501852-58501874 CAGGCGGACCCGCACGCTGCGGG + Intronic
1139322821 16:66129190-66129212 CAGGCTGCCCGGGAGGCAACAGG + Intergenic
1141132218 16:81444547-81444569 GGGGCGGGCCGGGACCCCGCGGG + Intergenic
1142032098 16:87843726-87843748 CAGGAGGCCGGGGATGCTGCTGG + Intronic
1142378869 16:89720912-89720934 CCGGAGGCCCGGAACGCAGCCGG + Exonic
1143166410 17:4899317-4899339 GAGGCGGCCCGGGGGGCCTCGGG + Exonic
1143962207 17:10730057-10730079 CAGCCCGCCCCGAACGCCGCGGG + Exonic
1146329692 17:31917225-31917247 CAGAAGGCCCCGGCCGCCGCCGG - Intergenic
1147311182 17:39596923-39596945 CAGGAGGCCCGGGAGGCCCGCGG + Intergenic
1147393322 17:40122811-40122833 CAGCCGGCCGGGGAAGGCGCGGG - Intronic
1147996778 17:44363884-44363906 CAGGCGGCGCGCCACACCGCTGG + Intergenic
1148930048 17:51120674-51120696 CGGGCGGCCCGGGGCGTCGCCGG + Exonic
1150488867 17:65561245-65561267 GGGGCGGCCCGGGGCGCGGCCGG - Intronic
1151218118 17:72591763-72591785 CTGGCGACCGGGGACGCTGCTGG - Intergenic
1151763792 17:76121973-76121995 CAGGCAACCGGGGACGCTGCGGG + Intergenic
1151973167 17:77469519-77469541 CAGGCAGGCCGTGACCCCGCAGG - Intronic
1152463489 17:80453308-80453330 CAGGAGGCCAGGGGCGCCTCAGG - Intergenic
1152801606 17:82333425-82333447 CAGGCGGGCGGGGTCGCAGCGGG - Intronic
1153794510 18:8609801-8609823 CGGGCGGCCAGGGCCGCCGGAGG + Exonic
1153805724 18:8706733-8706755 CAGGTGTCCCGGGGCGCCCCCGG + Intronic
1157405898 18:47422688-47422710 CAGCCAGCCCGGGCTGCCGCTGG - Intergenic
1157794483 18:50560867-50560889 GAGCCGGCCCGGGACCCAGCTGG - Intronic
1158436028 18:57435921-57435943 CACGCGGGCCGCGGCGCCGCTGG + Exonic
1158962209 18:62596479-62596501 CGGGCGCCCCCGGAAGCCGCAGG + Intergenic
1160024090 18:75204678-75204700 CGGGCGGGCCGGGACCGCGCAGG + Intronic
1160424190 18:78769162-78769184 CAGGCGGCCTGTGCCGCGGCCGG + Intergenic
1160512746 18:79461599-79461621 CTGGCGGCCGGGGACGGTGCTGG + Intronic
1160824167 19:1071632-1071654 CAGGAGCTCCGGGAAGCCGCTGG - Intronic
1160830981 19:1104751-1104773 CAGGCTCCCCCGGGCGCCGCAGG + Intronic
1161153573 19:2721405-2721427 CCGGCGGGCGGGGACGGCGCGGG - Exonic
1161556262 19:4944454-4944476 CTGGAGCCCCGGGACGCTGCAGG - Intronic
1163609207 19:18292350-18292372 CACGCGGCGCTGGAGGCCGCGGG + Intergenic
1164834525 19:31349179-31349201 CAGGCGCCCCGGCGCGCAGCAGG - Exonic
1165682641 19:37790660-37790682 AAGGCGGCGCGGGTCGCTGCCGG + Intronic
1165943095 19:39425034-39425056 CAGGAGCCCCGGGAGGCTGCGGG - Exonic
1166942446 19:46375045-46375067 CAGGGGGCCCGGCATGCAGCAGG - Intronic
1167134904 19:47610136-47610158 CAGGGGCCCGGGGAGGCCGCAGG - Intronic
1167609845 19:50501776-50501798 CAGGAGGCCCGGGAGGAGGCTGG - Intergenic
925029104 2:636173-636195 CAGGTGGCCCCGGACGCCGCTGG + Intergenic
925609436 2:5691780-5691802 CCGTCGGCCAGGGCCGCCGCGGG + Intergenic
925610253 2:5696365-5696387 CAGGGGGCGCGGGGCGCGGCGGG + Exonic
926190179 2:10722071-10722093 CAGCCGTCCGGAGACGCCGCGGG + Intronic
927511809 2:23648665-23648687 CAGGGTGCCAGGGACACCGCCGG + Intronic
929701885 2:44169277-44169299 AAGGCCGCCCGGCACCCCGCCGG + Intronic
929777405 2:44937846-44937868 CGGGCGGCCAGGGAGGGCGCAGG - Intergenic
929788672 2:45009115-45009137 CGGGCGGGCGGGGACGCAGCCGG - Exonic
930106076 2:47640521-47640543 CAGGCTGCCAGGGGCGCCGGAGG + Intergenic
932780329 2:74555090-74555112 CAGGCGGCCCGGGTCCCGACGGG - Intronic
932812078 2:74834151-74834173 CAGGAGTCCCGGGCTGCCGCTGG + Exonic
933667078 2:84971914-84971936 GAGCCGGCCCGGGACCCGGCAGG + Intronic
934579564 2:95427450-95427472 CTGGTGTCCCGGGACGCTGCAGG + Intergenic
934599880 2:95649275-95649297 CTGGTGTCCCGGGACGCTGCAGG - Intergenic
936106847 2:109632098-109632120 CAGGAGGCCCTGGAAGCCTCCGG - Intergenic
937283409 2:120735749-120735771 CAGGGGGACCCGAACGCCGCCGG - Intronic
937933023 2:127220105-127220127 CGGGCGGCCGGGGTCGCCGCCGG - Intergenic
941021088 2:160408067-160408089 CGGGCGGCCCGGGGAGCAGCCGG + Intronic
941096623 2:161244997-161245019 CAGGCGGCCCAGGCCAGCGCCGG - Intergenic
945279809 2:208025562-208025584 CTGGCTGCCCGGGCCGCCGGCGG - Intergenic
946418665 2:219552878-219552900 CAGGCGGACCGGTCCGGCGCGGG + Exonic
947860434 2:233354318-233354340 CGGGGGGCCCGGGACGCTTCAGG + Intergenic
948601792 2:239111642-239111664 CAGGCGTCCATGGAGGCCGCCGG - Exonic
948801630 2:240435889-240435911 CGGGTGGCCGGGGGCGCCGCCGG + Exonic
1169231142 20:3889548-3889570 CAGGCGGCCGGGGACCCCGAAGG + Exonic
1169437997 20:5610759-5610781 AGGGCGGCCCGGGACGCGGCGGG - Intronic
1173662902 20:44746234-44746256 CAGCCGTCCCGGGGCGCCTCTGG + Intronic
1174352578 20:49979237-49979259 CAGGTGGCCTGGGACCCGGCAGG - Intergenic
1175771627 20:61627926-61627948 CAGGGGGCCCAGGAGGCGGCTGG - Intronic
1175999559 20:62825839-62825861 CACGCTGCCCGGGAGGCCGGCGG - Exonic
1176236489 20:64056080-64056102 CAGGCCGCCAGGGCCGCCACTGG + Intronic
1178914336 21:36698494-36698516 CAGGAGGAGCGGGAGGCCGCAGG - Intergenic
1179544632 21:42105985-42106007 CAGCCTGCCCGGGACCCTGCCGG - Intronic
1179631804 21:42683545-42683567 CAGGCGGCCCCGGAGGCCTGGGG - Intronic
1182294938 22:29307085-29307107 GAGCCGGGCCGGGCCGCCGCAGG - Exonic
1184254456 22:43279134-43279156 CAGGCTGCCCCAGACGCTGCTGG + Intronic
1184273702 22:43398809-43398831 CAGGTGGCCCAGGAGGCCACGGG - Intergenic
1185235967 22:49713262-49713284 CAGGAGGCCTGGGACTCTGCAGG - Intergenic
1185255085 22:49827441-49827463 CGGGCGGCCCGCGAGGCGGCGGG + Intronic
1185259530 22:49853851-49853873 CCCGCCGCCCGCGACGCCGCCGG - Exonic
950569866 3:13793262-13793284 CAGGGGGCCCGGGCCCCCCCAGG + Intergenic
953485043 3:43286838-43286860 CGCGCGGCCCGGGAGGACGCGGG + Intronic
954151823 3:48661752-48661774 GACGCGGCCCGGGGCGCTGCGGG + Exonic
963733111 3:148991602-148991624 CAGGCGGCCGGGGCAGCCTCAGG - Exonic
963904582 3:150763089-150763111 TTCGGGGCCCGGGACGCCGCCGG - Exonic
966787579 3:183635489-183635511 CAGGTGGCCCCGGAGGCCACCGG + Intergenic
968225191 3:196968751-196968773 CAGGAGGCCCCGGAGGCGGCGGG + Exonic
968820205 4:2844127-2844149 GAGGCTGCCCGGGCCGCCGCAGG - Intronic
969858559 4:10018856-10018878 CTCGCGGCGCGGGACACCGCGGG - Intronic
976053064 4:81031147-81031169 CACGGAGCCCGGGACGCGGCCGG - Exonic
976569765 4:86594543-86594565 CAGTCGGCCGGGATCGCCGCTGG + Exonic
977894064 4:102344783-102344805 GAGGTGGCGCGGGACGCCCCTGG + Exonic
988595359 5:32585763-32585785 AAGGGGGCCGGGGACGCCGAGGG - Intronic
990557764 5:56952244-56952266 AGGGCGGCCCGCGACGCCCCCGG + Intronic
992078944 5:73216293-73216315 CAGGCAGCTGGGGAGGCCGCGGG + Intergenic
993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG + Exonic
997521263 5:134525828-134525850 CGTGGGGCCTGGGACGCCGCGGG + Intronic
1002045131 5:176537205-176537227 GAGGCGGCGCAGGACGCAGCTGG + Exonic
1002783913 6:386890-386912 CAGGAGGCCGGGGAGGCCTCGGG - Intergenic
1003065981 6:2903616-2903638 GCGGAGGCCCTGGACGCCGCAGG - Intergenic
1003086203 6:3063612-3063634 GCGGAGGCCCTGGACGCCGCAGG + Intergenic
1007400172 6:41598834-41598856 CAGGCAGCCCGGGCCTCCCCTGG + Exonic
1007967501 6:46015913-46015935 CAGCCGGGCGGGGACGCGGCGGG + Intronic
1008381871 6:50845965-50845987 CCGGCGCCCCGGGTGGCCGCTGG - Exonic
1017880722 6:158560589-158560611 GAGGCTGCCCGGGAGGCGGCGGG - Intronic
1019421914 7:954574-954596 GAGGCCGCCCGGGATGGCGCAGG - Intronic
1019746412 7:2702674-2702696 CAGGCGGGCAGGGGCGTCGCAGG + Intronic
1020224962 7:6272613-6272635 CGCGCGGCCCGGGTCGCGGCCGG + Exonic
1020274250 7:6615385-6615407 CGGCCAGCCCGGGACGCCCCAGG + Intergenic
1020418174 7:7969321-7969343 CTGCGGGCCCTGGACGCCGCCGG - Exonic
1024074276 7:45810783-45810805 CAGGAGGCCGGGAAGGCCGCCGG - Intergenic
1025053136 7:55744745-55744767 CAGGAGGCCGGGAAGGCCGCCGG + Intergenic
1026038124 7:66844523-66844545 CGGGCGGCGGGGGACGCTGCGGG + Intergenic
1026471055 7:70694411-70694433 CAGGCAGCCCGCGGCGCGGCTGG + Intronic
1027251324 7:76400548-76400570 CAGGCGGCCCCGGCAGCGGCTGG + Exonic
1029694049 7:102201653-102201675 AAGGAGGCCCAGGACGCCCCCGG + Exonic
1030121161 7:106112107-106112129 CAGGCGGGCCTGGCCGGCGCGGG + Intronic
1032266454 7:130373529-130373551 CAGGCTGGCCGGGAGGCCGTGGG + Intergenic
1033589317 7:142796935-142796957 GGGGCGCCCCGGGACGCCGGGGG + Intergenic
1034344635 7:150379020-150379042 CAGGGGTGCCAGGACGCCGCCGG + Intronic
1034958457 7:155350302-155350324 AAGTCGGCCCGGGAGACCGCAGG - Intergenic
1034977759 7:155458046-155458068 GAGGCGGCCCGCGTCCCCGCCGG + Intergenic
1034978017 7:155459079-155459101 CACGCGTCCCGGCTCGCCGCGGG + Intronic
1036664642 8:10730623-10730645 CCTGCGTCCCGGGCCGCCGCCGG + Intronic
1036811031 8:11867867-11867889 CCGGCCCCCAGGGACGCCGCGGG + Intronic
1037788950 8:21919869-21919891 CAGCCGGCTCGGGACTCGGCAGG + Intronic
1039921310 8:41896265-41896287 CGGGCGGCCCGGGACGCGGTGGG - Intronic
1039949084 8:42153525-42153547 CAGGCGGCGCTGGGCACCGCAGG + Intronic
1040291902 8:46129831-46129853 CAGCCTGCCCGGGACACCCCTGG + Intergenic
1042226166 8:66515979-66516001 GAGGATGCCGGGGACGCCGCAGG - Exonic
1042787743 8:72567896-72567918 CAGGCTGCCCAGGACGCGCCTGG + Exonic
1042859147 8:73295420-73295442 GAGGCGGCCCAGGCCGCTGCCGG - Exonic
1042920532 8:73915027-73915049 CAGGCAGCCGGGGCAGCCGCAGG + Intergenic
1049409080 8:142464473-142464495 CACGCGGCCGGGGCCGCTGCAGG - Exonic
1049552433 8:143266871-143266893 CAGGCTCCCGGGGACGCCCCTGG + Intronic
1049555442 8:143279183-143279205 CAGGCGTCCCGGGAGGGCTCAGG - Intergenic
1049614329 8:143569494-143569516 CAGGCGCCCGGGGCCGCAGCAGG + Exonic
1049674289 8:143882896-143882918 CAGGCCGCCCAGGACGATGCTGG - Intergenic
1049689616 8:143952898-143952920 CAGGCGGGAAGGGAAGCCGCAGG + Intronic
1053010286 9:34628980-34629002 CAGGCGGCCCTGGCCTCGGCTGG + Intergenic
1057361098 9:94374548-94374570 CAGCCCGCCCCTGACGCCGCCGG + Exonic
1057662260 9:97013604-97013626 CAGCCCGCCCCTGACGCCGCCGG - Intergenic
1058866646 9:109167161-109167183 CAGGCCGCTCGGGCCGCAGCGGG + Exonic
1059102196 9:111482819-111482841 CAGGCCGCCCCGCCCGCCGCCGG - Intronic
1061421067 9:130473048-130473070 CAGGAGGCCTGGGAGGGCGCAGG - Intronic
1061725541 9:132580343-132580365 CTGCCGGCCCGGACCGCCGCGGG + Intergenic
1062339466 9:136087547-136087569 CAGGCGGCCCCAGAAGCTGCGGG - Intronic
1185471525 X:386705-386727 CGGGCGTCCGGGGGCGCCGCGGG - Exonic
1189336862 X:40175726-40175748 CAGGCGGCCCGAGCGGTCGCAGG + Intronic
1189821297 X:44872669-44872691 CAGGGGTCCCGGGACCCCACAGG - Intergenic
1191085552 X:56563835-56563857 CAGGCGGGCAGGGAAGGCGCGGG - Exonic
1193360678 X:80575015-80575037 CAGGAGTCCCGGGCTGCCGCTGG - Intergenic
1199794343 X:151180229-151180251 CTGGCGGCCCGTGACCCTGCAGG + Exonic
1200092933 X:153644259-153644281 CGGGCGCCCCGGGCCTCCGCCGG - Intronic
1200115331 X:153767471-153767493 CAGGCGGCCCAGGCCCTCGCTGG - Exonic
1200216861 X:154371828-154371850 CCGGCGGACGGGGATGCCGCCGG - Intronic