ID: 1130370850

View in Genome Browser
Species Human (GRCh38)
Location 15:83284470-83284492
Sequence GTGCGCGGAGCAGGCGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370850_1130370856 1 Left 1130370850 15:83284470-83284492 CCCGGGCCGCCTGCTCCGCGCAC 0: 1
1: 0
2: 2
3: 18
4: 281
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370850_1130370863 19 Left 1130370850 15:83284470-83284492 CCCGGGCCGCCTGCTCCGCGCAC 0: 1
1: 0
2: 2
3: 18
4: 281
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370850_1130370857 2 Left 1130370850 15:83284470-83284492 CCCGGGCCGCCTGCTCCGCGCAC 0: 1
1: 0
2: 2
3: 18
4: 281
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370850_1130370855 -2 Left 1130370850 15:83284470-83284492 CCCGGGCCGCCTGCTCCGCGCAC 0: 1
1: 0
2: 2
3: 18
4: 281
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370850 Original CRISPR GTGCGCGGAGCAGGCGGCCC GGG (reversed) Intronic
900100248 1:959415-959437 GTGCTCGGTGCGGGCAGCCCCGG + Intergenic
900123504 1:1059425-1059447 GTCCGCAGTGGAGGCGGCCCCGG + Intergenic
900411911 1:2516350-2516372 GTGCTGGGTGCAGGTGGCCCCGG - Intronic
900832830 1:4977417-4977439 GTGGGCAGAGCAGGCAGACCAGG + Intergenic
901405011 1:9039690-9039712 CTGCCCGGAGGAGGCGGCCTCGG + Intronic
901525860 1:9823388-9823410 GCGCGCGCTGCAGGCGTCCCGGG - Intronic
901703913 1:11059714-11059736 AGGCGGGCAGCAGGCGGCCCGGG + Intronic
902613845 1:17613000-17613022 GTGAGAGGAGCAGGCGGGACAGG - Intronic
903324804 1:22563647-22563669 GCGCAGGGGGCAGGCGGCCCCGG - Exonic
904041858 1:27590027-27590049 GTGGGTGGGGCAGGGGGCCCAGG - Intronic
904364512 1:30001837-30001859 GTGAGCTCAGCAGGTGGCCCAGG - Intergenic
904822938 1:33256794-33256816 GCCCGAGGCGCAGGCGGCCCCGG - Intronic
905442729 1:38005383-38005405 GCGCGCGGCGCAGGCGGGGCCGG + Exonic
905626003 1:39491194-39491216 CTGCCCGCAGCAGCCGGCCCGGG - Intergenic
905752367 1:40477263-40477285 GTGGGCGGAGCCGGCGGCCGGGG + Exonic
906517483 1:46448224-46448246 GAGCGCTGGGCAGGCAGCCCGGG + Intergenic
908385425 1:63636584-63636606 GTGCCAGGAGGAGGAGGCCCAGG - Intronic
912379718 1:109240762-109240784 GTACGCGGCGGGGGCGGCCCTGG + Intergenic
912717008 1:111989965-111989987 GGGCGCGGCGCAGGCGGGGCGGG + Intergenic
915346675 1:155201071-155201093 GTGCAGGGAGCAGGCGGGCAAGG - Intronic
922533618 1:226363625-226363647 GTGAGTGGAGGAGGCGGCCTGGG + Intronic
922762213 1:228140280-228140302 GTGGGCGGAAGAGGTGGCCCCGG + Exonic
922775943 1:228214235-228214257 TTGCGTGGAGCTGGCGGTCCCGG + Exonic
924436591 1:244048654-244048676 GAGCGCGGAGCCGCCGGGCCGGG - Intergenic
924552114 1:245088707-245088729 GTGAGCGGAGAAGGCTTCCCAGG + Intronic
924907730 1:248474075-248474097 GTGGGAGGAGCAGGTGGCCAAGG - Exonic
924916378 1:248574011-248574033 GTGGGAGGAGCAGGTGGCCAAGG + Exonic
1063124867 10:3128924-3128946 GTGCCGGGAGCAGGCGGGGCCGG + Intronic
1063159562 10:3409267-3409289 GTGCCGGGAGCTGGCAGCCCTGG + Intergenic
1063660704 10:8033906-8033928 GGGCGCCGAGAAGGAGGCCCTGG + Intergenic
1065090563 10:22229145-22229167 GTACACGGGGAAGGCGGCCCGGG - Intergenic
1066602745 10:37125528-37125550 GTGCCCGGAGAACGCGGCCAGGG + Intergenic
1067852480 10:49762427-49762449 GTCCACGGTGCTGGCGGCCCAGG + Intergenic
1073242156 10:102065894-102065916 GTGCGAGGAGCGGCAGGCCCGGG + Exonic
1073268185 10:102240995-102241017 GGGCACGGGGCAGGCGGCCAGGG - Intronic
1073403512 10:103277360-103277382 GGCCGAGGAGCAGGCGGCCGAGG - Exonic
1073503823 10:103966978-103967000 GTGAGCGGAGCACGGGGCTCGGG - Intergenic
1074377394 10:112951316-112951338 GCGCGCGGGGCGGCCGGCCCGGG - Intronic
1075727887 10:124619912-124619934 GAGCCCGCAGCAGGGGGCCCGGG + Exonic
1076371693 10:129959628-129959650 CCGCGGGGAGCAGGCCGCCCTGG + Intronic
1076506019 10:130973196-130973218 GTGCGCAGAGGAGGCCGCCAGGG - Intergenic
1077102901 11:830079-830101 CTGCCTGGAGGAGGCGGCCCGGG + Exonic
1077377300 11:2211051-2211073 GTGGGGGGAGCAGGATGCCCTGG + Intergenic
1078480695 11:11672717-11672739 GTGCCCGGAGCAGGGAGCCTTGG + Intergenic
1083659753 11:64246628-64246650 GGGCGCGGCGTTGGCGGCCCCGG - Exonic
1083674311 11:64317010-64317032 GTGCGGGAGGCAGGTGGCCCGGG + Intronic
1083674521 11:64318093-64318115 CTGCGCAGTGGAGGCGGCCCAGG + Exonic
1084301363 11:68254708-68254730 GTGCCCGGAGCACGCAGCACTGG + Intergenic
1084438070 11:69155625-69155647 CTGGCCGGAGCAGACGGCCCCGG + Intergenic
1084601224 11:70147102-70147124 GTGCGTGGAGCAGCCCTCCCGGG + Intronic
1085276174 11:75301702-75301724 GTGCGGGGAGCAGGTGGCAGCGG + Intronic
1085423095 11:76380716-76380738 GGGCGCAGAGCGGGCGGCCCGGG - Intronic
1089822636 11:121241839-121241861 CTTTGCGGAGCAGGAGGCCCAGG + Intergenic
1089879866 11:121763078-121763100 CTTCACGGAGCAGGCCGCCCTGG - Intergenic
1091550195 12:1530717-1530739 GGGCGCGGGGCTGGCGGCGCGGG - Intronic
1100869529 12:98895304-98895326 GTGCGCGGAGGGGGCGGCGGAGG - Intronic
1101409693 12:104457958-104457980 GGGCGCAGAGCAGCCGGCTCCGG - Intronic
1101764088 12:107682572-107682594 CTCTGCGGAGCAGGAGGCCCAGG + Intergenic
1101844241 12:108349663-108349685 ATGAGCAGAGCAGGAGGCCCAGG - Intergenic
1103764550 12:123271331-123271353 GGGTGCGGGGCGGGCGGCCCGGG - Intronic
1103856384 12:123973308-123973330 GTGCGCGGCGCCCGCGGCCTGGG + Exonic
1105809156 13:23979522-23979544 GAGCCCGGAGCAGGAGGACCTGG - Intergenic
1106568393 13:30906263-30906285 CCGCGCGGAGAAAGCGGCCCCGG - Exonic
1107133445 13:36920082-36920104 GCGCTCGGAGCGGGCGGCCGGGG - Intronic
1111800572 13:92975134-92975156 CTCCGAGGAGCAGGAGGCCCAGG + Intergenic
1112506688 13:99980301-99980323 GTGCTCGGGCCAGGCGTCCCCGG + Intergenic
1113082308 13:106533149-106533171 GTGGCTGGAGCAGGCGGCCTGGG + Intronic
1113604648 13:111596602-111596624 GAGCGCAGAGCAGGAGGGCCAGG - Intronic
1113896250 13:113766262-113766284 GTGCGCCGGGCGGGCGGCCTGGG + Intronic
1116828270 14:49693109-49693131 GTGCGTGGAGCAGTCGGGGCTGG + Exonic
1117722008 14:58637804-58637826 GAGCGAGGAGGAGGCGGCTCTGG + Intronic
1118607634 14:67515216-67515238 GGGCGGGGAGCAGGCGGTGCAGG - Exonic
1118849297 14:69572278-69572300 GCGGGCGGAGCGCGCGGCCCGGG - Exonic
1119330137 14:73787302-73787324 GCGCGCGGAGCCGGGGGCGCGGG - Intronic
1120916890 14:89718413-89718435 GTGGGAGGAGCAGGCAGCACAGG - Intergenic
1121569560 14:94937051-94937073 GTGACCTGAACAGGCGGCCCTGG - Intergenic
1121686594 14:95840069-95840091 GTGCTCTGAGCAGGCTGCTCTGG + Intergenic
1122113249 14:99515783-99515805 GTGCTCAGAGCAGGAGGTCCAGG - Intronic
1122363241 14:101179842-101179864 CTGCGTGCAGCAGGCGTCCCTGG + Intergenic
1122792931 14:104192087-104192109 GTGCCCGGAGCCAGCGGCACAGG + Intergenic
1122899077 14:104774701-104774723 GTGGGTGGGGCAGGTGGCCCTGG - Intronic
1124237638 15:28003855-28003877 GTGGAGGGAGCAGGCGGCGCGGG - Intronic
1124696567 15:31869326-31869348 GTGCCCGGAGAAGCCTGCCCTGG - Intronic
1127995565 15:64151682-64151704 GGGGGCGGAGCCGGCCGCCCCGG + Intergenic
1128127232 15:65202091-65202113 GTGCCAGGAGCAGGCAGCCAAGG + Intronic
1129162110 15:73752841-73752863 GCGCGCGAAGCCGGGGGCCCCGG + Intergenic
1129392195 15:75226072-75226094 GTGTGACGAGCAGGAGGCCCAGG + Intergenic
1130370850 15:83284470-83284492 GTGCGCGGAGCAGGCGGCCCGGG - Intronic
1131263582 15:90902832-90902854 GCGCGCGGAGCAGGGGGCTACGG + Intronic
1132518003 16:374792-374814 GTCTGCGGAGCAGGAGGCACTGG + Exonic
1132638574 16:966333-966355 AGGCGCCGAGCAGCCGGCCCTGG + Intronic
1132646253 16:1000605-1000627 GTGCGGGGAACAGGTGCCCCCGG + Intergenic
1132929397 16:2451222-2451244 GCGCGCGGGGCAGGTGGCGCGGG + Intronic
1132978348 16:2721389-2721411 GGGCGCGGCGCGGGCGGCCAGGG + Intergenic
1136553291 16:30993107-30993129 GTGAGCGGGGCAGGCGGCCTGGG - Intronic
1136620838 16:31427666-31427688 ATGCGCGGAGCGGGCGCCTCTGG + Intergenic
1138515000 16:57531058-57531080 GTGAGAGGAGAAGGGGGCCCAGG - Intronic
1139354870 16:66361422-66361444 GTGCCCGGAGGAGGTGGCCTGGG - Intergenic
1142037186 16:87869538-87869560 GTGGGCGGGGCCGGCGGGCCGGG - Intergenic
1142303086 16:89270271-89270293 GGCCTGGGAGCAGGCGGCCCCGG - Intronic
1142693492 17:1620914-1620936 GTGAGCAGAGCAGGCTGGCCCGG - Intronic
1143164804 17:4892469-4892491 GGGGGCTGAGCAGGGGGCCCTGG - Exonic
1143732667 17:8889889-8889911 GTGCACGGTCCAGGCGGGCCTGG - Intronic
1144781396 17:17810184-17810206 GTTCCGGGAGCAGGCGGCTCCGG - Exonic
1145041736 17:19582343-19582365 GGGCGCCGGGCAGGCGCCCCTGG - Intergenic
1145042675 17:19588358-19588380 GGGCGCCGGGCAGGCGCCCCTGG + Intergenic
1147987570 17:44315321-44315343 GTGCGCGACGCCGGCGGGCCCGG + Intronic
1148090260 17:45019095-45019117 GAGGGCGGCGCGGGCGGCCCGGG + Intergenic
1148403329 17:47386891-47386913 GTGCAAGGAGCAGGCGGCGGCGG - Intronic
1148593042 17:48830978-48831000 GTGGGCGGGGCAGGCGGGACGGG + Intronic
1148698657 17:49575742-49575764 GCGCGGGGAGCGGGCGGCCGGGG + Intergenic
1148744374 17:49910274-49910296 GGGCGCTGAGGAGGCCGCCCCGG + Intergenic
1150069249 17:62138157-62138179 GCGGGCCGAGCGGGCGGCCCTGG + Intergenic
1150211843 17:63446182-63446204 GTGCGGGGCGGGGGCGGCCCAGG - Exonic
1151780156 17:76240300-76240322 GGGCGCGGGGCGGGCGGCCGCGG - Exonic
1151828597 17:76537251-76537273 GTCGGCGGAGCAGGCGGCGTGGG - Intronic
1152593166 17:81223371-81223393 GCGCGAGGAGCACGCGGCCTCGG + Intergenic
1152654766 17:81514503-81514525 GTGCGGGGAGGTGCCGGCCCCGG + Intronic
1152855239 17:82661953-82661975 GTTCCCAGAGGAGGCGGCCCTGG + Intronic
1152917850 17:83051335-83051357 GAGCGCGGGGCAGGCGGGCGGGG + Intronic
1152924135 17:83079821-83079843 GGGCGCGGCGCGGGCGGCCTGGG + Exonic
1153765084 18:8367289-8367311 GGGCCCAGAACAGGCGGCCCAGG - Intronic
1158530528 18:58256183-58256205 CTGCGCGGAGGAGGCTGCCCCGG + Intronic
1160204792 18:76823135-76823157 CTGCGCGGCGCCGGCTGCCCCGG + Intronic
1160454726 18:78992544-78992566 GCGCGCGCGGCAGGCGGCTCGGG + Exonic
1160726859 19:621192-621214 GCGGGCCGAGCGGGCGGCCCTGG + Exonic
1161267424 19:3370811-3370833 GTGTCCGGGGCAGGAGGCCCAGG - Intronic
1161443312 19:4304701-4304723 GTGCGCGGGGCCCGCGGGCCGGG + Exonic
1161554996 19:4936130-4936152 GTGCTCGGTCCAGGCGGCCTTGG + Intronic
1161630967 19:5355198-5355220 GAGGGCGGAGCAGGAGGCACCGG + Intergenic
1162348606 19:10135834-10135856 CTGGGTGGAGCACGCGGCCCTGG + Exonic
1162727066 19:12696150-12696172 GTGCGCGGGGCCGGGGGCCGGGG - Intronic
1163390370 19:17026902-17026924 ATGGGCGGAGCAGGCGTCCCGGG - Intergenic
1163844361 19:19629996-19630018 GTCCGGGCAGCAGGTGGCCCTGG + Exonic
1164510783 19:28895421-28895443 GTGAGGGGAGAAGGTGGCCCAGG + Intergenic
1164693205 19:30226036-30226058 GGGCGGGGAGGCGGCGGCCCAGG - Intergenic
1165860661 19:38907554-38907576 GTGCACGGAGGAGGCGGGCGAGG - Exonic
1166108120 19:40607495-40607517 GTGGGCAGAGCTGGCAGCCCCGG - Exonic
1166749123 19:45156367-45156389 GTGGGAGGAGCCTGCGGCCCAGG - Intronic
1168293900 19:55369723-55369745 GTGCGAGGCGCGGGCGGCCGGGG - Intronic
1168642694 19:58040551-58040573 GAGCACGGAGCTGGGGGCCCCGG - Intronic
925171205 2:1751263-1751285 GTGTGCAGAGAAGGGGGCCCGGG - Intergenic
926213947 2:10892184-10892206 GTGCCCTGAGCAGGCAGACCAGG - Intergenic
926914554 2:17879300-17879322 GAAGGCGGAGCAGACGGCCCGGG - Intronic
927152733 2:20205084-20205106 CTGCGTGCAGCAGGCGGCCCTGG + Intronic
927698227 2:25251873-25251895 GCACGCGGAGCTGGTGGCCCAGG - Intronic
927990339 2:27442764-27442786 GTGAGCGCGGCAGGCGACCCGGG + Intronic
929501410 2:42494051-42494073 GCGCGCGGAGCCGGCGGGCGAGG - Exonic
930198435 2:48530581-48530603 GGGCGCAGAGCTGGTGGCCCGGG - Intronic
932882495 2:75516918-75516940 GTGCCTGGAGAAGGAGGCCCTGG + Intronic
935250132 2:101253395-101253417 GTGCGCGAAGCTGGCGGCGAAGG - Exonic
937917232 2:127105323-127105345 GTGCCTGGAGCAGGCAGCCCTGG - Intronic
938302958 2:130229182-130229204 GTGCTCGGTGCGGGCAGCCCCGG - Intergenic
938453708 2:131445040-131445062 GTGCTCGGTGCGGGCAGCCCCGG + Intergenic
939784679 2:146494657-146494679 CTGCACAGAGCAGGGGGCCCTGG + Intergenic
941319937 2:164041625-164041647 CTGCACAGAGCAGGGGGCCCTGG + Intergenic
943725222 2:191245686-191245708 AGGCGCGGAGCAGGCGCCTCGGG - Intronic
945188946 2:207166624-207166646 GGGCGCGGCGCAGGGGGCCGCGG + Intronic
946747485 2:222860888-222860910 GAGCGCGGCGCTGGCGGCCCGGG - Intergenic
946874470 2:224114151-224114173 CTGCACAGAGCAGGGGGCCCTGG - Intergenic
948200180 2:236124130-236124152 GTGCGGCGAGCAGGCGGGCACGG - Exonic
948449548 2:238060774-238060796 GTGCGGGGATCCGCCGGCCCAGG + Intronic
1168973511 20:1947215-1947237 GAGCTCGGAGCAGGTGGCTCAGG - Intergenic
1169118674 20:3082954-3082976 GTGCGCGGCGGGGGCGGGCCTGG - Intronic
1169208182 20:3751593-3751615 GCACGCGGTGCAGGCGGCGCTGG + Exonic
1170629745 20:18056851-18056873 GGTCGTGGAGCAGGCGGCCTAGG + Exonic
1173165173 20:40682865-40682887 GAGCCCGGAGCAGCGGGCCCTGG + Intergenic
1173524570 20:43721804-43721826 GTTTGTGGAGCAGGAGGCCCAGG + Intergenic
1173647817 20:44644489-44644511 GTGAGCTGACCAGGCAGCCCTGG - Intronic
1174138788 20:48398552-48398574 CTGCATGGAGCAGGAGGCCCGGG + Intergenic
1174287229 20:49482315-49482337 GCGTGCGGGGCAGGCGGTCCAGG + Exonic
1175149950 20:56925655-56925677 GTGCGCGGGGCGGGGGTCCCCGG - Intergenic
1175521496 20:59605094-59605116 GTCCGCGGAGGAGGTGGCCGAGG - Exonic
1175804066 20:61817573-61817595 GTGCGCAGGACAGGCAGCCCAGG - Intronic
1175994094 20:62804706-62804728 GGGCGCGGGGCGGGCGTCCCGGG + Intergenic
1176241253 20:64076889-64076911 GTGGGCGGAGGAGGTTGCCCAGG + Exonic
1176381910 21:6117918-6117940 GTGTGCGGAGAAGGCGGGGCAGG - Exonic
1176429097 21:6565077-6565099 GTGAGCGCAGCAGGCAGCCAGGG - Intergenic
1177259563 21:18712516-18712538 CTGCACAGAGCAGGGGGCCCTGG - Intergenic
1178493855 21:33070952-33070974 GGCGGCGGCGCAGGCGGCCCCGG + Exonic
1178951486 21:36989779-36989801 GGGCGCGGGGCACGCGGCCAGGG + Intronic
1179547389 21:42121993-42122015 GAGCGAGAAGCAGGCTGCCCAGG + Intronic
1179585792 21:42373395-42373417 GTGCAGGGAGCAGGGGCCCCAGG + Intronic
1179704587 21:43173393-43173415 GTGAGCGCAGCAGGCAGCCAGGG - Intergenic
1179741562 21:43420321-43420343 GTGTGCGGAGAAGGCGGGGCAGG + Exonic
1180043821 21:45293777-45293799 GTGCACGGAGCAGGCGCCCGAGG + Intergenic
1180069962 21:45431335-45431357 GTGTGTGGACCCGGCGGCCCAGG + Intronic
1180182978 21:46126248-46126270 GGGCGCGGGGCAGTCGGCCGAGG + Intronic
1180871658 22:19150155-19150177 CTGCGGTGGGCAGGCGGCCCGGG + Exonic
1182288926 22:29264307-29264329 GTGGGCTCAGCAGGTGGCCCTGG - Intronic
1182355614 22:29721104-29721126 GCGCGCCGGGAAGGCGGCCCGGG + Intronic
1182576522 22:31276713-31276735 GGGCGCGGCGTTGGCGGCCCCGG + Intronic
1183074796 22:35420008-35420030 GTGCGGTGAGCAGGCGGGCAGGG + Exonic
1183247291 22:36703549-36703571 GCGCGCGGAGCGGGCGGCGCAGG - Exonic
1183683672 22:39349906-39349928 GCGCGCGCGGCCGGCGGCCCAGG - Intronic
1184472241 22:44702447-44702469 GGGCGCGGCGCAGGCGGCCCGGG + Intronic
1184796885 22:46738012-46738034 GGGCCCGGAGCCGGCGCCCCCGG - Exonic
1185161563 22:49232954-49232976 GTGCAGGGAGCAGACGGCGCGGG + Intergenic
1185218974 22:49619472-49619494 GTGCACGGAGCACCAGGCCCAGG + Intronic
1185228755 22:49668234-49668256 GTGTGCTGAGCCGGGGGCCCTGG - Intergenic
1185273449 22:49939054-49939076 GTGCCAGGAGCAGGCAGGCCTGG + Intergenic
1185413825 22:50699235-50699257 GTGGGCAGAGCAGGCAGGCCCGG + Intergenic
950487819 3:13283141-13283163 GCGCGGGGAGCAGGAGGCGCGGG - Intergenic
951558708 3:23945537-23945559 CTGCGGGAAGCGGGCGGCCCCGG + Exonic
951611341 3:24495139-24495161 CGGCGCGGAGCAGGCGCCCCGGG - Intronic
952269482 3:31817500-31817522 CTCCGTGGAGCAGGAGGCCCAGG + Intronic
953789885 3:45939221-45939243 GTGTGCACAGCAGGCTGCCCAGG - Intronic
954668971 3:52278057-52278079 CTGCGGGGTGGAGGCGGCCCTGG + Intronic
955782695 3:62502804-62502826 GTGGGTGGAGGAGGAGGCCCAGG + Intronic
956485514 3:69718168-69718190 GAGCTGGGGGCAGGCGGCCCAGG - Intergenic
961067001 3:123884206-123884228 CCGCGCGGCGAAGGCGGCCCGGG + Intronic
961651824 3:128420753-128420775 GTGGCAGGAGCAGGGGGCCCTGG - Intergenic
966182285 3:177197838-177197860 GGGGGCGGGGCGGGCGGCCCGGG - Intergenic
966883221 3:184361467-184361489 GTGCGCGGAGATGGCGGCCGCGG - Exonic
966972782 3:185060851-185060873 CTGCACAGAGCAGGGGGCCCTGG - Intergenic
967092415 3:186146415-186146437 GAGCCCGGAGCTGGCGGCCAAGG + Intronic
967453327 3:189651766-189651788 CTGCACAGAGCAGGGGGCCCTGG - Intronic
967596255 3:191329433-191329455 GGACGCGGAGCAGGTGGCCGCGG + Exonic
968448449 4:663985-664007 GTGCGCGGGGCCGGCGGGCAGGG - Intronic
968526340 4:1059538-1059560 GTGAGTGGAACAGGCCGCCCAGG - Intronic
969078780 4:4601985-4602007 GGTCGGGGAGCAGGAGGCCCAGG + Intergenic
972586141 4:40438461-40438483 ACACGCCGAGCAGGCGGCCCGGG + Exonic
976704587 4:88007624-88007646 GGGCGGGGAGCAGGCGGCGGCGG + Intergenic
979624077 4:122826945-122826967 GCGCGGCGAGCCGGCGGCCCGGG - Exonic
984219498 4:176955658-176955680 CTGCACAGAGCAGGGGGCCCTGG + Intergenic
985478346 5:92142-92164 GCGCGCGGCGAAGGCGGCCTCGG + Intergenic
985778358 5:1857063-1857085 GTGCGGGGAGCCAGCGGCCCGGG - Intergenic
985897066 5:2755098-2755120 GCGCGAGGAACAGCCGGCCCCGG + Exonic
990381877 5:55227164-55227186 CTGCTCGGAGGCGGCGGCCCGGG + Exonic
990490056 5:56295423-56295445 GCACTCGGAGCAGCCGGCCCCGG + Intergenic
990630974 5:57668367-57668389 GTGAGGGGAGCAGCCGGCCATGG - Intergenic
992105490 5:73447114-73447136 CTGCGCGGCGCAGGCGGCCGTGG - Exonic
992269729 5:75052855-75052877 CTGCGAGGCGCAGGGGGCCCGGG - Intergenic
1000463341 5:161547922-161547944 GCGTGCGGAGCTGGCGCCCCCGG + Intronic
1001556547 5:172641185-172641207 GGGGGCGGAGCCGGCGGGCCCGG + Intergenic
1002498882 5:179634485-179634507 CACCGCGGAGGAGGCGGCCCTGG - Intronic
1002502794 5:179658039-179658061 CACCGCGGAGGAGGCGGCCCTGG + Intergenic
1002653519 5:180723106-180723128 GTGTGTGGAGCAGGGGGTCCAGG + Intergenic
1002700967 5:181124570-181124592 GTGGGAGGAGCAGGTGGCCAGGG + Exonic
1002705126 5:181155655-181155677 GTGGGAGGAGCAGGTGGCCAGGG - Exonic
1002888053 6:1312920-1312942 GGGCGCGGAGGAGGCGATCCCGG + Exonic
1003551878 6:7107856-7107878 GGGCGAGGAGCTGGCGACCCCGG - Exonic
1004217554 6:13716779-13716801 GTGCGCGGCGCTCGCGGGCCAGG + Intergenic
1005852579 6:29832870-29832892 GTGCCCAGAGCAGGTTGCCCTGG + Intergenic
1006379980 6:33691754-33691776 GTAGGAGGAGCAGGCAGCCCGGG + Intronic
1007105815 6:39282245-39282267 GTGCCCAGAGCAGGTGGCCCAGG + Intergenic
1007390237 6:41546495-41546517 GGGCGCGGCGCAGGCGGCGGCGG + Exonic
1013048936 6:106512791-106512813 GAGCGGGGAGGAGGCGGCGCGGG + Exonic
1015366390 6:132401581-132401603 GCGCGCCCTGCAGGCGGCCCGGG - Intergenic
1017470393 6:154733222-154733244 GGGCGAGGCGCGGGCGGCCCCGG + Intergenic
1017884967 6:158591333-158591355 GTGGAAGGAGCAGGTGGCCCTGG + Intronic
1018400445 6:163415023-163415045 GCGCGCGGTGCCGGCCGCCCCGG + Exonic
1018960066 6:168441554-168441576 GCACGGGGAGCAGGTGGCCCCGG + Intronic
1019425689 7:975565-975587 GAGCGCCGAGCAGGCACCCCGGG + Exonic
1019524550 7:1474862-1474884 GTGAGGGGAGCCAGCGGCCCCGG - Intronic
1020785861 7:12571306-12571328 GTGCGCTGAGGCAGCGGCCCTGG - Intronic
1022106362 7:27200220-27200242 GTGGGCGGAGCGGGGGGGCCGGG - Intergenic
1022790693 7:33686162-33686184 GTGTGTGGCGCACGCGGCCCAGG + Intergenic
1023016054 7:35969185-35969207 GTGTCCGGAGCAGGCGGCAGAGG + Intergenic
1024499815 7:50093126-50093148 GAGCAGGGAGCCGGCGGCCCGGG + Exonic
1024919862 7:54545236-54545258 GTGAGAGGAGCTGGCCGCCCTGG - Intronic
1026009981 7:66629009-66629031 GCGGGCGGAGGCGGCGGCCCCGG - Exonic
1029270418 7:99374227-99374249 GGGCGGGGAGCAGGCGGTCCGGG - Intronic
1030659623 7:112205898-112205920 GCGCGCCGAGCAGGCGGTGCGGG + Intronic
1031966717 7:128032328-128032350 GGGCGGGGAGGAAGCGGCCCGGG - Intronic
1032548016 7:132759589-132759611 GGGAGGGGAGCAAGCGGCCCTGG + Intergenic
1035201989 7:157273594-157273616 GCGCCCGGTGCAGGCCGCCCAGG + Intergenic
1035725696 8:1823899-1823921 GTGGGTGGAGCAGGCCGTCCGGG + Intergenic
1036773661 8:11595409-11595431 GTGGGCTCAGCAGCCGGCCCTGG + Intergenic
1040386433 8:46917849-46917871 GCGCGGGGAGCAGGAGGCCGGGG + Intergenic
1041117931 8:54558571-54558593 CTGCGCAGTGCAGGCCGCCCAGG - Intergenic
1041689941 8:60678899-60678921 CGCCGCGGAGGAGGCGGCCCGGG + Exonic
1042591895 8:70404119-70404141 GTCCTCTGAGAAGGCGGCCCGGG + Intergenic
1042858988 8:73294845-73294867 GTGCGCAGCGGAGGCGGCACGGG - Exonic
1044685665 8:94823434-94823456 GAGCGCGGAGGCGGCGGACCGGG + Exonic
1045336133 8:101205689-101205711 CTGCGAGGAGCAGGCGGGGCGGG - Intronic
1056356458 9:85805569-85805591 GAGGGCCGAGCCGGCGGCCCGGG + Intergenic
1057189673 9:93079662-93079684 GTGGGAGCAGCAGGTGGCCCGGG - Intronic
1059299018 9:113298013-113298035 GTGGGCACAGCAGGCGGCGCCGG + Exonic
1060208916 9:121698923-121698945 GTGAGCGGGGCGGCCGGCCCTGG + Intronic
1060406769 9:123376710-123376732 GAGCTGGGAGCAGGCTGCCCTGG - Intronic
1060555316 9:124504831-124504853 GGGCGCGGGGCTGGCGGCGCGGG + Intronic
1060806259 9:126579173-126579195 GGGCTGGGAGCAGGCGGCCCGGG - Intergenic
1060811092 9:126611876-126611898 ATGCCCGGAGAAGGCGGCTCAGG + Intergenic
1060990244 9:127844909-127844931 GCGAGCCGAGAAGGCGGCCCAGG + Intronic
1061208457 9:129177420-129177442 GGGCGCGGAGCAGGCGGCCGGGG + Exonic
1061577557 9:131516933-131516955 GTAAGGGGAGCAGGTGGCCCTGG - Intronic
1062213266 9:135376000-135376022 GTGCTCGGAGCAGACAGCACAGG - Intergenic
1062345977 9:136115518-136115540 GTGTCCGGAGCAGGCGGCAGAGG - Exonic
1062355661 9:136160790-136160812 GGGCGGGAAGCTGGCGGCCCCGG + Intergenic
1062462039 9:136666154-136666176 GGGGGCGGAGCAGGCGGCACAGG - Intronic
1062490650 9:136803385-136803407 GTGAGCAGAGCAGGCTGGCCGGG - Intronic
1062520257 9:136954665-136954687 GTGAGGGGAGGAGGTGGCCCAGG - Intronic
1062524122 9:136971475-136971497 CTGCACGGAGCAGGCGGGTCAGG - Intronic
1187397643 X:18932009-18932031 GTGCGCAAAGCAGGCAGGCCAGG - Intronic
1189316242 X:40058802-40058824 GTGCTCGGGGCAGGTGGCCTGGG - Intronic
1197774181 X:130109505-130109527 GTGCGGGGCGGGGGCGGCCCAGG + Intronic
1200063975 X:153496071-153496093 CTGAGCAGAGCAGGGGGCCCAGG + Intronic
1200068695 X:153517540-153517562 GTGCGCGGCGCAGGGGCCTCGGG - Intergenic
1200098181 X:153673847-153673869 GTGCGCGGAGGGGGCGGGGCCGG - Intronic
1200235638 X:154466583-154466605 GTGCTTGGAGCGGGTGGCCCAGG - Intronic
1200884076 Y:8251951-8251973 GGGCGGGGAGCAGGGGACCCAGG + Intergenic